Aims: -Purification of a specific protein. -Study of protein-protein interactions

Size: px
Start display at page:

Download "Aims: -Purification of a specific protein. -Study of protein-protein interactions"

Transcription

1

2 Aims: -Purification of a specific protein -Study of protein-protein interactions

3

4 This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin beads) binds to the Fc portion of IgG (immunoglobulin). The beads are used in a chromatography column or loose in a test tube.

5

6 globalmedicaldiscovery.com

7

8 Pull-down assays: Use strong non-covalent interactions between a protein of interest (bait) and the potential interacting partners (prey proteins).

9 The bait can be expressed in E. coli as a fusion protein. The fusion protein is then immobilized on a solid support or solid particles using an affinity ligand specific for the fusion tag. Other unwanted products from E. coli are washed off. The immobilized bait protein is incubated with the prey protein (in a mixture), and other non-interacting molecules can be rinsed off.

10

11

12

13

14 A common method to generate a fusion protein (bait) is to use GST (glutathione-s transferase) as the fusion tag by expression in E. coli. Fusion at C-terminus of GST. The GST tag interacts very strongly with glutathione (GSH). The fusion protein is then immobilized on agarose particles bearing GSH. Other unwanted products are washed off. The immobilized bait protein is incubated with the prey protein, and non interacting molecules can be rinsed off.

15

16 GSH (γ-glutamylcysteinylglycine)

17 Specific GST approach: membrane-associated proteins

18 Specific GST approach: Use a GST-PDZ fusion protein to pull down membrane associated proteins by affinity from HeLa cells. Expression of GST-PDZ in E. coli and attachment to agarose-glutathione particles; washing. Incubation of particles with HeLa cancer cells to capture interactive proteins. Non interacting proteins rinsed off. Elution of captured proteins and separation by SDS-PAGE. J Proteome Res Sep;5(9):

19

20 Add all proteins from HeLa cells Stir and let equilibrate; centrifuge. Proteins with no affinity for PDZ1 are in the supernatant. Detach proteins of interest from beads using a strong eluent.

21 PDZ affinity proteins on SDS-PAGE ~36 kda Connexin 36?

22 Identification of other proteins pulled down by GST-PDZ Keratin and cytokeratin 8 Trypsin (contaminant) GST-PDZ1 Vimentin Actin Alpha-actinin kda ARN/ADN nuclear binding protein 54 kda Proline/glutamine-rich splicing protein 76 kda Nucleolin 74 kda Beta-tubulin kda Carbonic anhydrase + connexin 36 kda

23 Another common bait used for pulling down proteins: the His 6 -tag The tag may be placed at the N or C terminus: (His) 6 -Protein or Protein-(His) 6

24 His tags have a high affinity for Ni 2+ and Co 2+

25 A mixture of proteins (including the His-tagged fusion protein) is incubated with an affinity resin containing chelated Ni 2+ or Co 2+ Resins are available commercially in different varieties, and are generally sepharose/agarose functionalized with a chelator. Immobilized metal affinity chromatography (IMAC)

26 Chelators: iminodiacetic acid (Ni-IDA) and nitrilotriacetic acid (Ni-NTA) are used for Ni 2+

27 Carboxylmethyl aspartate (Co-CMA) is used for cobalt The resin is then washed with phosphate buffer to remove proteins that do not specifically interact with Ni 2+ or Co 2+ Imidazole in high conc. (200 mm) is then used to detach His-tag proteins.

28 Affinity chromatography is aimed at protein purification, although it can yield the protein of interest plus interacting partners. As opposed to chromatography, affinity pulldown methods are often aimed at studying protein-protein interactions rather than purification. GST tags are quite bulky and can significantly change the properties of the bait protein to which they are fused. His tags are much smaller and in most cases do not change the bait protein s properties. Affinity and pulldown methods are usually followed by SDS- PAGE.

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of

More information

Nickel-NTA Agarose Suspension

Nickel-NTA Agarose Suspension Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing

More information

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing. 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE Nickel NTA Agarose Beads DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous

More information

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric

More information

GST Fusion Protein Purification Kit

GST Fusion Protein Purification Kit Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650) Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------

More information

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension. 1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding

More information

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 20% ethanol. INSTRUCTIONS The resins are adapted to work mainly in native conditions

More information

AFFINITY GST PURIFICATION

AFFINITY GST PURIFICATION DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding proteins. are products that allow batch or column purifications. Purification

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Strep-Tactin XT Spin Column

Strep-Tactin XT Spin Column Strep-Tactin XT Spin Column Purification Protocol Last date of revision Last June date 2017 of revision June 2017 Version PR90-0001 Version PR90-0001 For research use only Important licensing information

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Small-Molecule Drug Target Identification/Deconvolution Technologies

Small-Molecule Drug Target Identification/Deconvolution Technologies Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily

More information

Amintra Affinity Resins

Amintra Affinity Resins Amintra Affinity Resins Ni-NTA Metal Chelate Affinity Resin Technical Data and Instruction Manual info@expedeon.com 2 TABLE OF CONTENTS TABLE OF CONTENTS 3 Introduction 4 Storage 4 Chemical compatibility

More information

I Introduction II Product Description III Immobilized Metal Ion Affinity Chromatography (IMAC)... 4

I Introduction II Product Description III Immobilized Metal Ion Affinity Chromatography (IMAC)... 4 A M E R S H A M B I O S C I E N C E S Chelating Sepharose Fast Flow INSTRUCTIONS Table of contents Page I Introduction.......................................... 2 II Product Description.....................................

More information

Rhinophase -AB, Zirconia-based Monoclonal Antibody Purification System

Rhinophase -AB, Zirconia-based Monoclonal Antibody Purification System Rhinophase -AB, Zirconia-based Monoclonal Antibody Purification System Welcome to the sixth issue of ZirChrom's electronic newsletter. This newsletter introduces a biocompatible stationary phase useful

More information

Bio-Scale Mini Nuvia IMAC Ni-Charged Cartridges, 1 and 5 ml

Bio-Scale Mini Nuvia IMAC Ni-Charged Cartridges, 1 and 5 ml Bio-Scale Mini Nuvia IMAC Ni-Charged Cartridges, 1 and 5 ml Instruction Manual Catalog numbers 780-0811 780-0812 Table of Contents Section 1 Introduction... 1 Section 2 Product Information... 2 Section

More information

ab Antibody Serum Purification Kit (Protein A) Protocol

ab Antibody Serum Purification Kit (Protein A) Protocol ab109209 Antibody Serum Purification Kit (Protein A) Protocol For preparing antibodies for conjugation The components of Ab109209 are fully compatible with our Conjugation kits however they are not compatible

More information

Protein Purification. igem TU/e 2016 Biomedical Engineering

Protein Purification. igem TU/e 2016 Biomedical Engineering igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +1 50 247 55 59 2016.igem.org/Team:TU-Eindhoven Protein

More information

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Rapid GST Inclusion Body Solubilization and Renaturation Kit Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His

More information

Thermo Scientific Pierce FPLC Purification

Thermo Scientific Pierce FPLC Purification 3 E A 28 25 2 15 1 5 Thermo Scientific Pierce FPLC Purification. 1. 2. 3. 4. Table of Contents Introduction FPLC Cartridge Overview 1 Product Introduction 1 Highlights Thermo Scientific Products 1 2-3

More information

1. Bloomsbury BBSRC Centre for Structural Biology, Birkbeck College and University College London.

1. Bloomsbury BBSRC Centre for Structural Biology, Birkbeck College and University College London. Purification/Polishing of His-tagged proteins - Application of Centrifugal Vivapure Ion-exchange Membrane Devices to the Purification/Polishing of Histagged Background Multi-milligram quantities of highly

More information

Selective Profinity IMAC Resins Provide Ultrahigh-Purity Recombinant His-Tagged Proteins

Selective Profinity IMAC Resins Provide Ultrahigh-Purity Recombinant His-Tagged Proteins PROTEIN PURIFICATION Profinity IMAC Resins Unique open pore structure facilitates purification of large MW proteins and protein-protein interaction studies Excellent purity of target proteins Stability

More information

Antibody Purification Guide

Antibody Purification Guide Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of

More information

Purification of His-tag proteins

Purification of His-tag proteins Purification of His-tag proteins User manual Protino Ni-TED 150 Packed Columns Protino Ni-TED 1000 Packed Columns Protino Ni-TED 2000 Packed Columns Protino Ni-TED Resin July 2017 / Rev. 07 www.mn-net.com

More information

Protein Purification. Handbook & Selection Guide. G-Biosciences

Protein Purification. Handbook & Selection Guide. G-Biosciences G-Biosciences Protein Purification Handbook & Selection Guide G-Biosciences 1-800-628-7730 www.gbiosciences.com Protein Estimation Assays Apoptosis Assays Cytotoxicity Assays SAM Methyltransferase Assays

More information

FastPure Spin Columns (Mini and Midi)

FastPure Spin Columns (Mini and Midi) G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FastPure Spin Columns (Mini and Midi) (Cat. # 786-1088, 786-1089, 786-1090, 786-1091) think

More information

Protein Techniques 1 APPENDIX TO CHAPTER 5

Protein Techniques 1 APPENDIX TO CHAPTER 5 Protein Techniques 1 APPENDIX T CHAPTER 5 Dialysis and Ultrafiltration If a solution of protein is separated from a bathing solution by a semipermeable membrane, small molecules and ions can pass through

More information

Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov

Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov NEW AFFINITY SORBENTS FOR PURIFICATION OF RECOMBINANT PROTEINS WITH THE USE OF CHITIN-BINDING DOMAIN AS AN AFFINITY TAG Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov Centre

More information

Affinity Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.:

Affinity Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.: Affinity Chromatography Teaching Kit Manual Cat No. New Cat No. KT41 106192 Revision No.: 00010905 CONTENTS Page No. Objective 3 Principle 3 Kit Description 4 Materials Provided 6 Procedure 7 Result 12

More information

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter)

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Automation Guide 2 I. Description 2

More information

Strep-Tactin Spin Column Purification Protocol

Strep-Tactin Spin Column Purification Protocol Strep-Tactin Spin Column Purification Protocol Last date of revision February 2008 Version PR10-0005 IBA Headquarters IBA GmbH Rudolf-Wissell-Str. 28 D-37079 Göttingen Germany Tel: +49 (0) 551-50672-0

More information

Affi-Gel Protein A MAPS II Kit Instruction Manual

Affi-Gel Protein A MAPS II Kit Instruction Manual Affi-Gel Protein A MAPS II Kit Instruction Manual Catalog Number 153-6159 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723) Table of Contents Introduction...1

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

ab GST tag ELISA Kit

ab GST tag ELISA Kit ab126581 GST tag ELISA Kit Instructions for Use For the quantitative measurement of the GST tag protein expression. This product is for research use only and is not intended for diagnostic use. Version

More information

Bio-Scale Mini Profinity IMAC Cartridges, 1 and 5 ml. Instruction Manual. Catalog #

Bio-Scale Mini Profinity IMAC Cartridges, 1 and 5 ml. Instruction Manual. Catalog # Bio-Scale Mini Profinity IMAC Cartridges, 1 and 5 ml Instruction Manual Catalog # 732-4610 732-4612 732-4614 Table of Contents Section 1...Introduction...1 Section 2 Product Information...2 Section 3 Connection

More information

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided

More information

Ras activation kit. Catalog Number: ADI-EKS-460. Table of Contents

Ras activation kit. Catalog Number: ADI-EKS-460. Table of Contents Ras activation kit Catalog Number: ADI-EKS-460 Table of Contents Assay Design Page 1 Scientific Overview 1 Precautions 1 Materials Provided 2 Storage of Materials 2 Materials Required but Not Provided

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

Announcements. Next week s discussion will have a quiz on Chapter 3fg and Chapter 11ab Computer Lab (Chapter 11ab): 10/17 10/22

Announcements. Next week s discussion will have a quiz on Chapter 3fg and Chapter 11ab Computer Lab (Chapter 11ab): 10/17 10/22 Announcements Next week s discussion will have a quiz on Chapter 3fg and Chapter 11ab Computer Lab (Chapter 11ab): 10/17 10/22 SCI 162 will be open for 2 hours of each lab section to finish Chapter 3 Chapters

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Instructions 28-9670-57 AA Mag Sepharose Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra Protein A Mag Sepharose Xtra and Protein G Mag Sepharose Xtra are available in the following

More information

Amicon Pro Affinity Concentration Kit - GST

Amicon Pro Affinity Concentration Kit - GST Amicon Pro Affinity Concentration Kit - GST Purification of GST-tagged recombinant proteins. Catalog Nos. ACR5000GS, ACK5003GS, ACK5010GS, ACK5030GS, ACK5050GS, ACK5100GS FOR RESEARCH USE ONLY Not for

More information

Next Generation Zirconia-Based Antibody Purification Media

Next Generation Zirconia-Based Antibody Purification Media Next Generation Zirconia-Based Antibody Purification Media Dr. Clayton McNeff, Dwight Stoll, Danielle Hawker (ZirChrom), Dr. Andy Clausen (Merck) Dr. Peter W. Carr and Dr. Anuradha Subramanian (U of MN)

More information

HiTrap convenient protein purification

HiTrap convenient protein purification GE Healthcare Life Sciences HiTrap convenient protein purification Column Guide Ion Exchange Chromatography (IEX) IEX separates proteins with differences in charge. The separation is based on the reversible

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

An effective platform for purification of IgM monoclonal antibodies using Hydroxyapatite

An effective platform for purification of IgM monoclonal antibodies using Hydroxyapatite An effective platform for purification of IgM monoclonal antibodies using Hydroxyapatite Frank Hensel, Patrys, GmbH Pete Gagnon, Validated Biosystems 5th International Conference on Hydroxyapatite and

More information

Thermo Scientific GTPase Research Tools

Thermo Scientific GTPase Research Tools Thermo Scientific Research Tools Active Pull-Down Assays We offer two different tools to study biology, one for active monitoring and one for global profiling. The Thermo Scientific Pierce Active Pull-Down

More information

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES.

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES. GST Purfication and Pulldown Part I Instructor: David Deitcher TA: Kristy Lawton In order to study the function of a protein it is often useful to have that protein purified away from others in the cell.

More information

3. Close the bottom end of the column and apply the packing device on top. Pump water through the upper adaptor to remove air.

3. Close the bottom end of the column and apply the packing device on top. Pump water through the upper adaptor to remove air. INSTRUCTIONS FOR USE WorkBeads Protein A Product name Pack size Article number WorkBeads Protein A Bulk Media 1.5 ml 40605001 Bulk Media 5 ml 40605002 Bulk Media 10 ml 40605003 Bulk Media 100 ml 40605004

More information

G Sep Size Exclusion Columns

G Sep Size Exclusion Columns G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name G Sep Size Exclusion Columns (Cat. # 786 1297, 786 1298, 786 1300, 786 1301, 786 1302, 786

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11 Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Strep-Tactin Spin Column

Strep-Tactin Spin Column Strep-Tactin Spin Column Purification Protocol Last date of revision November 2012 Version PR10-0006 www.strep-tag.com For research use only Important licensing information Products featuring Strep-Tactin

More information

Application Note USD Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent

Application Note USD Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent Application Note USD 241 Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent What this Study Demonstrates T h i s s t u d y o n C a

More information

HiPer Immunoprecipitation Teaching Kit

HiPer Immunoprecipitation Teaching Kit HiPer Immunoprecipitation Teaching Kit Product Code: HTI016 Number of experiments that can be performed: 5 Duration of Experiment Storage Instructions The kit is stable for 6 months from the date of receipt

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

HiFliQ Ni-NTA FPLC Columns User Guide

HiFliQ Ni-NTA FPLC Columns User Guide HiFliQ Ni-NTA FPLC Columns User Guide Protein Ark s HiFliQ Ni-NTA FPLC columns designed for rapid one-step purification, and ideal for preparative purification and contaminant removal. HiFliQ Ni-NTA FPLC

More information

Protein G HP SpinTrap / Ab Spin Trap

Protein G HP SpinTrap / Ab Spin Trap GE Healthcare Life Sciences Protein G HP SpinTrap / Ab Spin Trap Product booklet Codes: 28-9031-34 28-4083-47 Page finder 1. Legal 3 2. Handling 4 2.1. Safety warnings and precautions 4 2.2. Storage 4

More information

Seize X Protein G Immunoprecipitation Kit

Seize X Protein G Immunoprecipitation Kit INSTRUCTIONS Seize X Protein G Immunoprecipitation Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 45210 0936.4 Number Description 45210 Seize X Protein G Immunoprecipitation Kit, contains sufficient

More information

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Rapid GST Inclusion Body Solubilization and Renaturation Kit Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His

More information

A Novel Tag System for the Purification and Processing of Fusion-Tagged Proteins

A Novel Tag System for the Purification and Processing of Fusion-Tagged Proteins AFFINITY PURIFICATION SYSTEMS Profinity exact Purification Resin A Novel Tag System for the Purification and Processing of Fusion-Tagged Proteins Introduction Research on the structure and function of

More information

Protein A HP SpinTrap

Protein A HP SpinTrap GE Healthcare Protein A HP SpinTrap Product booklet Code: 28-9031-32 Page finder 1. Legal 3 2. Handling 4 2.1. Safety warnings and precautions 4 2.2. Storage 4 2.3 Expiry 4 3. Introduction 5 4. General

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Presto Soil DNA Extraction Kit

Presto Soil DNA Extraction Kit Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500

More information

Ion Exchange Chromatography. Learning Objectives:

Ion Exchange Chromatography. Learning Objectives: Proteomics Ion Exchange Chromatography Ion Exchange Chromatography Ion exchange chromatography is a purification technique, which involves the separation of the proteins based on the ion exchange property

More information

Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium

Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences

More information

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS HALOLINK ESIN FO POTEIN PULL-DOWN AND ANALYSIS MAJETA UH, PH.D. 1, DAN SIMPSON, PH.D. 1, JACQUI SANKBEIL, M.S. 1, DANETTE HATZELL, PH.D. 1, NATASHA KAASSINA, M.S. 1, NADINE NASSIF, M.S. 1, JAMI ENGLISH,

More information

HisTALON Superflow 1 ml & 5 ml Cartridges

HisTALON Superflow 1 ml & 5 ml Cartridges User Manual HisTALON Superflow 1 ml & 5 ml Cartridges User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

About the Kits...2 Description 2 Components 4 Storage 4. Overview...5. Cell Extract Preparation...5. His Bind Resin Chromatography...

About the Kits...2 Description 2 Components 4 Storage 4. Overview...5. Cell Extract Preparation...5. His Bind Resin Chromatography... Novagen User Protocol TB054 Rev. F 0106 1 of 16 His Bind Kits Table of Contents About the Kits...2 Description 2 Components 4 Storage 4 Overview...5 Cell Extract Preparation...5 His Bind Resin Chromatography...8

More information

Protein & Antibody. Purification & Detection Tools

Protein & Antibody. Purification & Detection Tools Abbkine featured PurKine isolation and purification portfolio with complete antitag antibodies and synthetic peptides to meet and satisfy your most types of protein purification, sample preparation and

More information

Presto Stool DNA Extraction Kit

Presto Stool DNA Extraction Kit Instruction Manual Ver. 10.21.17 For Research Use Only Presto Stool DNA Extraction Kit Advantages STLD004 (4 Preparation Sample Kit) STLD050 (50 Preparation Kit) STLD100 (100 Preparation Kit) Sample: 180-200

More information

About the Kits... 2 Description 2 Components 3. Overview... 3

About the Kits... 2 Description 2 Components 3. Overview... 3 Table of Contents About the Kits... 2 Description 2 Components 3 Overview... 3 Cell Extract Preparation... 5 Mechanical disruption method 5 Cell extract preparation using BugBuster reagent 6 Soluble fraction

More information

BIOL 3380 Combined Lab Report T AM W-AM R-AM F-AM T PM W-PM R-PM F-PM

BIOL 3380 Combined Lab Report T AM W-AM R-AM F-AM T PM W-PM R-PM F-PM BIOL 3380 Combined Lab Report Name: Younghee Kwon Circle your lab section: T AM W-AM R-AM F-AM T PM W-PM R-PM F-PM Instructor: Dr. Scott Rippel Graduate TA: Nymisha Date: November 9, 2014 Partner: Mauricio

More information

One-Step Western TM Kit using TMB

One-Step Western TM Kit using TMB Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..

More information

GE Healthcare. Affinity Chromatography. Principles and Methods

GE Healthcare. Affinity Chromatography. Principles and Methods GE Healthcare Affinity Chromatography Principles and Methods Handbooks from GE Healthcare Protein Purification Handbook 18-1132-29 Gel Filtration Principles and Methods 18-1022-18 Affinity Chromatography

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

rprotein A GraviTrap Protein G GraviTrap rprotein A/Protein G GraviTrap

rprotein A GraviTrap Protein G GraviTrap rprotein A/Protein G GraviTrap GE Healthcare Life Sciences Data file 28-9921-04 AA rprotein A GraviTrap Protein G GraviTrap rprotein A/Protein G GraviTrap Protein sample preparation rprotein A GraviTrap, Protein G GraviTrap, and rprotein

More information

2. The Principles of Dynabeads

2. The Principles of Dynabeads 2. The Principles of What Are? 9 How Are Used? 9 Different Types of 10 Surface Activated, Primary and Secondary-Coated 10 Small and Large 10 Different Separation Strategies 11 Positive Isolation: Binding

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Purification of mfp. from an Overnight Culture. Laboratory 17

Purification of mfp. from an Overnight Culture. Laboratory 17 Purification of mfp from an Overnight Culture When scientists at a therapeutics company, like Amgen, have successfully identified a promising therapeutic protein, two objectives would be to locate and

More information

TALON Products. For polyhistidine-tagged protein purification

TALON Products. For polyhistidine-tagged protein purification TAL Products For polyhistidine-tagged protein purification Product TAL Metal Affinity Resin Resin ready for loading in columns for small or medium-scale purification of is-tagged proteins. Purify > 5 mg

More information

SMART Digest ImmunoAffinity (IA) Kit User Manual. Version 1

SMART Digest ImmunoAffinity (IA) Kit User Manual. Version 1 MART Digest ImmunoAffinity (IA) Kit User Manual Version 1 XX21549-EN 0816 Revision A August 2016 MART Digest ImmunoAffinity (IA) Kits Delivering Fast, imple and ighly Reproducible Immunocapture and Digestion

More information

Gel Filtration Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.:

Gel Filtration Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.: Gel Filtration Chromatography Teaching Kit Manual Cat No. New Cat No. KT39 106190 Revision No.: 00130405 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided 7 Procedure 8 Observation

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Fusion Protein Products. Screen Purify Detect Cleave

Fusion Protein Products. Screen Purify Detect Cleave Fusion Protein Products Screen Purify Detect Cleave Afusion protein consists of two gene sequences that are ligated together and transcribed as a single molecule. One sequence encodes for a tag, which

More information