Manufacturing and Characterization Challenges for Human Stem Cell Products
|
|
- Roderick Fox
- 5 years ago
- Views:
Transcription
1 Manufacturing and Characterization Challenges for Human Stem Cell Products Center for Biomedicine and Genetics Beckman Research Institute of City of Hope Larry A. Couture, Ph.D January, 2009
2 Center for Biomedicine and Genetics Established Jan ,000 square ft. 2 story 10,000 square ft. classified space 3 zones, 12 production rooms class 100 fill suite Products Plasmid DNA Lentivirus Adenovirus Oncolytic vectors mab Recombinant proteins Bacterial products Cell Products Islet cells T-cell CD34+ hesc Neural stem cells
3 The Stem Cell Promise A potential source of transplantable cells to regenerate injured or lost tissues or to restore functions lacking through acquired or inherited disorders. What are Stem Cells? Cells capable of self renewal and the ability differentiate into multiple cell types and tissues in response to biological cues.
4 Are Stem Cells a new Biologic Class The stem cell class: Type Source Potential Clinical Embryonic (hesc) Embryos Totipotent or Pluripotent pending Fetal (NSC) Fetal tissue Multipotent 10 years Adult (CD34+, ASC, MSC) Adult tissue Multipotent 30 years Induced Pluripotent Stem Cells Adult Tissue Totipotent or Pluripotent no All: Capable of self renewal and the ability differentiate into multiple cell types and tissues in response to biological cues. New types and new challenges? Yes A new class? NO
5 Regulation of Stem Cell Therapies Novel biologic therapies comprised of or derived from stem cells will be regulated as human cells, tissues or cellular and tissue- based products (HCT/Ps). HCT/Ps means articles containing or consisting of human cells or tissues that are intended for implantation, transplantation, infusion or transfer into a human recipient.
6 What makes hesc and ipsc unique Safety tumorgenicity Stability genetic Cell culture Source political and social = Characterization and development challenges
7 Development Challenges Source control Derivation Manufacturing Pre-clinical models Characterization safety, purity/identity and stability
8 Undifferentiated hesc Are Not Homogenous Populations hesc H9 hesc H9 SSEA-4 Tra-1-60 Tra-1-81
9 Scalability ROCK Inhibitor-Y27632 H9 p31 No Inhibitor With Inhibitor Inhibitor Removed
10 Defining The Stem Cell Product Undifferentiated hesc MCB Intermediate MCB Differentiated product MCB Differentiation Process (Days to weeks) Tumorgenicity? Safety
11 Characterization Safety, Purity/Identity, Stability Multi-parametric analytical testing Morphologic evaluation Detection of phenotype-specific surface markers Unique biochemical markers Gene and protein expression analyses Epigenetic profiling Cellular impurities profile assessment Biologic activity assessment MHC/HLA expression Tumorgenicity assays
12 Safety Animal testing: Safety Assessment Cell survival post-transplantation Cell migration Cell fate - plasticity; differentiation/ phenotype expression; fusion Tissue integration Tumorigenicity - hyperplastic or unregulated growth What is a relevant animal model? What is the sensitivity of animal model for tumorgenicity? Can hesc spiking experiments address uncommitted cell contaminants?
13 Stability (hesc MCB) hesc P79 TaqI SSEA-4 +/- P29- P29+ P79- P79+ Hep Normal Karyotype TTTTAGGAGGGTTTTGGAAGTTTAGTTAGGTTCGAGGATTAATTTAGTTCGGTTTCGGTTT TTTTGGTTTATTATTTTTATTATTTGGAGGGGGCGAGAAGGCGAAATTCGAAGTTAGGTG TTTCGTTATGGGGAAGGAAGGCGTTTTAAGTCGGGGGTTTGGTGAAATGAGGGTTTGCGA AGGGATTATTTAATTTTTTTTTTTTTTTTTAGTTTTATTTATTAGTTTTGATTTTTGGTTTC p29 SSEA-4 (-) 40% p79 SSEA-4 (-) 45% Liver cells p29 SSEA-4 (-) 58% p79 SSEA-4 (-) 58% p29 SSEA-4 (+) 0% p79 SSEA-4 (+) 0% p29 SSEA-4 (+) 6% p79 SSEA-4 (+) 8% OCT4 promoter methylation correlates with loss of SSEA-4 NANOG promoter methylation correlates with loss of SSEA-4
14 Summary hesc are not a new class of biologics but do present unique characterization and development challenges Existing regulatory paradigms are applicable for now New approaches to demonstrating identity, stability and purity may be necessary Developing suitable Safety tests may prove the most challenging
15 Acknowledgements Manufacturing David Hsu Matthew Luo Lara Ausubel Sylvana Couture Patricia Lopez Christine Knoblauch Cassidy Yang Ross McMahon Jonathan Anderson Ivy Derecho Valerie Quezada Nina Dunphy QA Yasmine Shad David Ceniceros Luis Gutierrez Misty Shakeley Jose Valdez Mosleh Alkhatabeh Mario Marcelo QC Patricia Huang Kunal Jariwala Rafat Khan COH Art Riggs Zunde Wang
16 H9 ES Embryoid Body
17 Derivation and Manufacturing Media for culturing hescs routinely supplemented with bovine serum, growth factors as well as other animal-derived ancillary products Bovine serum is acceptable provided demonstration that source is from herds BSE-free countries. Clinical-grade serum sourced from humans Develop serum-free, chemically defined medium. hesc lines established on non-human feeder cell layers: Fit the FDA definition of xenotransplantation FDA does not intend xenotransplantation requirements to preclude use of hescs in human clinical trials For stem cell products derived from hesc lines raised on non-human feeders it may be necessary to demonstrate that the line is free from infectious agents a that may pose a risk for transmission to recipients Adventitious agent testing is equally important when feeders are comprised of human cells
18 Source control Evaluating human stem cell sources: Informed consent Appropriate screening/testing of donor tissue for communicable disease [Donor Eligibility Rule] Implications of genetic analysis Intrinsic safety concerns based on cell source (adult, fetal, embryonic)
19 Purity (hesc MCB) Immunohistochemistry OCT-3/4 nuclear transcription factor NANOG nuclear transcription factor Alkaline Phosphatase FACS Analysis SSEA-4 Tra-1-60
20 Characterization Demonstrate through analytical and clinical testing: Sterility Purity * Potency Identity Stability * Safety * Efficacy
IND - Cell Therapy. Robert W. Lindblad, MD, FACEP. Where Did you Hear
IND - Cell Therapy Robert W. Lindblad, MD, FACEP Where Did you Hear The EMMES Corporation CRO Coordinating Center Cell Therapy PACT Production Assistance for Cellular Therapy Bone Marrow Transplant Network
More informationCMC Considerations for Stem Cell-based. Donald W. Fink, Jr., Ph.D.
Food and Drug Administration Center for Biologics Evaluation and Research CMC Considerations for Stem Cell-based Products Donald W. Fink, Jr., Ph.D. Phone: (301) 827-5153 E-Mail: donald.fink@fda.hhs.gov
More informationStem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan
Stem Cells & Neurological Disorders Said Ismail Faculty of Medicine University of Jordan Outline: - Introduction - Types & Potency of Stem Cells - Embryonic Stem Cells - Adult Stem Cells - ipscs -Tissue
More informationInduced Pluripotent Stem Cell
Induced Pluripotent Stem Cell When eventually mastered, the processes involved in the obtaining, cultivating and differencing ESC into cells of clinical interest, another practical limitation should be
More informationhpsc Growth Medium DXF Dr. Lorna Whyte
hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research
More informationXeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
More informationCurrent Considerations on Chemistry, Manufacturing and Control of Cell Therapy Products (CTPs)
Current Considerations on Chemistry, Manufacturing and Control of Cell Therapy Products (CTPs) Wei Wei Ph.D Center for Drug Evaluation, National Medical Products Administration (CDE,NMPA) 2018/12/04 Tokyo
More informationANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)
ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent
More informationStem Cel s Key Words:
Stem Cells Key Words: Embryonic stem cells, Adult stem cells, ips cells, self-renewal, differentiation, pluripotent, multipotent, Inner cell mass, Nuclear transfer (Therapeutic cloning), Feeder cells,
More informationFuture of Stem Cell Engineering. Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST
Future of Stem Cell Engineering i Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST Keywords of Stem Cell Engineering g Embryo and Fetus (Foetus) Adult stem cells and embryonic stem cells
More informationNPTEL Biotechnology Tissue Engineering. Stem cells
Stem cells S. Swaminathan Director Centre for Nanotechnology & Advanced Biomaterials School of Chemical & Biotechnology SASTRA University Thanjavur 613 401 Tamil Nadu Joint Initiative of IITs and IISc
More informationAssuring Pluripotency of ESC and ipsc Lines
Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells
More informationWill Stem Cells Finally Deliver Without Controversy?
Will Stem Cells Finally Deliver Without Controversy? Keith Gary, Ph.D. Director of Program Development Kansas City Area Life Sciences Institute Olathe North Life Sciences 1 February 2012 What s the Buzz?
More informationMolecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics
Molecular Medicine Molecular Medicine Stem cell therapy Gene therapy Tumor therapy Immunotherapy Other therapies Vaccines Genetic diagnostics Medical genomics Medication Diagnostics medicine: old desire
More informationLecture 17. Transgenics. Definition Overview Goals Production p , ,
Lecture 17 Reading Lecture 17: p. 251-256, 260-261 & 264-266 Lecture 18: p. 258-264, 508-524 Transgenics Definition Overview Goals Production p.251-256, 260-261, 264-266 315 Definition A transgenic animal
More informationStem Cells, Regenerative Medicine and cgmp (GTP)
Stem Cells, Regenerative Medicine and cgmp (GTP) Encompass Stem cell based therapies activities Collection source Purification Isolation from other cell types if needed Manipulation Minimal vs Moderate
More informationBeth Hutchins, PhD PhRMA ICH Gene Therapy Discussion Group
ICH Considerations on General Principles to Address the Risk of Inadvertent Germline Integration of Gene Therapy Vectors and Current Topics on Gene Therapy in USA Beth Hutchins, PhD PhRMA ICH Gene Therapy
More informationPRIME-XV Cell Therapy Products by
PRIME-XV Cell Therapy Products by Product List 2017 TRINOVA BIOCHEM now distributes the PRIME-XV Cell Therapy line by Irvine Scientific in Germany, Austria and Switzerland. Irvine Scientific is a worldwide
More informationCase Study: Examples Relating to the Quality Control of Cell-based Products
Case Study: Examples Relating to the Quality Control of Cell-based Products CMC Strategy Forum Japan 2014 Yuuki Miyatake1), 2) 1) TEIJIN PHARMA LIMITED 2) Japan Pharmaceutical Manufacturers Association
More informationOutcomes in Mesenchymal Stem Cell Manufacturing. Athena Russell, MT(AAB) Human Cellular Therapy Laboratory Mayo Clinic Jacksonville, FL
Outcomes in Mesenchymal Stem Cell Manufacturing Athena Russell, MT(AAB) Human Cellular Therapy Laboratory Mayo Clinic Jacksonville, FL Background HCTL established in 1992 to support BMT programs of Mayo
More informationFDA Update. Scott A. Brubaker, CTBS Director, Division of Human Tissues Office of Tissues and Advanced Therapies CBER/FDA
FDA Update Scott A. Brubaker, CTBS Director, Division of Human Tissues Office of Tissues and Advanced Therapies CBER/FDA 13 th Annual FDA and the Changing Paradigm for HCT/P Regulation February 13, 2017
More informationSpecifications. February 19, 2015, TOKYO, JAPAN. Takao Hayakawa, Ph.D. Director, Pharmaceutical Research and Technology Institute, Kindai University
Specifications February 19, 2015, TOKYO, JAPAN Takao Hayakawa, Ph.D. Director, Pharmaceutical Research and Technology Institute, Kindai University Norihisa Sakamoto, M.D., Ph.D. Deputy Review Director
More informationPRIME-XV Cell Therapy Products by
PRIME-XV Cell Therapy Products by Product List 2017 TRINOVA BIOCHEM now distributes the PRIME-XV Cell Therapy line by Irvine Scientific in Germany, Austria and Switzerland. Irvine Scientific is a worldwide
More informationCULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers
CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION Stem Cell Research Solutions Promotional offers Stem Cell research products For more than a decade, we have provided you with key tools to address challenges
More informationfor SCI: Challenges for Entry and Execution of Phase 1 Clinical Trials Challenges and Opportunities of Cellular Therapeutic Development
Case Study: Human Embryonic Stem Cell Based Therapy for SCI: Challenges for Entry and Execution of Phase 1 Clinical Trials Jane S Lebkowski Ph.D NHLBI-PACT Workshop Sept 15, 2011 Challenges and Opportunities
More informationCellular and Gene Therapy Products - CBER Update
DEPARTMENT OF HEALTH AND HUMAN SERVICES CENTER FOR BIOLOGICS EVALUATION and RESEARCH Cellular and Gene Therapy Products - CBER Update Well Characterized Biological Products January 12-14, 2009 Kimberly
More informationStem Cells: Introduction and Prospects in Regenerative Medicine.
Stem Cells: Introduction and Prospects in Regenerative Medicine www.gothamgazette.com/.../stemcell/stem_cell.jpg Ode to a Stem Cell, Part II by VCW There once was stem cell stuck in the hood Dividing endlessly,
More informationAncillary Materials for Cell & Tissue Therapies Definitions, US Regulatory Approach, and USP s Risk-Tiered Approach
USP/ISCT Workshop 2012 Seattle, WA, USA Ancillary Materials for Cell & Tissue Therapies Definitions, US Regulatory Approach, and USP s Risk-Tiered Approach Elizabeth Read, MD Head of Product Development
More informationA simple choice. Essential 8 Media
A simple choice Essential 8 Media Your stem cells thrive with the essentials Gibco Essential 8 Medium is a feeder-free, xeno-free medium originally developed in the laboratory of stem cell research pioneer
More informationStem Cell Research 101
Stem Cell Research : A promising type of bioscience research The Stem Cell debate and the impact of the induced pluripotent stem cell procedure Why Is Vocabulary Important? Key terms frame the debate Mature
More informationDeveloping Targeted Stem Cell Therapeutics for Cancer. Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013
Developing Targeted Stem Cell Therapeutics for Cancer Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013 The Challenge of Drug Delivery for Brain Cancer Stem Cells
More informationGENERATION OF OFF-THE-SHELF TCR-LESS CAR T CELLS FROM RENEWABLE PLURIPOTENT CELLS
GENERATION OF OFF-THE-SHELF TCR-LESS CAR T CELLS FROM RENEWABLE PLURIPOTENT CELLS Bob Valamehr, PhD Vice President, Fate Therapeutics AACR Annual Meeting 2018 Press Program McCormick Place North/South
More informationGenetic Technologies
Genetic Technologies Distinguish the terms biotechnology, recombinant DNA technology, transgenic organisms, genetic engineering Understand the two basic techniques to obtain selective fragments of DNA
More informationDes cellules-souches dans le poumon : pourquoi faire?
Des cellules-souches dans le poumon : pourquoi faire? Karl-Heinz Krause Dept. of Pathology and Immunology, Medical Faculty Dept. of Genetic and Laboratory Medicine, University Hospitals Geneva, Switzerland
More informationSTEM CELL ETHICS: THE NEGLECTED ISSUES. Dr. Christie Holland Rev. Dr. Karen Lebacqz
STEM CELL ETHICS: THE NEGLECTED ISSUES Dr. Christie Holland Rev. Dr. Karen Lebacqz Stem Cell Science -- some basic terms totipotent = able to make an entire organism. pluripotent = able to make all types
More informationRegulatory considerations for manufacturing and testing of investigational chimeric antigen receptor (CAR) T-cell products
Regulatory considerations for manufacturing and testing of investigational chimeric antigen receptor (CAR) T-cell products Xiaobin Victor Lu Product Reviewer Gene Therapies Branch DCGT/OCTGT/CBER/FDA MEASUREMENT
More informationSabrina Jedlicka. Interactions of Neurons and Materials
Sabrina Jedlicka Interactions of Neurons and Materials Developmental Cell Biology Some Perspective Stem cells: Undifferentiated cells that are capable of proliferation, self-maintenance and differentiation
More informationRaw Materials: Sourcing and Qualification Testing
Raw Materials: Sourcing and Qualification Testing Scott R. Burger, MD Advanced Cell & Gene Therapy Technical Applications Track 2 ISCT 2009 Sourcing Raw Materials Raw materials for cell/gene therapy manufacturing
More informationManufacturing Challenges with Cell and Gene Therapy Products: A Health Canada Perspective
Manufacturing Challenges with Cell and Gene Therapy Products: A Health Canada Perspective CASSS CMC Summer Forum 2017 Chris Storbeck, PhD Health Canada Outline Health Canada organization Regulation of
More informationA Life Cycle Approach to Raw Material Qualification for Cell and Gene Therapy Products
A Life Cycle Approach to Raw Material Qualification for Cell and Gene Therapy Products Angela Whatley, Ph.D. Office of Tissues and Advanced Therapies CBER/FDA CMC Strategy Forum on Cell & Gene Therapies
More informationStem Cell Principle -
Effective Date: 31.10.2017 Doc ID: 20290214 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Stem Cell Principle - Rationale Research on human stem cells and their
More informationA Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs
Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,
More informationBME 177. Engineering stem cells. Gayatri Pal Lecturer Biomolecular Engineering
BME 177 Engineering stem cells Gayatri Pal Lecturer Biomolecular Engineering Introduction Graduated from MCD Biology (Yeast Cell Cycle) -CIRM classes (Introduction to stem cell biology) Post-doc training
More informationProtocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationFDA Inspections: FDA Inspections: An Overview Overview
FDA Inspections: An Overview Robert Lindblad, MD The EMMES Corporation August 11, 2011 researchcartoons.com Why Inspections? Why Inspections? To evaluate compliance with regulations To establish that an
More informationDec 04, 2013
Stem Cells Junfeng Ji ( 纪俊峰 ), PhD Professor Research Center of Stem Cell and Developmental Biology School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cn Dec 04, 2013 Totipotent Pluripotent
More informationFirst xeno-free serum replacement for pluripotent stem cells
Stem Cell Research First xeno-free serum replacement for pluripotent stem cells KnockOut SR XenoFree Stem Cell Research New, xeno-free growth and expansion of hescs and human ipscs KnockOut SR XenoFree
More informationDirected differentiation of human embryonic stem cells
Directed differentiation of human embryonic stem cells TECAN Symposium 2008 Biologics - From Benchtop to Production Wednesday 17 September 2008 Andrew Elefanty Embryonic Stem Cell Differentiation Laboratory,
More informationTherapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota
Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Neuronal Death Neurons are lost due to four main causes: Trauma Toxin Hypoxia (typically loss of air or blood
More informationProtocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationRealizing the Future that Regenerative Medicine Will Open
470 Hitachi Review Vol. 65 (2016), No. 9 Featured Articles Realizing the Future that Regenerative Medicine Will Open Shizu Takeda, Ph.D. OVERVIEW: Regenerative medicine is an innovative approach to medicine
More informationBIOTECHNOLOGY. Unit 8
BIOTECHNOLOGY Unit 8 PART 1 BASIC/FUNDAMENTAL SCIENCE VS. APPLIED SCIENCE! Basic/Fundamental Science the development and establishment of information to aid our understanding of the world.! Applied Science
More informationRegulation of Biologics in The United States: From a Rich Tradition To A Challenging Future
Regulation of Biologics in The United States: From a Rich Tradition To A Challenging Future Chris Joneckis,, Ph.D. Senior Advisor For CMC Issues Center For Biologics Evaluation And Research Food and Drug
More informationMatrices sourcebook. Your guide to Gibco extracellular matrices products
Matrices sourcebook Your guide to Gibco extracellular matrices products Introduction Gibco products, including extracellular matrices, 3D scaffolds, and attachment proteins, are essential tools for providing
More informationIps Cells Can Be Efficiently Differentiated Back To Mscs Using A Short Exposure To Tgfβ
Ips Cells Can Be Efficiently Differentiated Back To Mscs Using A Short Exposure To Tgfβ Dmitriy Sheyn, PhD 1, Shiran Ben-David, BSc 1, Sandra Ann De Mel, BSc 1, Loren Ornelas, BSc 1, Anais Sahabian, MSc
More informationProtocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
More informationVersatility and performance of Lipofectamine Stem Transfection Reagent
PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types
More informationCélulas madre con pluripotencia inducida: posibles aplicaciones clínicas
Células madre con pluripotencia inducida: posibles aplicaciones clínicas Angel Raya ICREA Research Professor Control of Stem Cell Potency Group Institute for Bioengineering of Catalonia Barcelona, Spain
More informationYoji SATO, Ph.D. Head, Division of Cellular & Gene Therapy Products National Institute of Health Sciences, Tokyo, Japan
NIHS Since 1874 Yoji SATO, Ph.D. Head, Division of Cellular & Gene Therapy Products National Institute of Health Sciences, Tokyo, Japan October 21, 2013 DISCLAIMER: The views and opinions expressed in
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More informationCell Characterization: Developing Assays to Address the Biological Parameters of Identity and Potency
Cell Characterization: Developing Assays to Address the Biological Parameters of Identity and Potency Jessica Carmen Ph.D and Jon Rowley Ph.D., LBS-TCS, May 2011 Disclaimer Certain matters discussed in
More informationThe Elite Provider. Cell & Gene. Therapy Manufacturing
The Elite Provider Cell & Gene Therapy Manufacturing GMP Manufacturing Services The cgmp manufacturing in Vigene is compliant with US FDA and EU EMA regulatory requirements. The manufacturing area consists
More informationSupplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationMOUSE EMBRYONIC STEM CELL PRODUCTS FBS- ES QUALIFIED MESENCHYMAL STEM CELL QUALIFIED MEDIA STEM CELL PRODUCTS
www.lifetechindia.com NUTRISTEM HUMAN EMBROYNIC STEM CELL MEDIA MOUSE EMBRYONIC STEM CELL PRODUCTS FBS- ES QUALIFIED MESENCHYMAL STEM CELL QUALIFIED MEDIA STEM CELL PRODUCTS To order contact: 36, Aggarwal
More informationQuality of raw materials and manufacturing of advanced therapies. Fouad Atouf, Ph.D. Head, Global Biologics July 12, 2018
Quality of raw materials and manufacturing of advanced therapies Fouad Atouf, Ph.D. Head, Global Biologics July 12, 2018 Evolution of the compendia 1820: a single recipe book 2018: Procedures and acceptance
More informationCQAs for C> Products to Enable Comparability Assessment. Ben Thompson Snr Director, Biopharmaceutical CMC RA GlaxoSmithKline
CQAs for C> Products to Enable Comparability Assessment Ben Thompson Snr Director, Biopharmaceutical CMC RA GlaxoSmithKline Overview Demonstrate the value of defining CQAs early in product development
More informationANAT 2341 Embryology Lecture 18 Stem Cells
ANAT 2341 Embryology Lecture 18 Stem Cells 29 September 2010 Dr Antonio Lee Neuromuscular & Regenera
More informationRegulatory Approval of Modern Gene-Based Cancer Immunotherapies CAR T Cells A product perspective
Regulatory Approval of Modern Gene-Based Cancer Immunotherapies CAR T Cells A product perspective ASQ509 Biomed/Biotech SIG 2/1/18 Xiaobin Victor Lu Division of Cellular and Gene Therapies Office of Tissues
More informationLongevity Leaders Conference. February 4, 2019
Longevity Leaders Conference February 4, 2019 Forward Looking Statements The matters discussed in this presentation include forward looking statements which are subject to various risks, uncertainties,
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationCloning. 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms:
Cloning 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms: cell division, morphogenesis, differentiation 2. Plant cloning 3. Animal cloning
More informationPluriQ TM Serum Replacement (PluriQ TM SR)
PluriQ TM Serum Replacement (PluriQ TM SR) (PluriQ SR) is a defined, serum-free supplement formulated as a direct replacement for FBS (fetal bovine serum) used in the growth and maintenance of undifferentiated
More informationAndrew Finnerty General Manager - CCMI
Andrew Finnerty General Manager - CCMI Manufacturing Human Mesenchymal Stem Cells for Clinical Trials Quality Considerations Biopharma and Pharma RQA Regional Forum Bioclin Laboratories, Athlone 13 May
More informationTherapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota
Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Coffee Hour Wednesday (Dec 13) Thursday (Dec 14) Friday (Dec 15) 9:00-10:00am Surdyk s Café in
More informationProcess and guidelines for applications for approval of trials involving gene and other biotechnology therapies. November 2015
Process and guidelines for applications for approval of trials involving gene and other biotechnology therapies November 2015 HRC Gene Technology Advisory Committee For further information contact: Professor
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationFDA Regulation of Stem-Cell Based Therapies Dina Gould Halme, Ph.D., and David A. Kessler, M.D.
The new england journal of medicine health policy report FDA Regulation of Stem-Cell Based Therapies Dina Gould Halme, Ph.D., and David A. Kessler, M.D. In the interest of public safety, the Food and Drug
More informationCell therapies to treat haematopoietic disorders
Cell therapies to treat haematopoietic disorders Haematopoietic Stem Cells (CD34) RBCs Platelets Limitations A donor required for each treatment Transfusion-transmitted infection Immunological (HLA/AB0)
More informationRegulatory science insights into cellular products and practical microscale technologies for their assessment
Regulatory science insights into cellular products and practical microscale technologies for their assessment Kyung Sung Johnny Lam November 9, 2018 Cellular and Tissue Therapies Branch Division of Cellular
More informationBGEN Laboratory Methods in Human and Medical Genetics
BMG COURSES BGEN 7000 - Research Seminar MSc Consists of presentations of the student's current research. For Master s students only. 1.0 credit hours. BGEN 7020 Proteins (Formerly 137.702) Three hours
More informationADVANCED MEDIA TECHNOLOGY
ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,
More informationThe NYSCF Research Institute
Regenerative Medicine Research Update Susan L. Solomon The NYSCF Research Institute New York Pharma Forum February 25, 2016 Regenerative Medicine Research Regenerative medicine uses laboratory grown human
More informationStem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division
Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division stem cell stem cell skin muscle nerve Properties of STEM cells Plasticity
More informationRegulatory Implications for Global Manufacturing Development of Regenerative Medicines
Regulatory Implications for Global Manufacturing Development of Regenerative Medicines Katherine Tsokas, JD June 2017 Global Regulatory Affairs Janssen Research & Development, LLC Jessica Riley, Shells
More informationXcelthera, Inc. San Diego Regenerative Medicine Institute
Direct Conversion of Pluripotent Human Embryonic Stem Cells into Functional Human Neuronal or Cardiomyocyte Cell Therapy Derivatives for Regenerative Medicine Xuejun H Parsons, PhD Xcelthera, Inc. San
More informationStem cells and motor neurone disease
Stem cells and motor neurone disease F Stem cell research has fuelled hope of a treatment for a variety of conditions. This information sheet explains what these cells are and includes details of the current
More informationReporting Deviations of Biological Products and HCT/Ps. Ellen Areman Senior Consultant Biologics Consulting Group, Inc.
Reporting Deviations of Biological Products and HCT/Ps Ellen Areman Senior Consultant Biologics Consulting Group, Inc. Relevant Legislation Public Health Service (PHS) Act Regulates biological products
More informationDisease Clinical features Genotype
Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient
More informationComponents Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5
HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives
More informationLesson 7A Specialized Cells, Stem Cells & Cellular Differentiation
Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Learning Goals I can explain the concept of cell differentiation and cell specialization. I can explain how the cell structure relates
More informationEdexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify
More informationAgilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH
Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH MONITOR CELL FATE TRANSITIONS Improve Differentiation and Reprogramming Outcomes Adult Fibroblast Cells Reprogramming (ips Cells)
More informationComparability Is Not a Nightmare, Just Think Ahead!
Comparability Is Not a Nightmare, Just Think Ahead! Margarida Menezes Ferreira Senior Assessor at INFARMED PT expert at BWP/CHMP - EMA member of the CAT - EMA (margarida.menezes@infarmed.pt) I attend this
More informationANNOUNCEMENTS. HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134)
ANNOUNCEMENTS HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134) Lecture 5: Kinetics of Cell Growth in Culture Phenomenological mathematical
More informationMatrices Sourcebook Life Technologies extracellular matrices products
Matrices Sourcebook Life Technologies extracellular matrices products Introduction Our Gibco products, including extracellular matrices, 3D scaffolds, and attachment proteins, are essential tools for providing
More informationStem Cells: Ethics and Oversight May 24, Sidney H. Golub, Ph.D. Interim Director Sue & Bill Gross Stem Cell Research Center
Stem Cells: Ethics and Oversight May 24, 2017 Sidney H. Golub, Ph.D. Interim Director Sue & Bill Gross Stem Cell Research Center Nobel Laureates 2012 John Gurdon Shinya Yamanaka Pluripotent Stem Cell PLURIPOTENT
More informationCell-based therapies in tissue engineering and regenerative medicine (TE/RM)
Cell-based therapies in tissue engineering and regenerative medicine (TE/RM) Pamela Gehron Robey, Ph.D. Craniofacial and Skeletal Diseases Branch National Institutes of Dental and Craniofacial Research
More informationProduct Information and Testing - Amended. Product Information
Product Information and Testing - Amended Product Information Product Name Lot Number Parent Material Depositor Banked by Thaw Recommendation Culture Platform Protocol Passage Number Date Vialed Vial Label
More informationLisa Griffin (BSc Hons Biology), David Hughes August 2013
Title Authors Contact Target level Publication date Lisa Griffin (BSc Hons Biology), David Hughes Maggy.fostier@manchester.ac.uk KS4 science, GCSE August 2013 Activity Length Content related to the GCSE
More informationUniversity of California Department of Bioengineering & Molecular & Cell Biology
University of California Department of Bioengineering & Molecular & Cell Biology Course Number: BioE C218 & MCB C237 Course Title: Stem Cells and Directed Organogenesis Offered: Spring Instructor: Irina
More information