Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Size: px

Start display at page:

Download "Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene"

Merryl Allen
5 years ago
Views:

1 Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen, Pei Han, Jin Yang, Kryn Stankunas, Bingruo Wu, Minggui Pan, Bin Zhou, Michael T. Longaker, and Ching-Pin Chang Inventory of Supplemental Information Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene deletion only in the bulge and bulge-derived cells but not in the epidermis. It also shows that Nfatc1Cre;Brg1 f/f mice had no defects in hair morphogenesis before the first hair regeneration cycle began. Furthermore, Figure S1 reveals normal epidermal differentiation in Nfatc1Cre;Brg1 f/f mice. This figure is important to show the specificity of Brg1 deletion and hair follicle phenotype. Supplemental Figure 2 (Figure S2), related to Figure 2 Figure S2 provides evidence to show the absence of skin permeability defects in the mutant mice and to show the requirement of bulge Brg1 for the early phase of wound repair. Supplemental Figure 3 (Figure S3), related to Figure 3 Figure S3 provides evidence to show the absence of bulge cell apoptosis in the mutant mice and in human bulge cells with BRG1 knocked down. It also provides a validation of

2 bulge cell marker expression in the human bulge cells and a quantitation of BRG1 protein in human bulge cells with BRG1 knocked down. Supplemental Figure 4 (Figure S4), related to Figure 4 Figure S4 shows Wnt signaling in the hair follicles of TOPGAL mice and multiple repeats of Shh RNA-in Situ images to further support Figure 4. Supplemental Figure 5 (Figure S5), related to Figure 5 Figure S5 shows the predicted binding sites of NF B on Shh promoter. Supplemental Figure 6 (Figure S6), related to Figure 7 Figure S6 shows the rescue of cell proliferation and p27 Kip1 expression by Shh driven by a heterologous CMV promoter in Brg1-deficent human bulge cells. Supplemental Experimental Procedures Complete list of the primary antibodies used for immunostaining, western blots and Co-IP. Sequences of PCR primers for ChIP and RT qpcr. Detailed protocol for in vitro BrdU labeling in bulge cells.

9 Supplemental Figure Legends Figure S1, related to Figure 1 Hair morphogenesis and epidermal differentiation are normal in mutant (A and B) X-gal staining of the skin of Nfatc1Cre;Brg1 f/+ ;R26R (A) and Nfatc1Cre;Brg1 f/f ;R26R (B) at embryonic day 17 (E17). Dashed lines indicate the developing hair follicles. (C F) Immunostaining of Brg1 (red) in the skin of Brg1 f/f (C, E) and Nfatc1Cre;Brg1 f/f (D, F) at E17 (C, D) and P7 (E, F). DAPI (DNA): blue. Dashed lines mark the epidermal and dermal junction. Arrows point to the hair follicles and epidermis. (G I) Hair coat of Brg1 f/f (G), Nfatc1Cre;Brg1 f/+ (H), and Nfatc1Cre;Brg1 f/f (I) mice at P20. (L O) Hematoxylin eosin staining of hair follicles of Brg1 f/f mice at P7 (L) and P19 (N), as well as hair follicles of Nfatc1Cre;Brg1 f/f mice at P7 (M) and P19 (O). (P and Q) Immunostaining of Pbx1 (brown) in the hair follicle dermal papilla at P22. DP: dermal papilla. Counterstain: hematoxylin. (R and S) Immunostaining of K5 (pink) of Brg1 f/f (R) and Nfatc1Cre;Brg1 f/f (S) skin at P50. DAPI: blue. (U and V) Immunostaining of K10 (green) of Brg1 f/f (U) and Nfatc1Cre;Brg1 f/f (V) skin at P30. DAPI: blue. (W and X) Immunostaining of Loricrin (brown) of Brg1 f/f (W) and Nfatc1Cre;Brg1 f/f (X) skin at P50. Counterstain: hematoxylin. Figure S2, related to Figure 2 Mutant skin has normal barrier function but impaired wound repair

10 (A and B) Toluidine blue staining of whole embryos of Brg1 f/f and Nfatc1Cre;Brg1 f/f at E14 (A) and E18 (B). (C and D) Toluidine blue staining of the back skin of Brg1 f/f (C) and Nfatc1Cre;Brg1 f/f (D) at P60. Positive staining was seen in E12 Brg1 f/f and Nfatc1Cre;Brg1 f/f embryos (pointed by white arrows). (E and F) X-gal staining of skin incision sites of Nfatc1Cre;Brg1 f/+ ;R26R (C) and Nfatc1Cre;Brg1 f/f ;R26R (D) two days after skin incision. Figure S3, related to Figure 3 No increased cell death in Brg1-null follicles and validation of human bulge cells (A F) TUNEL staining of Brg1 f/f (A, C, E) and Nfatc1Cre;Brg1 f/f (B, D, F) follicles at P22, P32 and P50. TUNEL: Green. DAPI: blue. (G I) Immunostaining of K15 (red, G), SOX9 (pink, H) and BRG1 (green, I) in human bulge cells. Feeder: NIH-3T3 feeder cells. Arrows point out feeder and bulge cells. (J) Quantification of Brg1 protein in sictrl and sibrg1 bulge cells with or without doxycycline treatment by western blots. P values were calculated using the Student s t-test. Error bars are data + 1 standard error. Figure S4, related to Figure 4 Shh expression is absent in Nfatc1Cre;Brg1 f/f follicles (A D) X-gal staining of Brg1 f/f ; TOPGAL (A, C) and Nfatc1Cre;Brg1 f/f ; TOPGAL (B, D) follicles at P22 and P40. Counterstain: nuclear fast.

11 (E J) Shh RNA in situ hybridization of Brg1 f/f (A, C, E) and Nfatc1Cre;Brg1 f/f (B, D, F) follicles at P22 and P32. Figure S5, related to Figure 5 Predicted NFκB binding sites on the Shh promoter Schematic illustration that shows the predicted NFκB binding sites (purple bars) on the Shh promoter. S1 S8: evolutionarily conserved regions of the Shh promoter. Figure S6, related to Figure 7 Rescue of cell proliferation and p27 Kip1 expression by Shh in Brg1-deficent human bulge cells (A D) Growth of human bulge cells 48 hours after doxycycline (Dox) treatment and sictrl (A, C) or sibrg1 (B, D) infection in the presence of control lentivirus (A, B) or SHH-expressing lentivirus (C, D). SHH expression is driven by CMV promoter in the lentiviral construct. (E and F) Quantitation of BRG1 and p27 Kip1 expression in human bulge cells 48 hours after doxycycline treatment and sictrl or sibrg1 infection in the presence of control lentivirus (E) or SHH-expressing lentivirus (F). P values were calculated using the Student s t-test. Error bars are data + 1 standard error.

12 Supplemental Experimental Procedures Primary antibodies for immunostaining, western blots and ChIP The following primary antibodies were used for immunostaining: J1 anti-brg1 antibody (Hang et al., 2010), G7 anti-brg1 (sc-17796, Santa Cruz Biotechnology), Ki67 (M7249, Dako), cytokeratin 15 (K15) (ab80522, Abcam), Nfatc1 (7A6) (sc-7294, Santa Cruz biotechnology), Sox9 (H-90) (sc-20095, Santa Cruz biotechnology), BrdU (ab6326, Abcam), β-tubulin (Clone E7, Hybridoma Bank), p27 kip1 (ab7961, Abcam), β-catenin (ab16051, Abcam), psmad2/3 (sc , Santa Cruz Biotechnology), Gli1 (ab49314, Abcam), NFkB p65 (ab7970, Abcam), Patched1 (ab39266, Abcam), cytokeratin 5 (K5) (ab24647, Abcam), cytokeratin 10 (K10) (ab9025, Abcam), Loricrin (ab85679, Abcam) and Gli2 (ab26056, Abcam). PCR primers for ChIP experiment PCR primers for the conserved regions of Shh promoter: S1 (+81 to 105); S2 ( 651 to 821); S3 ( 753 to 990); S4 ( 1,007 to 1,243); S5 ( 1,694 to 1,803); S6 ( 2,960 to 3,148); S7 ( 3,421 to 3,520); S8 ( 3,730 to 3,813). Control primers (SC1-4) for the non-conserved regions of the Shh promoter: SC1 ( 5,471 to 5,657), SC2 ( 6,562 to 6,759), SC3 ( 6,911 to 7,142), SC4 ( 7,548 to 7,726). Control primers for conserved regions of α-mhc, ß-MHC, and Bmp10 promoters (P1-P4): α-mhc ( 357 to 463), ß-MHC ( 64 to 205), P1 ( 264 to 411), P2 ( 1,430 to 1,579), P3 ( 1,724 to 1,868), and P4 ( 4,420 to 4,529). B1-B4 primer sets were designed to target the proximal promoter (B1) or predicted Gli binding sites (B2 B4) on the mouse or human BRG1 promoter: B1 ( 403 to 604); B2 ( 647 to 793); B3 ( 2566 to

13 2760); B4 ( 3793 to 3904). The DNA positions are denoted relative to the transcriptional start site (+1). Reverse transcription quantitative PCR (RT qpcr) The RT-qPCR reactions were performed using SYBR green master mix (BioRad, Hercules, CA). The primer sets used were tested to be quantitative: Human p27 Kip1, 5 primer CGTAAACAGCTCGAATTAAGAA, 3 primer CATTCCATGAAGTCAGCGATA. Human Cdk4, 5 primer ACAGCTACCAGATGGCACTTACA, 3 primer AAAGATACAGCCAACACTCCACA. Human Cdk6, 5 primer ACGTGGTCAGGTTGTTTGATGT, 3 primer TATCCTTTATGGTTTCAGTGGG, Human Cyclin D1, 5 primer AAAATGCCAGAGGCGGAGGAGA, 3 primer GGAGGGCGGATTGGAAATGAAC, Human Cyclin D2, 5 primer CTTCAAGTGCGTGCAGAAGGA, 3 primer CCAAGAAACGGTCCAGGTAAT, Human p16 INK4a, 5 primer TAAGTGCTCGGAGTTAATAGC, 3 primer CCTGTCCCTCAAATCCTCTG, Human H3F3A, 5 primer AAAACAGATCTGCGCTTCCA, 3 primer TTGTTACACGTTTGGCATGG. Human Brg1, 5 primer AGTGCTGCTGTTCTGCCAAAT, 3 primer GGCTCGTTGAAGGTTTTCAG. BrdU labeling Before harvesting, cells are incubated with 50 µm bromodexoyuridine (BrdU; B5002, Sigma- Aldrich) for 20 min at 37 C. The NIH-3T3 feeder cells were removed by Versene solution ( , Invitrogen) and the bulge cells were fixed, washed, permeabilized by 0.1% Triton X-

14 100 (T8532, Sigma-Aldrich) and then blocked in 3% bovine serum albumin (BSA, A2058, Sigma-Aldrich). The primary antibodies used were described above.

Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair

Article Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, 1 Wei Li, 1 Ching Shang, 1 Richard M. Chen, 1 Pei Han, 1 Jin Yang, 1 Kryn Stankunas,