The steps in genome sequencing

Size: px
Start display at page:

Download "The steps in genome sequencing"

Transcription

1 Genome Annotation

2 The steps in genome sequencing Generate genome sequence Assemby ORF caing trna identification rrna identification Functiona annotation

3 Annotating Genomes Identifying which protein performs which function

4

5 Why annotate a genome? Cataog what's there Identify what's missing but shoud be there! Things you don't know In vitro growth Mycopasma pneumoniae Comparative genomics Hypothesis generation

6 The goas of annotation Exchange information with others Compare annotations between organisms

7 How to annotate a genome? Sequence Assembe Identify open reading frames Putative proteins

8 Putative protein Open Reading Frame (ORF) A stretch of amino acids with no stop codon Coding Sequence (CDS) An ORF that coud encode a protein Protein encoding gene (PEG) An ORF that coud encode a protein Hypothetica protein = putative protein Something that has not been experimentay shown Poypeptide

9 PEGS E. coi 4,391 genes 4,288 genes that make proteins (pegs)

10 How to annotate a genome? Sequence Assembe Identify open reading frames Putative proteins Assign functions to proteins BLAST HMMR Psi-BLAST

11 Traditiona genome annotation

12 BLAST Simiarities Traditiona genome annotation

13 BLAST Simiarities Traditiona genome annotation

14 BLAST Simiarities Traditiona genome annotation

15 BLAST Simiarities Traditiona genome annotation

16 BLAST Simiarities Traditiona genome annotation

17 BLAST Simiarities Traditiona genome annotation

18 BLAST Simiarities Traditiona genome annotation

19 BLAST Simiarities Traditiona genome annotation

20 BLAST Simiarities Traditiona genome annotation

21 BLAST Simiarities Traditiona genome annotation

22 BLAST Simiarities Traditiona genome annotation

23 BLAST Simiarities Traditiona genome annotation

24 BLAST Simiarities Traditiona genome annotation

25 Protein Famiies

26 Protein Famiies

27 Protein Famiies

28 Protein Famiies

29 Gene Ontoogy Ontoogy A hierarchy of functions Does not need to be inear - Directed Acycic Graph Controed Vocabuary Decides which words or phrases to use

30 GO Gene ontoogy A eukaryotic focus - Drosophia - Mus - Saccharomyces - Homo

31 GO Ceuar component The parts of a ce Moecuar function e.g. igand binding Bioogica processes What things do

32 GO Terms [GO ID, function] e.g: GO: Ontoogy: moecuar function Name: pyruvate kinase activity

33 GO Terms [GO ID, function] e.g: GO: Ontoogy: moecuar function Name: pyruvate kinase activity Mainy assigned by BLAST/HMMER/... etc

34 Directed Acycic Graph Moecuar function Cataytic activity Transferase activity Transferase activity, transferring phosphorous Kinase activity phosphotransferase activity, acoho group as acceptor Pyruvate kinase activity

35 Probems Annotation by committee Eukaryotic focus Some efforts to counter that - Owen White - Arriane Toussaint Not very deep Strict controed vocabuary

36 Aternatives

37 Basic bioogy aci acz acy aca Jacob & Monod, 1961

38 Basic bioogy aci acz acy aca

39 Different types of custering < 80 % < 80 % < 80%

40 Different types of custering < 80 % < 80 % < 80%

41

42 Different types of custering < 80 % < 80 % < 80%

43 Heme / chorophy metaboism is conserved They are both porphyrins

44 Occurrence of custering in different genomes 1 Custers of genes w/ maximum 80% identity Genes in subsystems in custers Tota number of genomes in group 120 Fraction of genes in custers Number of genomes

45 The Subsystems Approach to Annotation Subsystem is a generaization of pathway coection of functiona roes jointy invoved in a bioogica process or compex Functiona Roe is the abstract bioogica function of a gene product atomic, or user-defined, exampes: - 6-phosphofructokinase (EC ) - LSU ribosoma protein L31p - Streptococca viruence factors - Shoud not contain putative, thermostabe, etc Popuated subsystem is compete spreadsheet of functions and roes

46 Histidine Degradation Conversion of histidine to gutamate Functiona roes defined in tabe Incusion in subsystem is ony by functiona roe Controed vocabuary

47 Subsystem Spreadsheet Subsystem Spreadsheet Organism Variant HutH HutU HutI GuF HutG NfoD ForI Bacteroides thetaiotaomicron 1 Desufotea psychrophia 1 Haobacterium sp. 2 Deinococcus radiodurans 2 Bacius subtiis 2 Cauobacter crescentus 3 Pseudomonas putida 3 Xanthomonas campestris 3 Q8A4B3 Q8A4A9 Q8A4B1 Q8A4B0 gi gi gi gi Q9HQD5 Q9HQD8 Q9HQD6 Q9HQD7 Q9RZ06 Q9RZ02 Q9RZ05 Q9RZ04 P10944 P25503 P42084 P42068 P58082 Q9A9MI P58079 Q9A9M0 Q9A9L9 Q88CZ7 Q88CZ6 Q88CZ9 Q88D00 Q88CZ3 Q8PAA7 P58988 Q8PAA6 Q8PAA8 Q8PAA5 Listeria monocytogenes -1 Coumn headers taken from tabe of functiona roes Rows are seected genomes or organisms Ces are popuated with specific, annotated genes Functiona variants defined by the annotated roes Variant code -1 indicates subsystem is not functiona Custering shown by coor

48 The Popuated Subsystem Subsystem Spreadsheet Organism Variant HutH HutU HutI GuF HutG NfoD ForI Bacteroides thetaiotaomicron 1 Desufotea psychrophia 1 Haobacterium sp. 2 Deinococcus radiodurans 2 Bacius subtiis 2 Cauobacter crescentus 3 Pseudomonas putida 3 Xanthomonas campestris 3 Q8A4B3 Q8A4A9 Q8A4B1 Q8A4B0 gi gi gi gi Q9HQD5 Q9HQD8 Q9HQD6 Q9HQD7 Q9RZ06 Q9RZ02 Q9RZ05 Q9RZ04 P10944 P25503 P42084 P42068 P58082 Q9A9MI P58079 Q9A9M0 Q9A9L9 Q88CZ7 Q88CZ6 Q88CZ9 Q88D00 Q88CZ3 Q8PAA7 P58988 Q8PAA6 Q8PAA8 Q8PAA5 Listeria monocytogenes -1

49 Nan-operon, a key pathway within the Siaic Acid Metaboism subsystem Microbia siaic acid metaboism has now been firmy estabished as a viruence determinant in a range of infectious diseases

50 The nan-operon

51 Comparison of annotations within the conserved custer (nan-operon) Coor coding for annotations: - green, consistent - yeow; genera cass; - gray, inconsistent or not informative

52 Methionine Biosynthesis From here You need to get to here

53

54

55 ?

56 ? Missing genes?

57 Hypothesis testing that eads to the wet ab...

58 Subsystems deveoped based on Wet ab Chromosoma context Metaboic context Phyogenetic context Microarray data Proteomics data

59 How can we compare annotations There are severa groups doing annotations of microbia genomes How do we compare them?

60 Caveat emptor!

61 Natura Metrics Number of subsystems defined Number of functiona roes defined Number of genes connected to functiona roes

62 Annotations for some genomes

63 Appied Metrics Number of soid connections of gene to functiona roe where soid is 1. supported by experimenta data 2. connected to functiona roe and in chromosoma custer with genes impementing functiona roes from the same subsystem 3. ony gene in genome connected to a functiona roe in an active variant of a subsystem Reactions, GO terms, Artices, Other databases cross references (number and diversity)

64 Appied Metrics

65 Comparison of annotations within the conserved custer (nan-operon) Coor coding for annotations: - green, consistent - yeow; genera cass; - gray, inconsistent or not informative

66 Tamudic question * If I find the identica protein sequence in two different organisms, is it doing the same function in both organisms? Per: Eio Schaecter, Sma Things Considered. A tamudic question is unanswerabe

67 hisa FIG function: Phosphoribosyformimino-5-aminoimidazoe carboxamide ribotide isomerase (EC ) Other functions in RefSeq: phosphoribosyformimino-5-aminoimidazoe carboxamide phosphoribosyformimino-5-aminoimidazoe carboxamide ribotide isomerase phosphoribosyformimino-5-aminoimidazoe carboxamide ribotide... 1-(5-phosphoribosy)-5-[(5- phosphoribosyamino)methyideneamino] imidazoe-4-carboxamide isomerase N-(5-phospho-L-ribosy-formimino)-5-amino-1-(5- phosphoribosy)-4-imidazoecarboxamide isomerase N-(5'-phospho-L-ribosy-formimino)-5-amino-1-(5'-phosphoribosy)-4-imidazoecarboxamide isomerase N-(5'-phospho-L-ribosy-formimino)-5-amino-1- (5'- phosphoribosy)-4-imidazoecarboxamide isomerase N-(5'-phospho-L-ribosy-formimino)-5-amino-1- (5'-phosphoribosy)-4-imidazoecarboxamide isomerase N-(5'-phospho-L-ribosy-formimino)-5-amino-1- (5'-phosphoribosy)-4- imidazoecarboxamide isomerase Phosphoribosy isomerase A [1-[5-phosphoribosy]-5-[[5-phosphoribosyamino]methyideneamino] imidazoe-4-carboxamide isomerase]

68 Measuring Consistency Define a set of protein famiies such that each famiy contains genes paying the same function Attach functiona roes to protein famiies Measure the consistency of the annotations made to genes within each famiy 1. "consistency" is the odds that two proteins from the same famiy have the same function 2. Evauate both famiies and functions.

69 Consistency among databases (2008)

70 Number of RefSeq proteins in famiies

71 How to measure accuracy If everything was caed hypothetica protein the database woud be 100% consistent Need to measure accuracy (specificity) as we as consistency Sampe 100 proteins at random from curated set (i.e. that are beieved to be correct) Manuay inspect annotations to score correctness

72 Probems Subsytems are biased! Subsystems are inaccurate! Merging annotations between different groups is poitica/psychoogica not technica!

73 Probems E. coi 4,391 genes 4,288 genes that make proteins (pegs) 676 genes that make enzymes 15% of genes encode enzymes!

74 The SEED Famiy

75 Three eve hierarchy Over 1,000 Subsystems Amino Acids and Derivatives Aanine, serine, and gycine Serine Biosynthesis Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Methionine Biosynthesis Make your own subsystems!

76 Cass # SS Cass # SS Amino Acids and Deriva/ves 56 Nuceosides and Nuceo/des 14 Carbohydrates 97 Phosphorus Metaboism 6 Ce Division / Cyce 10 Photosynthesis 9 Ce Wa and Capsue 50 Potassium metaboism 3 Custering-based ss 193 Protein Metaboism 52 Cofactors, Vitamins, Pigments 43 RNA Metaboism 39 DNA Metaboism 30 Regua/on/signaing 23 FaMy Acids, Lipids, and Isoprenoids 22 Respira/on 44 Membrane Transport 41 Secondary Metaboism 24 Metaboism of Aroma/c Compounds 30 Stress Response 37 Mo/ity and Chemotaxis 8 Sufur Metaboism 12 Nitrogen Metaboism 11 Viruence 116

77 Annotation of Compete Genomes Automated user originated processing Takes 1-7 hours depending on size and compexity of the genome ~2,000 externa submissions, incuding hundreds of genomes not yet pubicy reeased. Reannotation of >500 genomes compete 1,000 users, 200 organizations, 25 countries. hmp://rast.nmpdr.org/

78 The annotation process (compete genomes) Find the phyogenetic neighborhood of your genome Look for proteins that reated organisms have Core proteins Subset of a subsystems Use those cas as a training set for critica/ gimmer Intrinsic training set!

79 This one s for Gary

80 Automatic metaboic reconstruction Subsystem, GO, and KEGG connections KEGG EC numbers KEGG reaction numbers SEED reaction numbers (Chris Henry) Metaboic fux modes Automaticay generate FBA matrices (Aaron Best/ Matt DeJongh; Hope Coege)

81

82 The Popuated Subsystem

83 Automaticay compare metaboic reconstructions

84 Find and suggest candidate functions Rapidy correct missing annotations Add more members to subsystems Improves future genome annotations! (especiay with new subsystems)

85 RAST usage grows...

86 RAST coverage...

The SEED Family

The SEED Family The SEED Family www.nmpdr.org www.theseed.org Number of known sequences How much has been sequenced? 100 Environmentalbacteria sequencing l genome s First bacterial genome Year 1,000 bacteria l genome

More information

Practices for Improving Quality and Safety

Practices for Improving Quality and Safety 2 Practices for Improving Quaity and Safety Practices for Improving Quaity and Safety The capabiity of boards and board quaity committees to function effectivey and to move appropriatey between fiduciary

More information

Reintroduction of the local breeds of sheep and goats in Malta

Reintroduction of the local breeds of sheep and goats in Malta Reintroduction of the oca breeds of sheep and goats in Mata Bunde R. in Gabiña D. (ed.). Strategies for sheep and goat breeding Zaragoza : CIHEAM Cahiers Options Méditerranéennes; n. 11 1995 pages 97-100

More information

Applied bioinformatics in genomics

Applied bioinformatics in genomics Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics

More information

Defense Does Not. Spends on Software

Defense Does Not. Spends on Software -._._..._-..... -._.. -- _.._... _,.......,..-. ---_..-.- _._.. --..-. -. -. -.--...-_- _.^...-.-..-.._-.-.- _....- -..- *IIy IV) 1 3 4.0 i * EMBEDDED COMPUTER SYSTEMS Defense Does Not Know How Much It

More information

Name HOUR EXAM II BIOLOGY 108 FALL, 2003

Name HOUR EXAM II BIOLOGY 108 FALL, 2003 Name First Last PD Number - (Pease Print) HOUR EXAM BOLOGY 108 FALL, 2003 n the spirit of the honor code, pedge that have neith 1 Signature 2 3 4 5 6 7 8 9 10 1. (10 points) From the foowing ist circe

More information

BIOL4. General Certificate of Education Advanced Level Examination June Unit 4 Populations and environment

BIOL4. General Certificate of Education Advanced Level Examination June Unit 4 Populations and environment Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initias Genera Certificate of Education Advanced Leve Examination June 2012 Question 1 2 Mark Bioogy

More information

Liability Data Reporting: Lessons Learned from the 2016 data collection process and changes for the 2017 LDT template and collection process

Liability Data Reporting: Lessons Learned from the 2016 data collection process and changes for the 2017 LDT template and collection process 1/31/2017 Fifth Industry Diaogue Liabiity Data Reporting: Lessons Learned from the 2016 data coection process and changes for the 2017 LDT tempate and coection process Dominique Laboureix, Member of the

More information

CHAPTER 5 SUMMARY AND CONCLUSION. 188 P a g e

CHAPTER 5 SUMMARY AND CONCLUSION. 188 P a g e CHAPTER 5 SUMMARY AND CONCLUSION 188 P a g e Deinococcus radiodurans R1 exhibits an extraordinary tolerance to various abiotic stresses including radiations and desiccation. The amazing radioresistance

More information

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

More information

BIOL4. General Certificate of Education Advanced Level Examination January Unit 4 Populations and environment

BIOL4. General Certificate of Education Advanced Level Examination January Unit 4 Populations and environment Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initias Genera Certificate of Education Advanced Leve Examination January 2011 Question 1 2 Mark Bioogy

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Chapter 2 Understanding the PMBOK Guide

Chapter 2 Understanding the PMBOK Guide Chapter 2 Understanding the PMBOK Guide Chapter Summary This chapter examines: The PMBOK Guide is a guide rather than a methodoogy and the difference is expored. This section aso summarizes some important

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12212 Supplementary Discussion Contamination Assessment We evaluated the amount of human contamination in our viral DNA preparations by identifying sequences

More information

Statistical Assessment of Changes in Bird Certification Rules for Aero-Engines Through Time

Statistical Assessment of Changes in Bird Certification Rules for Aero-Engines Through Time University of Nebraska - Lincon DigitaCommons@University of Nebraska - Lincon 2011 Bird Strike North America Conference, Niagara Fas Bird Strike Committee Proceedings 9-2011 Statistica Assessment of Changes

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

What is necessary for life?

What is necessary for life? Life What is necessary for life? Most life familiar to us: Eukaryotes FREE LIVING Or Parasites First appeared ~ 1.5-2 10 9 years ago Requirements: DNA, proteins, lipids, carbohydrates, complex structure,

More information

Gene Prediction Group

Gene Prediction Group Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT

More information

Research on Knowledge Gap Recognition Mechanism of Virtual Industry Cluster

Research on Knowledge Gap Recognition Mechanism of Virtual Industry Cluster Research Journa of Appied Sciences, Engineering and Technoogy 5(14): 3810-3816, 2013 ISSN: 2040-7459; e-issn: 2040-7467 Maxwe Scientific Organization, 2013 Submitted: October 17, 2012 Accepted: December

More information

Energy Prices and the Laws of Supply and Demand

Energy Prices and the Laws of Supply and Demand Energy Prices and the Laws of Suppy and Demand Summary: By using the aws of suppy and demand, students demonstrate how the marketpace sets energy prices and show how these prices change. Objectives Students

More information

Module I: Introduction Lecture 1 4 February, 2010

Module I: Introduction Lecture 1 4 February, 2010 Module I: Introduction 20.109 Lecture 1 4 February, 2010 Introduction to: Module Overview Fundamental concepts and techniques in molecular biology A powerful and accessible strategy (SELEX) for identifying

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

Power and Sample-size Estimation for Microbiome Studies. Dr Chimusa Department of Pathology University of Cape Town AGe, 2017

Power and Sample-size Estimation for Microbiome Studies. Dr Chimusa Department of Pathology University of Cape Town AGe, 2017 Power and Sampe-size Estimation for Microbiome Studies Dr Chimusa Department of Pathoogy University of Cape Town AGe, 2017 Outine Overview of Tutoria Power Cacuation from R micropower too Power Cacuation

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

Prokaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine

Prokaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine 1 Abstract A prokaryotic annotation pipeline was developed to automatically annotate draft and complete bacterial genomes. The protein coding genes in the genomes are predicted by the combination of Glimmer

More information

Framework of Reputation Aggregation Management for Service-Oriented Business Ecosystems

Framework of Reputation Aggregation Management for Service-Oriented Business Ecosystems Framework of Reputation Aggregation Management for Service-Oriented Business Ecosystems Le Xin Tsinghua Nationa Laboratory for Information Science and Technoogy, Department of Automation, Tsinghua University

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

BIOL2. General Certificate of Education Advanced Subsidiary Examination June Unit 2 The variety of living organisms

BIOL2. General Certificate of Education Advanced Subsidiary Examination June Unit 2 The variety of living organisms Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initias Genera Certificate of Education Advanced Subsidiary Examination June 2011 Question 1 2 Mark

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Module I: Introduction

Module I: Introduction Module I: Introduction 20.109 Lecture 1 3 February, 2011 Introduction to: Module Overview Fundamental concepts and techniques in molecular biology Appreciating nucleic acids (RNA in particular) as more

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it What is life made of? 1665: Robert Hooke discovered that organisms are composed of individual compartments called cells

More information

Interaction of Cutibacterium (formerly Propionibacterium) acnes with bone cells: a step

Interaction of Cutibacterium (formerly Propionibacterium) acnes with bone cells: a step Title page Interaction of Cutibacterium (formerly Propionibacterium) acnes with bone cells: a step toward understanding bone and joint infection development Guillaume Ghislain Aubin,2 2 Bacteriology and

More information

What is necessary for life?

What is necessary for life? Life What is necessary for life? Most life familiar to us: Eukaryotes FREE LIVING Or Parasites First appeared ~ 1.5-2 10 9 years ago Requirements: DNA, proteins, lipids, carbohydrates, complex structure,

More information

Hammer-Capsule Hammer-Capsule 57.1 Introduction Hammer Capsule Specifications Product Description

Hammer-Capsule Hammer-Capsule 57.1 Introduction Hammer Capsule Specifications Product Description Hammer-Capsue 57.0 Hammer-Capsue 57.1 Introduction The Hammer-Capsue System consists of a sef contained, singe use, two-part gass capsue into which threaded anchor rod or reinforcing bars can be directy

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Computational gene finding

Computational gene finding Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

Scouts of the World Award YOUTH PROGRAMME

Scouts of the World Award YOUTH PROGRAMME 1 Scouts of the Word Award YOUTH PROGRAMME Introduction The Scouts of the Word Award chaenges a young peope, Scouts and non-scouts, to think about goba issues and act upon them in their oca community.

More information

Bacterial Genome Annotation

Bacterial Genome Annotation Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control

More information

Role: Sales Manager Name: Sample SM Candidate Date: 26 June 2012

Role: Sales Manager Name: Sample SM Candidate Date: 26 June 2012 Roe: Name: Saes Manager Sampe SM Candidate Date: 26 June 2012 :: Introduction This Saes Taent Assessment report is designed to hep you understand the candidate s potentia fit to the seected roe. This report

More information

Study Session 5 Urbanisation: Trends, Causes and Effects

Study Session 5 Urbanisation: Trends, Causes and Effects Study Session 5 Urbanisation: Trends, Causes and Effects Copyright 2016 The Open University Contents Introduction 3 Learning Outcomes for Study Session 5 3 5.1 Urbanisation trends 3 5.1.1 Goba trends in

More information

Translation Mechanisms

Translation Mechanisms Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

KEGG Kyoto Encyclopedia of Genes and Genomes

KEGG Kyoto Encyclopedia of Genes and Genomes KEGG Kyoto Encyclopedia of Genes and Genomes Objectives of KEGG Computerize current knowledge of biological systems in terms of pathway of interacting molecules or genes Maintain gene catalogs for sequenced

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

ENZYMES AND METABOLIC PATHWAYS

ENZYMES AND METABOLIC PATHWAYS ENZYMES AND METABOLIC PATHWAYS This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. Enzymes build

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

Nationally Important Agro-biodiversity Heritage Sites (NIABHS): An Innovative Concept for Sustainable Conservation Efforts

Nationally Important Agro-biodiversity Heritage Sites (NIABHS): An Innovative Concept for Sustainable Conservation Efforts Nationay Important Agro-biodiversity Heritage Sites (NIABHS): An Innovative Concept for Sustainabe Conservation Efforts P. K. Singh ICAR- Indian Institute of Sugarcane Research, Dikusha P.O., Lucknow 226

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Transcription Start Sites Project Report

Transcription Start Sites Project Report Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Annotating the Genome (H)

Annotating the Genome (H) Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

Gene Finding Genome Annotation

Gene Finding Genome Annotation Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics

More information

Biochemistry study of the molecular basis of life

Biochemistry study of the molecular basis of life Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living

More information

Modular design of the nic-gene cluster within the Arthrobacter genus

Modular design of the nic-gene cluster within the Arthrobacter genus Modular design of the nic-gene cluster within the Arthrobacter genus Marius I. Mihăşan* Laboratory of Biochemistry, Faculty of Biology, University A. I. Cuza, Iaşi *marius.mihasan@uaic.ro, Carol I Bvd.,

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

SWOT Analysis. Copyright 2016 The Open University

SWOT Analysis. Copyright 2016 The Open University SWOT Anaysis Copyright 2016 The Open University 2 of 16 Monday 26 February 2018 Contents SWOT Anaysis 4 1 When to use a SWOT anaysis 5 2 Exporing the environment of a project 6 3 The four components of

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

ORFs, unknown function GC (%) # of ORFs. Fen-75cm Fn (91) Nitrosopumilus maritimus

ORFs, unknown function GC (%) # of ORFs. Fen-75cm Fn (91) Nitrosopumilus maritimus Table S1 Comparison of genome properties for 10 distinct bins identified from two metagenomes. The mean coverage is calculated by dividing total read counts with read length. ORF, open reading frame. Nearest

More information

Fermentation Processes Monitoring and Control Using Generalized Nets

Fermentation Processes Monitoring and Control Using Generalized Nets Годишник на секция Информатика Съюз на учените в България Том 2, 2009, 38-45 Annua of Informatics Section Union of Scientists in Bugaria Voume 2, 2009, 38-45 Fermentation Processes Monitoring and Contro

More information

Computational gene finding. Devika Subramanian Comp 470

Computational gene finding. Devika Subramanian Comp 470 Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Computational gene finding

Computational gene finding Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

Part DECIDING WHICH MARKETS TO ENTER

Part DECIDING WHICH MARKETS TO ENTER II Part DECIDING WHICH MARKETS TO ENTER Introduction to Part II After considering the initia phase (Part I, The decision whether to internationaize) the structure of this part foows the process of seecting

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Building and Implementing a Balanced Scorecard Model at Cihan University Requirements and Steps

Building and Implementing a Balanced Scorecard Model at Cihan University Requirements and Steps Buiding and Impementing a Baanced Scorecard Mode at Cihan Dr. Nasrat A. Madah Dr. Imad Shihab Ahmad Khurram Sutan Head of Business Administration Business Administration Assistant Lecturer Department Department

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4

More information

Linking Gene Expression Patterns and Transcriptional Regulation in Plasmodium falciparum

Linking Gene Expression Patterns and Transcriptional Regulation in Plasmodium falciparum Linking Gene Expression Patterns and Transcriptional Regulation in Plasmodium falciparum Aidan J. Peterson Fox Chase Cancer Center 333 Cottman Avenue Philadelphia, PA 19111 (215) 728-4067 Aidan.Peterson@fccc.edu

More information

Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna)

Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna) Heredity B-4.3 Explain how DNA functions as the code of life and the blueprint for proteins. (Focus on DNA replication) B-4.4: Summarize the basic process involved in protein synthesis (including transcription

More information

DNA, RNA & Proteins Chapter 13

DNA, RNA & Proteins Chapter 13 DNA, RNA & Proteins Chapter 13 DNA stands for. What is DNA? - The genetic information that controls the activity of a cell. - Located in the of every one of your cells. What is the structure of DNA like?

More information

Simulation-Optimization Model For Fuzzy Waste Load Allocation

Simulation-Optimization Model For Fuzzy Waste Load Allocation Proceedings of the 6th WSEAS Int. Conf. on EVOLUTIONARY COMPUTING, Lisbon, Portuga, June 16-18, 25 (pp384-391) Simuation-Optimization Mode or uzzy Waste Load Aocation M. SAADAT POUR, A. ASHAR, O. BOZORG

More information

Functional analysis using EBI Metagenomics

Functional analysis using EBI Metagenomics Functional analysis using EBI Metagenomics Contents Tutorial information... 2 Tutorial learning objectives... 2 An introduction to functional analysis using EMG... 3 What are protein signatures?... 3 Assigning

More information

Designer Genes Tryout Test Carmel Science Olympiad

Designer Genes Tryout Test Carmel Science Olympiad Designer Genes Tryout Test 2018-2019 Carmel Science Olympiad Name: Score: / 105 Rank: (Do NOT complete score and rank, for officer use only) Directions: You will have 40 minutes to individually complete

More information

Landscape Ruggedness in Evolutionary Algorithms

Landscape Ruggedness in Evolutionary Algorithms Persona use of this materia is permitted. However, permission to reprint/repubish this materia for advertising or promotiona purposes or for creating new coective works for resae or redistribution to servers

More information

BISHOPAgEd.Weebly.com. Weeks: Dates: 1/18-1/29 Unit: RNA &Protein Synthesis. Monday Tuesday Wednesday Thursday Friday. FFA Meeting 6pm 27 E

BISHOPAgEd.Weebly.com. Weeks: Dates: 1/18-1/29 Unit: RNA &Protein Synthesis. Monday Tuesday Wednesday Thursday Friday. FFA Meeting 6pm 27 E Ms. King BISHOPAgEd.Weebly.com Name: Period: Weeks: 21-22 Dates: 1/18-1/29 Unit: RNA &Protein Synthesis Monday Tuesday Wednesday Thursday Friday 18 NO School 19 E 20 O RNA Part 1 FFA Meeting 6pm 21 E 22

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Assembly Instructions

Assembly Instructions Assemby Instructions GENERAL Optoeectronic semiconductor devices can be mounted in any position. Connection wires may be bent provided the bend is not ess than 1.5 mm from the bottom of the case. During

More information

Algorithms in Bioinformatics ONE Transcription Translation

Algorithms in Bioinformatics ONE Transcription Translation Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

From Sequence to Knowledge: The Art & Science of Phage Genome Annotation. Ramy K. Aziz Cairo University

From Sequence to Knowledge: The Art & Science of Phage Genome Annotation. Ramy K. Aziz Cairo University From Sequence to Knowledge: The Art & Science of Phage Genome Annotation Ramy K. Aziz Cairo University A helping hand through The Annotation Bottleneck From Sequence to Knowledge: PhAnToMe, RAST, and the

More information

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

More information

Ocean fertilization. An overview of an early promise geoengineering technique for carbon dioxide reduction. Phil Williamson

Ocean fertilization. An overview of an early promise geoengineering technique for carbon dioxide reduction. Phil Williamson Ocean fertiization An overview of an eary promise geoengineering technique for carbon dioxide reduction Phi Wiiamson pwiiamson@ueaacuk UNFCCC SBSTA Bonn 2 June 2011 Issues appicabe to a CDR geoengineering

More information

KEGG: Kyoto Encyclopedia of Genes and Genomes

KEGG: Kyoto Encyclopedia of Genes and Genomes 1999 Oxford University Press Nucleic Acids Research, 1999, Vol. 27, No. 1 29 34 KEGG: Kyoto Encyclopedia of Genes and Genomes Hiroyuki Ogata, Susumu Goto, Kazushige Sato, Wataru Fujibuchi, Hidemasa Bono

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome

Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Introduction to Molecular Biology Lodish et al Ch1-4 http://www.ncbi.nlm.nih.gov/books EECS 458 CWRU Fall 2004 DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Roadmap The Cell Lodish

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Integrated Parallel Bottom-up and Top-down Approach to the Development of Agent-based Intelligent DSSs for Emergency Management

Integrated Parallel Bottom-up and Top-down Approach to the Development of Agent-based Intelligent DSSs for Emergency Management TEMS98: Disaster and Emergency Management: nternationa Chaenges for the Next Decade. The Fifth Annua Conference of The nternationa Emergency Management Society, Washington, D.C., May 19-22, 1998 ntegrated

More information