Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating

Transcription

1 Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating Nan Jiang 1, Zhijun Guo 2,3, Dan Sun 3, Yubao Li 2, Yutao Yang 1, Chen Chen 2, Li Zhang *2 and Songsong Zhu *1 1. State Key Laboratory of Oral Diseases, & National Clinical Research Center for Oral Disease, & West China Hospital of Stomatology, Sichuan University, Chengdu, China 2. Research Center for Nano-Biomaterials, Analytical & Testing Center, Sichuan University, Chengdu, China 3. School of Mechanical & Aerospace Engineering, Queens University Belfast, Belfast, UK Materials and methods Cell isolation and culture Bone marrow stromal cells (BMSCs) were isolated from the femurs of 4-week-old male Sprague-Dawley rats (Animal Research Center, Sichuan University, China) and subsequently cultured in alpha-modified Eagle s medium (α-mem, Gibco, Gaithersburg, MD, USA), which was supplemented with 10% fetal bovine serum (FBS, Gibco), 50 mg/l ascorbic acid (Sigma-Aldrich, St. Louis, MO, USA), 10 mm Na-β-glycerophosphate (Sigma-Aldrich), 10 8 M dexamethasone (Sigma-Aldrich), and 1% penicillin-streptomycin antibiotic antimycotic solution (Invitrogen, Carlsbad, CA, USA). The cells were incubated in a humidified atmosphere (95% air and 5% CO 2 ) at 37 C. After 48 h, the unattached cells were removed by rinsing, and fresh culture medium was topped up. The culture medium was replaced every 2 3 days, and the cells were sub-cultured when reaching 80 90% confluence.

2 Cell cycle analysis A 5'-bromo-2'-deoxyuridine (BrdU) flow kit (BD Pharmingen, San Diego, CA) was used to determine the cell cycle kinetics and to measure the incorporation of BrdU into DNA of the proliferating cells. The assay was performed according to the manufacturer's protocol. Briefly, cells (1x10 6 /well) were seeded overnight in 24-well tissue culture plates for 3 days, followed by the addition of 10 µm BrdU, and the incubation was continued for an additional 4 h. Cells were pooled from triplicate wells for every sample group, fixed in a solution containing paraformaldehyde and the detergent saponin, and incubated for 1 h with DNase at 37 C (30 µg per sample). FITC-conjugated anti-brdu antibody (1:50 dilution in wash buffer; BD Pharmingen) was added and incubation was continued for 20 min at room temperature. Cells were then rinsed and DNA was stained using 7-aminoactinomycin D (7-AAD; 20 µl per sample). Data collection and analyses were performed using an Accuri C6 flow cytometer (BD Biosciences). Samples were gated on SSC-A vs. FSC-A. Approximately 10,000 gated events were collected. The BrdU content (FITC) and total DNA content (7-AAD) were determined using FlowJo 10 software (De Novo Software). ALP activity assay Cell differentiation potential on the Ti disc samples was evaluated by alkaline phosphatase (ALP) activity. After incubation with the samples for 24 h, the culture medium was changed to osteogenic inductive medium, containing α-mem, 10% FBS, 100 U/mL penicillin, 100 mg/ml streptomycin sulfate, 100 nm dexamethasone, 50 µg/ml ascorbic acid, and 10 mm Na-β-glycerophosphate. The osteogenic inductive medium was replaced every 2 days. After

3 incubation for 7, 10, and 14 days, the cells seeded on all the Ti samples were fixed by 4% paraformaldehyde (Sigma-Aldrich) and stained with an ALP kit (Beyotime, Shanghai, China). Then the cells were incubated with p-nitrophenyl phosphate (pnpp, Sigma-Aldrich) for 30 min, and ALP activity was evaluated through measurement of optical density using the spectrophotometer at 405 nm. The total protein content was calculated employing Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA) and normalized relative to bovine serum albumin (BSA, Sigma-Aldrich) at 630 nm. A total of 4 samples per coating composition were examined at each time point, and the final results are shown as mean values ± standard deviations. Western blot assay Seeded at a density of cells/well, the BMSCs were cultured on Ti samples for 48 h. The cells were then trypsinized and lysed in the RIPA buffer (Roche, Switzerland). The protein concentration in the extracted lysates was determined using a BCA protein assay kit (Beyotime, China). The samples were separated by SDS-PAGE and transferred onto a PVDF membrane (Bio-Rad, USA). The membrane was then blocked with 5% BSA (Gibco, USA) in the TTBS solution. The samples were then incubated with anti-integrinβ1, anti-vinculin, anti-runx-2, and anti-opn primary antibody (1:500 dilution; Abcam, UK) and followed by horseradish peroxidase (HRP) conjugated secondary antibody (1:3500 dilution; CST, USA) for 60 min at room temperature. The intensity of the protein bands were quantified on a Western-Light Chemiluminescent Detection System.

4 Quantitative real-time PCR analysis After incubation with the Ti disc samples for 24 h and 48 h, the cells were collected for qrt-pcr test to explore RNA expression of the following factors: integrinβ1, vinculin, runt-related transcription factor 2 (Runx-2), collagen type I (Col-I), osteopontin (OPN) and osteocalcin (OCN). After the cells were detached by 0.25% trypsin-1 mm EDTA (Gibco BRL, Gaithersburg, MD, USA), total RNA was extracted employing TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then the mrna was reversely transcribed to cdna with the aid of a first-strand cdna synthesis kit (Takara, Shiga, Japan). After that, the relative expression levels of the osteogenic factors were determined using a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). GAPDH was used as the internal RNA control and the primer sequences were listed in Supplementary Table S1. Animal model The in vivo animal study was conducted in accordance with international standards on animal welfare as well as the Animal Research Committee of the university. A total of 40 Sprague-Dawley rats (age 3 months, weight g, Animal Research Center, Sichuan University, China) were used in the present study. The rats were placed under general anesthesia with abdominal injection of ketamine (100 mg/kg, Yuhan, Seoul, Korea) and xylazine (10 mg/kg, Bayer, Ansan, Korea). Bilateral longitudinal incisions (length: 10 mm) were made along the medial side of the knee joint, and a 1-mm hole was drilled using an inter-condylar notch, cooling with sterile saline solution. The rats were randomly assigned into four groups (Group A, B, C, and D, n=10 animals per group) and inserted with the

5 titanium implants (n=20 samples per group) as follows: Group A (cp-ti), Group B (P-C-Ti), Group C (P-G-Ti), and Group D (P-R-Ti). The implantation was made into the medullary canal of the metaphysis until the implant reached the articular surface, and the patella was relocated, reconstructing the extensor mechanism. The rats received intramuscular antibiotic and analgesic injection for 3 days and were allowed for free activities ad libitum. Twelve weeks following the surgery, the rats were sacrificed and the proximal tibiae (together with the titanium implant) were harvested for the following evaluations. Micro-CT evaluation 12 weeks after surgery, the specimens (n=10 per group) were harvested and surveyed by a high resolution µ-ct scanner system (Scanco Medical µ-ct 50, Switzerland). For the best X-ray scanning effect, the parameter of voltage, electric current, and integration time was set at 70 kv, 120µA and 700ms, respectively. The multi-level thresholds were applied and the reconstructive layer thickness was set to 10µm. To distinguish the implant from the bone, the threshold value was set to In peripheral quantitative evaluation, the constrained Gaussian filter value was maintained at σ = 1. 2 and support = 1. Histological analysis 12 weeks after the surgery, undecalcified dissections were conducted for the other half tibiae with implants (n=10 per group) The samples were fixed with 4% formalin buffered solution, rinsed by water and progressively dehydrated in ethanol with different concentrations (20%, 40%, 60%, 75%, 90%, and 100%). After being immobilized in poly-methyl-methacrylate

6 resin, the specimens were sectioned longitudinally into 80 µm thick slices using a rotary cutting saw (SP1600, Leica, Germany) and polished down to ~ 50µm using a polishing machine (Buelher Metaserv 2000). 1% toluidine blue was used to stain the trabecula bone for observation in VOI. The histological evaluation was carried out on sections approximately 1mm below the growth plate using a Leica DM-RBE microscope (Leica, Germany). Bone area ratio (BA), defined as the percentage of mature bone to the whole tissue region within a ring area extending 250 µm from the implant surface; and bone-to-implant contact (BC), defined as the percentage of the linear fraction of mineralized bone in direct contact with the implant interface, were calculated with the aid of the NIS-Elements F2.20 image software (Media Cybernetics, USA). Table S1. Primers Designed for Each Targeted Genes. Gene Forward primer Reverse primer Integrinβ1, GTGCCTCTTGACTACACGACC GGCGGAAAGGGTTATCCTTCA Vinculin TCTCGCACCTGGTGATTATGC TGAACAGTCTCTTTTCCAACCC Runx-2 CAGGCGTATTTCAGATGATGACA TAAGTGAAGGTGGCTGGATAGTG Col-I AACAGTCGCTTCACCTACAG AATGTCCAAGGGAGCCAC OPN CTACGACCATGAGATTGGCAG CATGTGGCTATAGGATCTGGG OCN GGAGGGCAGTAAGGTGGTGA ACGGTGGTGCCATAGATGC GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

7 Figure S1. Quantification of protein adsorption area on each sample Figure S2. A: Flow cytometry analysis for cell proliferation. SSC and FSC showed the target cells are almost identical, B: Target cells in each group, C: Quantitative analysis of S phase cells proportion in different samples. *p < 0.05 vs cp-ti.

8 Figure S3. The integrinβ1 and vinculin expressions of BMSCs after 48h culture in each group observed by CLSM. The magnification of the images is 800. Figure S4. A: ALP stain for BMSCs on day 7 for each group, B: The relative ALP activity of BMSCs incubated on different samples for 1,3 and 7days. *p < 0.05 vs cp-ti, #p < 0.05 vs P-C-Ti, ^p < 0.05 vs P-G-Ti.

9 Figure S5. The OCN and OPN expression of BMCSs after 48h culture in each group investigated by CLSM. The magnification of the images is 800.

10 Figure S6. A: Insertion of implants; B: the position of the implant in the tibia.