Received 2 July 1997/Returned for modification 6 August 1997/Accepted 20 October 1997
|
|
- Lily Doyle
- 6 years ago
- Views:
Transcription
1 INFECTION AND IMMUNITY, Jan. 1998, p Vol. 66, No /98/$ Copyright 1998, American Society for Microbiology Characterization of the Immunostimulatory Properties of Leishmania infantum HSP70 by Fusion to the Escherichia coli Maltose-Binding Protein in Normal and nu/nu BALB/c Mice ANA I. RICO, 1 GUSTAVO DEL REAL, 2 MANUEL SOTO, 1 LUIS QUIJADA, 1 CARLOS MARTINEZ-A., 2 CARLOS ALONSO, 1 * AND JOSE M. REQUENA 1 Centro de Biología Molecular Severo Ochoa 1 and Department of Immunology and Oncology, Centro Nacional de Biotecnología, 2 Consejo Superior de Investigaciones Científicas Universidad Autónoma de Madrid, Cantoblanco, E Madrid, Spain Received 2 July 1997/Returned for modification 6 August 1997/Accepted 20 October 1997 Leishmania infantum HSP70 has been described as an immunodominant antigen in both humans and dogs suffering from visceral leishmaniasis. In this study, we used L. infantum HSP70 fused to Escherichia coli maltose-binding protein (MBP), as the reporter protein, to analyze the influence of HSP70 on the immunogenicity of MBP in BALB/c mice. Plasmids were constructed to produce the three recombinant proteins used in this study, namely, MBP, L. infantum HSP70, and MBP-HSP70, which consists of MBP fused to the L. infantum HSP70 amino terminus. Immunization of BALB/c mice with the MBP-HSP70 fusion protein elicited humoral and cellular responses against MBP that were higher by an order of magnitude than those elicited by immunization with MBP alone or with a mixture of MBP and HSP70. Covalent linkage of MBP to HSP70 was essential for eliciting a strong anti-mbp immune response. Cytokine secretion and immunoglobulin G isotype analyses indicated that immunization with the MBP-HSP70 fusion protein preferentially induces a Th1 immune response. Immunization of athymic nu/nu mice with the MBP-HSP70 fusion protein unexpectedly gave rise to an anti-mbp humoral response showing features of a T-cell-dependent response. Thus, we present evidence that L. infantum HSP70 demonstrates an adjuvant effect in the immune response against a covalently linked reporter protein. The heat shock proteins (HSP) are produced by prokaryotic and eukaryotic cells in response to a variety of physiological insults. Those HSP belonging to the HSP90, HSP70, and HSP60 families are among the most highly conserved and abundant proteins found in living prokaryotic and eukaryotic organisms. Although they are classified as stress proteins, the HSP also have essential functions in the cell under normal growth conditions. These proteins are involved in the folding of newly synthesized proteins by preventing incorrect interactions within and between nonnative proteins (reviewed in reference 18). The HSP are also involved in several molecular processes of the immune system, such as immunoglobulin chain assembly (17), antigen processing and presentation (29), and the assembly of functional major histocompatibility complexes I and II (12). Although the abundance of the HSP may explain why they behave as dominant antigens in the immune response to a variety of pathogens (25, 26, 35), it is surprising that the immune system focuses its attention on a family of proteins with such a high degree of evolutionary conservation. It has been suggested that immune recognition of HSP of pathogens serves as a first line of defense as well as a source of autoimmune cascades that may develop through inappropriate cross-reactivity with self-hsp (8, 40). Of the HSP families, HSP70, in spite of being the most conserved protein, present in all organisms studied to date (16), is a major immunogen in infections caused by a number of pathogens, such as Schistosoma mansoni (19), Onchocerca volvulus (34), Plasmodium falciparum (2, 4, 5, 21), Histoplasma capsulatum (1), Trypanosoma * Corresponding author. Mailing address: Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, E Madrid, Spain. Phone: Fax: jmrequena@trasto.cbm.uam.es. cruzi (14, 23, 32), Trypanosoma congolense (6), and Leishmania (11, 24, 30, 36) and Mycobacterium (9, 15, 27, 33) spp. Epitope analysis of several of these HSP70 indicates the existence of multiple B- and T-cell epitopes throughout their primary structure (4, 13, 28, 31, 32, 41). The immunogenic properties of the HSP have been demonstrated in particular for Mycobacterium tuberculosis HSP70, which has been used successfully as an adjuvant-free carrier molecular (3). Recently, Suzue and Young (38) have further investigated the immunogenic potential of M. tuberculosis HSP70 by immunizing mice with a recombinant human immunodeficiency virus type 1 p24-hsp70 fusion protein. They demonstrated that in the absence of adjuvants, covalent linking of HSP70 to p24 was essential to elicit humoral and cellular immune responses to p24. Here, we have addressed the question of whether the immunostimulatory property of M. tuberculosis HSP70 is possessed by other HSP70. Based on the powerful immunogenic characteristics of Leishmania infantum HSP70 (30, 31), we analyzed whether L. infantum HSP70, when fused to an accompanying protein, can induce humoral and cell-mediated responses to the fused protein. Plasmid constructions, purification of proteins, mice, and immunizations. DNA coding for L. infantum HSP70 was amplified by PCR as described elsewhere (30). The amplification product was digested with EcoRI and HindIII restriction enzymes, purified on spin bind columns (FMC Bio Products, Rockland, Maine), and cloned in frame to the carboxyl terminus of the maltose-binding protein (MBP) encoded by the vector pmal-cri (New England Biolabs, Inc., Beverly, Mass.). The resulting clone was named pmal-rlihsp70. To obtain the recombinant protein MBP alone, the pmal-cri plasmid was digested with EcoRI, filled in with Klenow fragment, and religated with T4 DNA ligase. Consequently, the 347
2 348 NOTES INFECT. IMMUN. FIG. 1. Analysis of recombinants MBP, HSP70, and MBP-HSP70 fusion protein. (A) Schematic representation of recombinants MBP, HSP70, and MBP- HSP70 fusion protein and of their encoding plasmids. (B) Recombinant MBP (lane 1), HSP70 (lane 2), and the MBP-HSP70 fusion protein (lane 3) after purification, migration (SDS-PAGE), and staining with Coomassie blue. The sizes (in kilodaltons) of molecular size markers (lane M) are indicated on the left. modified vector, pmal-cri*, includes an in-frame stop codon four triplets downstream of the EcoRI restriction site. The pmal-cri* vector thus expresses the MBP moiety alone rather than the MBP-lacZa expressed by the original pmalcri plasmid. The pmal-rlihsp70 clone was digested with EcoRI and HindIII, the insert was cloned in the corresponding restriction sites of the vector pbluescript (Stratagene, La Jolla, Calif.), and the resulting clone was denominated pblsc70li. Clone pqe/hsp70 was created by subcloning the BamHI- HindIII insert of plasmid pblsc70li into the appropriate restriction sites of vector pqe9 (Qiagen, Hilden, Germany). Induction and purification of the recombinant proteins expressed by clones pmal-lihsp70 and pmal-cri* were performed as described in the manufacturer s instructions (New England Biolabs). The recombinant protein L. infantum HSP70, expressed by clone pqe/hsp70, was purified under denaturing conditions with a nitrilotriacetic acid-ni 2 column (Qiagen). Figure 1A shows a schematic representation of the recombinant proteins used. The purity of the recombinant proteins was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining (Fig. 1B). Female 12-week-old BALB/c mice and female 7-week-old, athymic BALB/c nu/nu mice were purchased from IFFA- CREDO (Lyon, France). The immunization schedule was the same as that described by Suzue and Young (38), i.e., mice were immunized intraperitoneally (i.p.) on days 0 and 21 with 50 pmol of the purified protein in 200 l of phosphate-buffered saline, which corresponds to 2.1, 3.5, and 5.6 g of MBP, HSP70, and the MBP-HSP70 fusion protein, respectively. The mice were periodically bled from the retro-orbital plexus. L. infantum HSP70 potentiates a specific humoral response against the covalently linked antigen. By using the data of Suzue and Young (38), we studied whether L. infantum HSP70 can elicit an immunostimulatory effect when used as a carrier molecule in adjuvant-free immunizations of mice. Escherichia coli MBP was chosen as the reporter antigen. Plasmid constructions encoding MBP, L. infantum HSP70, or the MBP- HSP70 fusion protein were obtained (Fig. 1). Groups of four BALB/c mice were immunized with MBP, HSP70, an MBP- HSP70 mixture, or the MBP-HSP70 fusion protein. One week after the last immunization, the anti-mbp immunoglobulin G (IgG) level in serum was determined with the FAST-ELISA (Becton Dickinson, Lincoln Park, N.J.) by using the coating antigen at a concentration of 2 g/ml. Horseradish peroxidaseconjugated anti-mouse IgG (Nordic Immunological Laboratories, Tilburg, The Netherlands) was used as the second antibody at a 1:2,000 dilution. The titer is expressed as the highest serum dilution giving an absorbance value four times higher than the preimmune serum reading (optical density, 0.050). Differences in antibody titers between groups of mice were compared with the two-tailed unpaired Student t test. Excel software (Microsoft Corporation) was used for statistical analysis. The anti-mbp IgG serum titers among mice immunized with MBP alone varied significantly, ranging from 8,000 to 256,000 (mean value ; standard deviation [SD] 10 5 ) (Fig. 2A). Similar serum titers and variations were found for serum samples from mice immunized with the MBP-HSP70 mixture (mean value ; SD ); this was an indication that the presence of HSP70 in the mixture did not influence the antibody response elicited by the MBP. The anti-mbp titers ( ;SD 10 5 ) detected in sera from mice immunized with the MBP-HSP70 fusion protein were approximately 1 order of magnitude greater than those observed in sera from mice immunized with MBP or the MBP- HSP70 mixture. It was observed, moreover, that while the titers of the anti-mbp humoral response in animals immunized with the protein alone or with the MBP-HSP70 mixture was highly variable, the anti-mbp titers in MBP-HSP70 fusion protein-immunized animals were uniform. It thus appears that L. infantum HSP70 can function, in the absence of an adjuvant, as an adjuvant-carrier molecule and can induce high antibody levels to the HSP70-accompanying protein; this effect occurs only when MBP is covalently linked to HSP70. To determine whether HSP70 may also condition the nature of the anti-mbp humoral response, the anti-mbp IgG1 and IgG2a isotypes resulting from administration of MBP, the MBP-HSP70 mixture, and the MBP-HSP70 fusion protein were analyzed (Fig. 2B). Th1 cytokines preferentially elicit an IgG2a antibody response, whereas Th2 cytokines stimulate IgG1 (7). The anti-mbp IgG1 and IgG2a titers induced by MBP immunization were not significantly different (P 0.308), with values of (SD ) and (SD ), respectively; the anti-mbp IgG1 and IgG2a titers in mice receiving the MBP-HSP70 mixture were also similar (P 0.665), with values of (SD ) and (SD ), respectively. However, in mice immunized with the MBP-HSP70 fusion protein, the IgG2a response was consistently higher than that of IgG1 (P ), with anti-mbp titers of (SD ) and (SD ), respectively. Thus, it seems that following the injection of the MBP-HSP70 fusion protein, there is a switch of anti-mbp antibodies towards an IgG2a isotype. The time course of anti-mbp IgG titer evolution was monitored over a 17-week period in the three groups of immunized
3 VOL. 66, 1998 NOTES 349 FIG. 2. Humoral immune response of BALB/c mice to different recombinant proteins. (A) Groups of four mice were immunized i.p. with MBP, an MBP- HSP70 mixture, or the MBP-HSP70 fusion protein as indicated in the text. The anti-mbp and anti-hsp70 IgG antibody titers were determined with the FAST- ELISA. The titer is expressed as the highest serum dilution factor giving an absorbance value four times greater than the value obtained with preimmune sera (optical density, 0.05). (B) Serum samples from mice immunized with MBP, the MBP-HSP70 mixture, or the MBP-HSP70 fusion protein were analyzed for anti-mbp IgG1 and IgG2a antibodies. (C) The time course of the anti-mbp antibody response is shown. Sera were obtained at the times indicated (in weeks) after the second immunization of the mice with MBP, the MBP-HSP70 mixture, or the MBP-HSP70 fusion protein. MBP HSP70, mixture; MBP-HSP70, fusion protein. mice (Fig. 2C). The antibody titer elicited by MBP or the MBP-HSP70 mixture had decreased to barely detectable levels by 9 weeks, whereas that induced by the MBP-HSP70 fusion protein experienced a decrease up to that time but remained above throughout the study period. The humoral response elicited by adjuvant-free immunization with MBP- HSP70 fusion protein can thus be considered long-lasting. To determine whether further immunization with the MBP- HSP70 fusion protein has a significant booster effect, the mice were reimmunized 20 weeks after the initial immunization with 50 pmol of the same MBP-HSP70 fusion protein preparation. One week after administration of the recombinant protein, anti-mbp IgG titers increased by 1 order of magnitude, reaching values of (SD ). This rapid and potent response reflects the immunological memory created by immunization with the MBP-HSP70 antigen. Immunization with the MBP-HSP70 fusion protein induces a powerful cellular response against MBP. To examine the ability of the MBP-HSP70 fusion protein to induce anti-mbp cellular responses, groups of four BALB/c mice were immunized subcutaneously at the tail base with 5 g of the MBP- HSP70 fusion protein, MBP, or bovine serum albumin (BSA; Sigma, St. Louis, Mo.). One week after immunization, draining inguinal and periaortic lymph nodes were removed, and singlecell suspensions of lymph node cells (LNC) were prepared and suspended in complete medium (RPMI 1640 supplemented with 10% fetal calf serum, 2 mm L-glutamine, and 10 M 2-mercaptoethanol). LNC (10 6 /well) were dispensed into 96- well microtiter plates. Cultures were challenged in triplicate with 2 g of MBP or concanavalin A (ConA; Sigma) per ml and incubated for 3 days at 37 C in 5% CO 2 ; after this, 1 Ci of [ 3 H]thymidine (5 Ci/mmol; Amersham Corp., Aylesbury, United Kingdom) was added to each well. After 16 h, the cells were harvested and [ 3 H]thymidine incorporation into DNA was measured by liquid scintillation counting. The specific incorporation was determined by subtracting the mean incorporation of triplicate control wells incubated with medium alone from the mean incorporation of the triplicate wells incubated with antigen. Table 1 shows the MBP-specific immune response of each group following in vitro T-cell stimulation with MBP. LNC from animals immunized with the MBP-HSP70 fusion protein proliferated in response to the antigen, whereas those from animals immunized with MBP alone did not. The proliferation levels of LNC from MBP-immunized animals were similar to those of LNC from control animals to which BSA had been administered (Table 1). The ability of the fusion protein to elicit cellular responses was also examined by determination of gamma interferon (IFN- ), interleukin 2 (IL-2), and IL-4 cytokines from LNC supernatants (Table 1). For cytokine determinations, LNC ( /well) from the same mice were seeded in 24-well plates and the cultures were challenged with 2 g of MBP or ConA per ml for 72 h at 37 C in 5% CO 2. IFN-, IL-4, and IL-2 production was measured in supernatants with an enzyme-linked immunosorbent assay kit (Genzyme Corp., Cambridge, Mass.). Results of the cytokine TABLE 1. Proliferation and cytokine production of LNC Immunization Stimulus a poration (cpm [ 3 H]thymidine incor- [mean SD]) b Concn (pg/ml) IFN- IL-2 IL-4 BSA Medium 2, ConA 50,313 2,246 2, MBP 4, MBP Medium 3, ConA 49,102 2,646 2, MBP 4, MBP-HSP70 fusion protein Medium 11,220 1, ConA 87,661 6,383 1, MBP 50,589 4, a The final concentrations of ConA and MBP were 2 g/ml. b Mean SD of triplicate determinations.
4 350 NOTES INFECT. IMMUN. FIG. 3. Western blot analysis of the specificity of the anti-hsp70 antibodies in immunized mice. (A) Total proteins of 10 7 human primary fibroblasts (lane 1), 10 7 T. cruzi epimastigotes (lane 2), and 10 7 L. infantum promastigotes (lane 3) were separated on SDS 10% PAGE gels and stained with Coomassie blue. The sizes (in kilodaltons) of the molecular size markers (lane M) are indicated on the right. (B to D) Equivalent protein gels were transferred to nitrocellulose membranes and incubated with anti-hsp70 monoclonal antibody 7.10 (B), serum from a mouse immunized with the MBP-HSP70 mixture (C), or serum from a mouse immunized with the MBP-HSP70 fusion protein (D). Sera were assayed at a 1:200 dilution. determinations were consistent with the proliferation assays in that only LNC from fusion protein-immunized mice secreted detectable amounts of IFN- and IL-2 when stimulated with MBP. IL-4 levels were low for all groups ( 20 pg/ml), in accord with the relatively low IgG1 (Th2-mediated) antibody response observed upon in vivo immunization. Analysis of the specificity of anti-hsp70 antibodies elicited by the MBP-HSP70 fusion protein. Since HSP70 is considered to be the most conserved protein present in all organisms (16), we analyzed the humoral response against L. infantum HSP70 and the specificity of the response elicited by immunization with the MBP-HSP70 fusion protein. This is of particular importance if this molecule is to be considered a practical alternative in the development of adjuvant-free vaccines. An autoimmune cascade caused by an inappropriate cross-reaction with self-hsp would obviously be undesirable. Immunization of mice with the MBP-HSP70 fusion protein induced high anti-hsp70 antibody titers, although they were lower (P 0.001) than those induced against the MBP moiety (Fig. 2A). The mean anti-hsp70 IgG titer was (SD ), while, as indicated above, the mean anti-mbp IgG titer in the same mice was The difference was even greater when anti-hsp70 IgG titers from MBP-HSP70 fusion proteinimmunized mice were compared with those of mice immunized with the MBP-HSP70 mixture. In this latter group, the mean anti-hsp70 IgG titer was relatively low ( ;SD ). The specificity of the humoral response was assayed by analysis of the recognition pattern of the antibodies to HSP70 from human fibroblasts, T. cruzi epimastigotes, and L. infantum promastigotes (Fig. 3A). The proteins were analyzed by standard SDS-PAGE (22) on 10% polyacrylamide gels. Samples of total protein were prepared from L. infantum promastigotes (WHO code MHOM/FR/78/LEM75), T. cruzi epimastigotes (strain G) (20), or human primary fibroblasts. After electrophoresis, the proteins were transferred to nitrocellulose membranes (Amersham). The filters were blocked with 5% nonfat dried milk powder in phosphate-buffered saline 0.5% Tween 20 and probed sequentially with primary and secondary antisera in blocking solution. A peroxidase immunoconjugate (Nordic Immunological Laboratories) was used as a secondary antibody, and specific binding was developed with 0.5 mg of 4-chloronaphthol (Sigma) per ml and 0.025% hydrogen peroxide. Proteins were probed in Western blots with either rat monoclonal antibody 7.10 (Fig. 3B), which recognizes HSP70 independently of its origin (39), serum from a mouse immunized with the MBP-HSP70 mixture (Fig. 3C), or serum from a mouse immunized with the MBP-HSP70 fusion protein (Fig. 3D). Anti-HSP70 antibodies induced by immunization with L. infantum HSP70 (alone or as a fusion protein) show no crossreactivity with HSP70 of mammalian origin. This selectivity of response is also evident in the course of natural L. infantum infection, since it has been observed that HSP70, one of the immunodominant antigens in Leishmania infection, elicits highly specific antibodies only to the parasite protein (30). The cross-reactivity with T. cruzi HSP70, present in some sera (Fig. 3D), can be explained by the high degree of sequence conservation between Leishmania and T. cruzi proteins (30). Crossreactivity with T. cruzi HSP70 was observed in 75% of the serum specimens from mice immunized with the MBP-HSP70 fusion protein (data not shown). Immunization with the MBP-HSP70 fusion protein induces a humoral response in athymic BALB/c nu/nu mice. To study T-cell involvement in the MBP-HSP70 fusion protein-induced humoral response, athymic BALB/c nu/nu mice were immunized twice with MBP, HSP70, or the MBP-HSP70 fusion protein. A positive anti-mbp antibody response was detected in nu/nu mice only after immunization with the MBP-HSP70 fusion protein (Fig. 4). The humoral response elicited in these mice was a typical, T-cell-dependent response. Following the first immunization, an IgM isotype was detected, whereas IgG predominated after challenge (Fig. 4B). The anti-mbp antibodies elicited in the fusion protein-immunized mice were essentially IgG2a (antibody titers, 1,200). Immunization of nu/nu mice with MBP or HSP70 elicited no humoral response (Fig. 4). The adjuvant effect of HSP70 was first demonstrated after immunization with Plasmodium peptides or meningococcal oligosaccharides cross-linked to M. tuberculosis HSP70 (3). Our results show that this carrier-adjuvant effect is also developed by L. infantum HSP70. Another example of this adjuvant effect is the anti-p53 antibody response in cancer patients, which is elicited only if mutated p53 is complexed with HSP70 in tumor cells (10). Thus, it seems that the adjuvant effect may be a common feature of this class of proteins. This phenomenon can be related, at the molecular level, to the tumor-specific immunity elicited by vaccination with HSP isolated from cognate cancer cells (37). Two interesting features can be deduced from the analysis of the anti-hsp70 humoral response elicited in the mice immunized with L. infantum HSP70. First, the anti-hsp70 antibodies were directed specifically against L. infantum HSP70 epitopes. Such restriction in epitope selection would evidently be desirable if L. infantum HSP70 was to be used in adjuvantfree vaccination. Second, the anti-hsp70 antibody titer was clearly lower than the anti-mbp antibody titer in fusion protein-immunized mouse sera. It can be postulated that the humoral response to L. infantum HSP70 is partially restricted, perhaps through mechanisms involved in regulation of responses to self components (8). These features, together with the facts that the humoral response elicited by the MBP-
5 VOL. 66, 1998 NOTES 351 FIG. 4. Analysis of the humoral immune response of athymic nu/nu mice. Groups of four BALB/c nu/nu were immunized i.p. with MBP, HSP70, or the MBP-HSP70 fusion protein on days 0 (first immunization) and 21 (second immunization). Details of the immunization protocol can be found in the text. Blood samples were taken a week after the first (A and C) and second (B and D) immunizations, and anti-mbp (empty bars) and anti-hsp70 (shaded bars) antibody titers were determined with the FAST-ELISA. Both IgG (A and B) and IgM (C and D) antibody classes were determined. This is a representative example of two independent experiments. HSP70 fusion protein was long-lived, that the BALB/c mice exhibited a rapid and strong response after the boost, and that the response was observed in T-cell-immunodeficient mice, make the use of L. infantum HSP70 fused to specific antigens an attractive alternative to the use of adjuvants in the development of protective tools against infectious diseases. We thank Susan Linquist for the rat monoclonal anti-hsp antibody. We are also grateful to Javier Palacín for excellent assistance with animal care and manipulations and to C. Mark for editorial assistance. This work was supported by grants I D 0020/94 from the Comunidad Autónoma de Madrid, PTR from the Plan Nacional de Investigación Científica y Desarrollo, and BIO from the Programa Nacional de Biotecnología. An institutional grant from Fundación Ramón Areces is also acknowledged. The Department of Immunology and Oncology was founded and is supported by the Consejo Superior de Investigaciones Científicas and by Pharmacia and Upjohn. REFERENCES 1. Allendoerfer, R., B. Maresca, and G. S. Deepe, Jr Cellular immune responses to recombinant heat shock protein 70 from Histoplasma capsulatum. Infect. Immun. 64: Ardeshir, F., J. E. Flint, S. J. Richman, and R. T. Reese A 75 kd merozoite surface protein of Plasmodium falciparum which is related to the 70 kd heat-shock proteins. EMBO J. 6: Barrios, C., A. R. Lussow, J. Van Embden, R. Van der Zee, R. Rappuoli, P. Costantino, J. A. Louis, P.-H. Lambert, and G. Del Giudice Mycobacterial heat-shock proteins as carrier molecules. II. The use of the 70 kda mycobacterial heat shock protein as carrier molecules. II. The use of the 70 kda mycobacterial heat shock protein as carrier for conjugated vaccines can circumvent the need for adjuvants and Bacillus Calmette Guérin priming. Eur. J. Immunol. 22: Behr, C., J.-L. Sarthou, C. Rogier, J.-F. Trape, M. H. Q. Dat, J.-C. Michel, G. Aribot, A. Dieye, J.-M. Claverie, P. Druihle, and P. Dubois Antibodies and reactive T cells against the malaria heat-shock protein Pf72/ hsp70-1 and derived peptides in individuals continuously exposed to Plasmodium falciparum. J. Immunol. 149: Bianco, A. E., J. M. Favaloro, T. R. Burkot, P. E. Culvenor, G. V. Brown, R. F. Anders, R. L. Coppel, and D. J. Kemp A repetitive antigen of Plasmodium falciparum that is homologous to heat shock protein 70 of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 83: Boulangé, A., and E. Authié A 69 kda immunodominant antigen of Trypanosoma (Nannomonas) congolense is homologous to immunoglobulin heavy chain binding protein (BiP). Parasitology 109: Coffman, R. L., B. W. P. Seymour, D. A. Lebman, D. D. Hiraki, J. A. Christiansen, B. Shrader, H. M. Cherwinski, H. F. J. Savelkoul, F. D. Finkelman, M. W. Bond, and T. R. Mosmann The role of helper T cell products in mouse B cell differentiation and isotype regulation. Immunol. Rev. 102: Cohen, I. R., and D. B. Young Autoimmunity, microbial immunity and the immunological homunculus. Immunol. Today 12: Davenport, M. P., K. R. McKenzie, A. Basten, and W. J. Britton The variable C-terminal region of the Mycobacterium leprae 70-kilodalton heat shock protein is the target for humoral immune responses. Infect. Immun. 60: Davidoff, A. M., J. D. Iglehart, and J. R. Marks Immune response to p53 is dependent upon p53/hsp70 complexes in breast cancers. Proc. Natl. Acad. Sci. USA 89: de Andrade, C. R., L. V. Kirchhoff, J. E. Donelson, and K. Otsu Recombinant Leishmania Hsp90 and Hsp70 are recognized by sera from visceral leishmaniasis patients but not Chagas disease patients. J. Clin. Microbiol. 30: DeNagel, D. C., and S. K. Pierce Heat shock proteins in immune responses. Crit. Rev. Immunol. 13: Elsaghier, A., R. Lathigra, and J. Ivanyi Localisation of linear
6 352 NOTES INFECT. IMMUN. epitopes at the carboxy-terminal end of the mycobacterial 71 kda heat shock protein. Mol. Immunol. 9: Engman, D. M., E. A. Dragon, and J. E. Donelson Human humoral immunity to hsp70 during Trypanosoma cruzi infection. J. Immunol. 144: Garsia, R. J., L. Hellqvist, R. J. Booth, A. J. Radford, W. J. Britton, L. Astbury, R. J. Trent, and A. Basten Homology of the 70-kilodalton antigens from Mycobacterium leprae and Mycobacterium bovis with the Mycobacterium tuberculosis 71-kilodalton antigen and with the conserved heat shock protein 70 of eucaryotes. Infect. Immun. 57: Gupta, R. S., and G. B. Golding Evolution of hsp70 gene and its implications regarding relationships between archaebacteria, eubacteria, and eukaryotes. J. Mol. Evol. 37: Haas, I. G BiP a heat shock protein involved in immunoglobulin chain assembly. Curr. Top. Microbiol. Immunol. 167: Hartl, F. U Molecular chaperones in cellular protein folding. Nature 381: Hedstrom, R., J. Culpepper, R. A. Harrison, N. Agabian, and G. Newport A major immunogen in Schistosoma mansoni infections is homologous to the heat-shock protein hsp70. J. Exp. Med. 165: Jiménez-Ortiz, A., D. C. Guevara, A. Osuna-Carrillo, and C. Alonso Trypanosoma cruzi induces changes in the nucleic acids content of host HeLa cells in vitro. Ann. Parasitol. Hum. Comp. 59: Kumar, N., Y. Zhao, P. Graves, J. P. Folgar, L. Maloy, and H. Zheng Human immune response directed against Plasmodium falciparum heat shock-related proteins. Infect. Immun. 58: Laemmli, U. K Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: Levy-Yeyati, P., S. Bonnefoy, G. Mirkin, A. Debrabant, S. Lafon, A. Panebra, E. Gonzalez-Cappa, J. P. Dedet, M. Hontebeyrie-Joskowicz, and M. J. Levin The 70-kDa heat-shock protein is a major antigenic determinant in human Trypanosoma cruzi/leishmania braziliensis braziliensis mixed infection. Immunol. Lett. 31: MacFarlane, J., M. L. Blaxter, R. P. Bishop, and J. M. Kelly Identification and characterisation of a Leishmania donovani antigen belonging to the 70-kDa heat-shock protein family. Eur. J. Biochem. 190: Maresca, B., and G. S. Kobayashi Hsp70 in parasites: as an inducible protective protein and as an antigen. Experientia 50: Maresca, B., and L. Carratù The biology of the heat shock response in parasites. Parasitol. Today 8: McKenzie, K. R., E. Adams, W. J. Britton, R. J. Garsia, and A. Basten Sequence and immunogenicity of the 70 kda heat shock protein of Mycobacterium leprae. J. Immunol. 147: Editor: S. H. E. Kaufmann 28. Peake, P. W., W. J. Britton, M. P. Davenport, P. W. Roche, and K. R. McKenzie Analysis of B-cell epitopes in the variable C-terminal region of the Mycobacterium leprae 70-kilodalton heat shock protein. Infect. Immun. 61: Pierce, S. K., D. C. DeNagel, and A. M. VanBuskirk A role for heat shock proteins in antigen processing and presentation. Curr. Top. Microbiol. Immunol. 167: Quijada, L., J. M. Requena, M. Soto, and C. Alonso During canine viscero-cutaneous leishmaniasis, the anti-hsp70 antibodies are specifically elicited by the parasite protein. Parasitology 112: Quijada, L., J. M. Requena, M. Soto, L. C. Gómez, F. Guzman, M. E. Patarroyo, and C. Alonso Mapping of the linear antigenic determinants of the Leishmania infantum hsp70 recognized by leishmaniasis sera. Immunol. Lett. 52: Requena, J. M., M. Soto, F. Guzman, A. Maekel, O. Noya, M. E. Patarroyo, and C. Alonso Mapping of antigenic determinants of the T. cruzi hsp70 in chagasic and healthy individuals. Mol. Immunol. 30: Roche, P. W., P. W. Peake, M. P. Davenport, and W. J. Britton Identification of a Mycobacterium leprae-specific T cell epitope on the 70 kda heat shock protein. Immunol. Cell Biol. 72: Rothstein, N. M., G. Higashi, J. Yates, and T. V. Rajan Onchocerca volvulus heat shock protein 70 is a major immunogen in a microfilaremic individuals from a filariasis-endemic area. Mol. Biochem. Parasitol. 33: Shinnick, T. M Heat shock proteins as antigens of bacterial and parasitic pathogens. Curr. Top. Microbiol. Immunol. 167: Skeiky, Y. A. W., D. R. Benson, J. A. Guderian, J. A. Whittle, O. Bacelar, E. M. Carvalho, and S. G. Reed Immune responses of leishmaniasis patients to heat shock proteins of Leishmania species and humans. Infect. Immun. 63: Srivastava, P. K., and H. Udono Heat shock protein-peptide complexes in cancer immunotherapy. Curr. Opin. Immunol. 6: Suzue, K., and R. A. Young Adjuvant-free hsp70 fusion protein system elicits humoral and cellular immune responses to HIV-1 p24. J. Immunol. 156: Velazquez, J. M., S. Sonoda, G. E. Bugaisky, and S. Lindquist Are Hs proteins present in cells that have not been heat shocked. J. Cell Biol. 96: Young, D. B Heat-shock proteins: immunity and autoimmunity. Curr. Opin. Immunol. 4: Zhong, G., and R. C. Brunham Antigenic analysis of the chlamydial 75-kilodalton protein. Infect. Immun. 60:
COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationCustom Antibodies Services. GeneCust Europe. GeneCust Europe
GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom
More informationModulation of Immune Response in Lambs
Modulation of Immune Response in Lambs A.S. Leaflet R1473 Jose O. Lopez Virella, graduate research assistant, M. L. Kaeberle, professor, veterinary microbiology Mamadou Niang, graduate research assistant.
More informationReceived 24 February 2000/Returned for modification 11 April 2000/Accepted 13 June 2000
INFECTION AND IMMUNITY, Sept. 2000, p. 4986 4991 Vol. 68, No. 9 0019-9567/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. DNA-Based Immunization with Trypanosoma cruzi
More informationMouse Monoclonal Antibody Isotyping Reagents
Mouse Monoclonal Antibody Isotyping Reagents Catalog Number: SEK003 Storage Temperature: 2-8 C Fax : +86-10-58628220 Tel : +86-400-890-9989 http://www.sinobiological.com Description Mouse Monoclonal Antibody
More informationThe Biotechnology Education Company. Quantitative ELISA. Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE:
The Biotechnology Education Company Revised and Updated Quantitative ELISA Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE: EDVO-Kit # 278 The objective of this experiment is
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationspecial offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationMouse ICAM-1 / CD54 ELISA Pair Set
Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General
More informationChapter 11. Restriction mapping. Objectives
Restriction mapping Restriction endonucleases (REs) are part of bacterial defense systems. REs recognize and cleave specific sites in DNA molecules. REs are an indispensable tool in molecular biology for
More informationSchistosoma mansoni Heat Shock Protein 70 Elicits an Early Humoral Immune Response in S. mansoni Infected Baboons
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 97(5): 711-716, July 2002 711 Schistosoma mansoni Heat Shock Protein 70 Elicits an Early Humoral Immune Response in S. mansoni Infected Baboons Herminia Y Kanamura/
More informationHuman IL10RB ELISA Pair Set ( CRFB4 )
Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationAnti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP
Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationLichenase fusions improve immunological properties of antigens
Lichenase fusions improve immunological properties of antigens Konstantin Musiychuk Center for Molecular Biotechnology, Fraunhofer USA 03/27/2012 Lichenase Hydrolysis site of β-glycans Structure of the
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationPeliClass human IgG subclass ELISA kit Enzyme-linked immunosorbent assay
PeliClass human IgG subclass ELISA kit Enzyme-linked immunosorbent assay Catalog No: M1551 Size: six pre-coated 8-well strips for each of the four IgG subclasses Test description The PeliClass human subclass
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationSpecies predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationAmersham * ECL * Gel horizontal electrophoresis system
GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel
More informationSDS-PAGE and Western Blot. Molecular Basis of Evolution
1 SDS-PAGE and Western Blot Molecular Basis of Evolution Homology high level of DNA and protein sequence similarity due to common ancestry. Evidence Genomes of related organisms are very similar. Even
More informationHuman IgG Antigen ELISA Kit
Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,
More informationMouse Interferon alpha ELISA Kit
Mouse Interferon alpha ELISA Kit Catalog No: CK2010-1 Size: 1 x 96 tests CK2010-5 5 x 96 tests Range: 12.5-400 pg/ml Specifications: This kit quantitates interferon alpha in tissue culture media (10% FBS)
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationAntibody Purification Guide
Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to
More informationCyfra 21-1 IRMA. Product information Information about other products is available at: Userś Manual DE52100
Product information Information about other products is available at: www.demeditec.com Userś Manual Cyfra 21-1 IRMA The CYFRA 21.1 IRMA system provides a direct in vitro quantitative determination of
More informationFor the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine.
m andw da a For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity Range (calibration
More informationQImaging Camera Application Notes Multicolor Immunofluorescence Imaging
QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody
More informationSTANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA)
STANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA) 1. PURPOSE This procedure is to be used for the characterization of purified monoclonal antibody. 2. SCOPE This
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationSerology as a Diagnostic Technique
Serology as a Diagnostic Technique Characteristics of Any Diagnostic Techniques Any useful detection strategy must be: Specific: yield a positive response for only the target organism or molecule. Sensitive:
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationSAMPLE LITERATURE Please refer to included weblink for correct version.
REVISED & UPDATED Edvo-Kit #269 Introduction to ELISA Reactions Experiment Objective: This experiment introduces concepts and methodologies of enzyme-linked immunosorbent assays (ELISA). See page 3 for
More informationFLAG Western Detection Kit
FLAG Western Detection Kit INSTRUCTION MANUAL Catalog #200470 Revision A For In Vitro Use Only 200470-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other
More informationAn indirect haemagglutination test to detect serum antibodies to Giardia lamblia
J. Biosci., Vol. 10, Number 4, December 1986, pp. 475-480. Printed in India. An indirect haemagglutination test to detect serum antibodies to Giardia lamblia K. N. JALAN, TUSHER MAITRA and RITA DAS Kothari
More informationMutating Asn-666 to Glu in the O-helix region of the taq DNA polymerase gene
Research in Pharmaceutical Sciences, April 2010; 5(1): 15-19 Received: Oct 2009 Accepted: Jan 2010 School of Pharmacy & Pharmaceutical Sciences 15 Isfahan University of Medical Sciences Original Article
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationNovel T cell antigen discovery technology providing new momentum on a malaria vaccine
Novel T cell antigen discovery technology providing new momentum on a malaria vaccine World Vaccine Congress 2012 Best Vaccine Startup 2008 Jessica Baker Flechtner, PhD Vice President, Research Genocea
More informationBi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1
Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationDEFB1 (Human) ELISA Kit
DEFB1 (Human) ELISA Kit Catalog Number KA2181 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the
More informationSee external label 2 C-8 C Σ=96 tests Cat # 5201Z CARCINOEMBRYONIC ANTIGEN (CEA) ENZYME IMMUNOASSAYTEST KIT CEA ELISA. Cat # 5201Z
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationSupplementary Information
Supplementary Information Extended Loop Region of Hcp1 is Critical for the Assembly and Function of Type VI Secretion System in Burkholderia pseudomallei Yan Ting Lim, Chacko Jobichen, Jocelyn Wong, Direk
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationKPL LumiGLO Reserve Chemiluminescent Substrate
DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way
More informationANTIBODY IMMUNOGENICITY
ANTIBODY IMMUNOGENICITY Tolerance Classical Immunity To aggegated Antibody Chiller and Weigle, PNAS, 65:551, 1970; Benjamin and Waldmann, et al, J Exp Med, 163:1539, 1986) THE IMMUNOGENICITY PROBLEM WITH
More informationStep-by-Step Description of ELISA
Step-by-Step Description of ELISA The protocols in this kit rely on indirect antibody capture ELISA. The steps in this assay are: Step 1: Antigen is added to the wells of the microplate strip and incubated
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationab SUMOylation Assay Kit
ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version
More informationCloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)
Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier
More informationGSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet
IL-10, also known as human cytokine synthesis inhibitory factor (CSIF), is an antiinflammatory cytokine that is produced by T cells, NK cells, mast cells and macrophages (1,2,3). It is capable of inhibiting
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationHuman IL-6 ELISA Kit. User Manual (Revised Dec 16, 2009) Human IL-6 ELISA Kit Protocol. (Cat#: RAY-ELH-IL6-001)
Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human IL-6 ELISA Kit User Manual (Revised Dec 16, 2009)
More informationMRC5 Host Cell Proteins
MRC5 Host Cell Proteins Immunoenzymetric Assay for the Measurement of MRC5 Host Cell Proteins Catalog # F300 Intended Use This kit is intended for use in determining the presence of MRC5 host cell protein
More informationFigure 1. Schematic of Ats1p expression plasmid.
Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1
More informationMouse Factor XII Total ELISA Kit
Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII
More informationMATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit
Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin
More informationPOLYMICROBIAL INFECTIONS IN BRAIN TISSUE FROM ALZHEIMER S DISEASE PATIENTS. Carrasco 1*
POLYMICROBIAL INFECTIONS IN BRAIN TISSUE FROM ALZHEIMER S DISEASE PATIENTS Diana Pisa 1+, Ruth Alonso 1+, Ana M. Fernández-Fernández 1, Alberto Rábano 2 and Luis Carrasco 1* 1 Centro de Biología Molecular
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationHSV-2 therapeutic vaccine program. Subunit vaccine candidates
HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationBio-Monolith Protein G Column - More Options for mab Titer Determination
Bio-Monolith Protein G Column - More Options for mab Titer Determination Application Note Biologics and Biosimilars Author Phu T. Duong Agilent Technologies, Inc. Introduction In recent years, monoclonal
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationStrep-tag Technology for Molecular Weight (MW) Determinations on Blots Using Precision Plus Protein Standards
blotting tech note 2847 Strep-tag Technology for Molecular Weight (MW) Determinations on Blots Using Precision Plus Protein Standards Introduction Bio-Rad has consistently provided innovative standards
More informationNewsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions
www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationMouse Peptide YY (PYY) ELISA
Mouse Peptide YY (PYY) ELISA For the quantitative determination of mouse PYY in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58705 For Research Use Only. Not for use in diagnostic
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationDe-risking Vaccine Formulation Design
De-risking Vaccine Formulation Design Drug Delivery & Formulation Summit and Expo San Diego 13 June 2016 Roger H Brookes Overview Introduction TB vaccine Proof-of-Concept for antigen (H4) specific immunomodulation
More informationMake Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript
Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,
More informationGeneric DELFIA Reagents
AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody
More informationRID 101: Basic Principles of Radial Immuno-Diffusion Everything you wanted to know about RID testing *But were afraid to ask*
RID 101: Basic Principles of Radial Immuno-Diffusion Everything you wanted to know about RID testing *But were afraid to ask* Carl A. Ascoli, Ph.D., CSO 1 2/29/2016 RID 101: Basic Principles Immunologicals
More informationAutomated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)
Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationMouse Gonadotropin Releasing Hormone (GnRH) ELISA
KAMIYA BIOMEDICAL COMPANY Mouse Gonadotropin Releasing Hormone (GnRH) ELISA For the quantitative determination of mouse GnRH in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58182
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationPARTIALLY PURIFIED LENTINAN FROM SHIITAKE MUSHROOM (LENTINUS EDODES) STILL RETAIN ANTITUMOUR ACTIVITY
-------The 3 rd ICMBMP October 1999 PARTIALLY PURIFIED LENTINAN FROM SHIITAKE MUSHROOM (LENTINUS EDODES) STILL RETAIN ANTITUMOUR ACTIVITY Ann-Teck Yap, Sudhir Kumar Chandramohan, Mah-Lee Ng Mary Department
More information