Manufacturing and Characterization Challenges for Human Stem Cell Products

Size: px
Start display at page:

Download "Manufacturing and Characterization Challenges for Human Stem Cell Products"

Transcription

1 Manufacturing and Characterization Challenges for Human Stem Cell Products Center for Biomedicine and Genetics Beckman Research Institute of City of Hope Larry A. Couture, Ph.D January, 2009

2 Center for Biomedicine and Genetics Established Jan ,000 square ft. 2 story 10,000 square ft. classified space 3 zones, 12 production rooms class 100 fill suite Products Plasmid DNA Lentivirus Adenovirus Oncolytic vectors mab Recombinant proteins Bacterial products Cell Products Islet cells T-cell CD34+ hesc Neural stem cells

3 The Stem Cell Promise A potential source of transplantable cells to regenerate injured or lost tissues or to restore functions lacking through acquired or inherited disorders. What are Stem Cells? Cells capable of self renewal and the ability differentiate into multiple cell types and tissues in response to biological cues.

4 Are Stem Cells a new Biologic Class The stem cell class: Type Source Potential Clinical Embryonic (hesc) Embryos Totipotent or Pluripotent pending Fetal (NSC) Fetal tissue Multipotent 10 years Adult (CD34+, ASC, MSC) Adult tissue Multipotent 30 years Induced Pluripotent Stem Cells Adult Tissue Totipotent or Pluripotent no All: Capable of self renewal and the ability differentiate into multiple cell types and tissues in response to biological cues. New types and new challenges? Yes A new class? NO

5 Regulation of Stem Cell Therapies Novel biologic therapies comprised of or derived from stem cells will be regulated as human cells, tissues or cellular and tissue- based products (HCT/Ps). HCT/Ps means articles containing or consisting of human cells or tissues that are intended for implantation, transplantation, infusion or transfer into a human recipient.

6 What makes hesc and ipsc unique Safety tumorgenicity Stability genetic Cell culture Source political and social = Characterization and development challenges

7 Development Challenges Source control Derivation Manufacturing Pre-clinical models Characterization safety, purity/identity and stability

8 Undifferentiated hesc Are Not Homogenous Populations hesc H9 hesc H9 SSEA-4 Tra-1-60 Tra-1-81

9 Scalability ROCK Inhibitor-Y27632 H9 p31 No Inhibitor With Inhibitor Inhibitor Removed

10 Defining The Stem Cell Product Undifferentiated hesc MCB Intermediate MCB Differentiated product MCB Differentiation Process (Days to weeks) Tumorgenicity? Safety

11 Characterization Safety, Purity/Identity, Stability Multi-parametric analytical testing Morphologic evaluation Detection of phenotype-specific surface markers Unique biochemical markers Gene and protein expression analyses Epigenetic profiling Cellular impurities profile assessment Biologic activity assessment MHC/HLA expression Tumorgenicity assays

12 Safety Animal testing: Safety Assessment Cell survival post-transplantation Cell migration Cell fate - plasticity; differentiation/ phenotype expression; fusion Tissue integration Tumorigenicity - hyperplastic or unregulated growth What is a relevant animal model? What is the sensitivity of animal model for tumorgenicity? Can hesc spiking experiments address uncommitted cell contaminants?

13 Stability (hesc MCB) hesc P79 TaqI SSEA-4 +/- P29- P29+ P79- P79+ Hep Normal Karyotype TTTTAGGAGGGTTTTGGAAGTTTAGTTAGGTTCGAGGATTAATTTAGTTCGGTTTCGGTTT TTTTGGTTTATTATTTTTATTATTTGGAGGGGGCGAGAAGGCGAAATTCGAAGTTAGGTG TTTCGTTATGGGGAAGGAAGGCGTTTTAAGTCGGGGGTTTGGTGAAATGAGGGTTTGCGA AGGGATTATTTAATTTTTTTTTTTTTTTTTAGTTTTATTTATTAGTTTTGATTTTTGGTTTC p29 SSEA-4 (-) 40% p79 SSEA-4 (-) 45% Liver cells p29 SSEA-4 (-) 58% p79 SSEA-4 (-) 58% p29 SSEA-4 (+) 0% p79 SSEA-4 (+) 0% p29 SSEA-4 (+) 6% p79 SSEA-4 (+) 8% OCT4 promoter methylation correlates with loss of SSEA-4 NANOG promoter methylation correlates with loss of SSEA-4

14 Summary hesc are not a new class of biologics but do present unique characterization and development challenges Existing regulatory paradigms are applicable for now New approaches to demonstrating identity, stability and purity may be necessary Developing suitable Safety tests may prove the most challenging

15 Acknowledgements Manufacturing David Hsu Matthew Luo Lara Ausubel Sylvana Couture Patricia Lopez Christine Knoblauch Cassidy Yang Ross McMahon Jonathan Anderson Ivy Derecho Valerie Quezada Nina Dunphy QA Yasmine Shad David Ceniceros Luis Gutierrez Misty Shakeley Jose Valdez Mosleh Alkhatabeh Mario Marcelo QC Patricia Huang Kunal Jariwala Rafat Khan COH Art Riggs Zunde Wang

16 H9 ES Embryoid Body

17 Derivation and Manufacturing Media for culturing hescs routinely supplemented with bovine serum, growth factors as well as other animal-derived ancillary products Bovine serum is acceptable provided demonstration that source is from herds BSE-free countries. Clinical-grade serum sourced from humans Develop serum-free, chemically defined medium. hesc lines established on non-human feeder cell layers: Fit the FDA definition of xenotransplantation FDA does not intend xenotransplantation requirements to preclude use of hescs in human clinical trials For stem cell products derived from hesc lines raised on non-human feeders it may be necessary to demonstrate that the line is free from infectious agents a that may pose a risk for transmission to recipients Adventitious agent testing is equally important when feeders are comprised of human cells

18 Source control Evaluating human stem cell sources: Informed consent Appropriate screening/testing of donor tissue for communicable disease [Donor Eligibility Rule] Implications of genetic analysis Intrinsic safety concerns based on cell source (adult, fetal, embryonic)

19 Purity (hesc MCB) Immunohistochemistry OCT-3/4 nuclear transcription factor NANOG nuclear transcription factor Alkaline Phosphatase FACS Analysis SSEA-4 Tra-1-60

20 Characterization Demonstrate through analytical and clinical testing: Sterility Purity * Potency Identity Stability * Safety * Efficacy

IND - Cell Therapy. Robert W. Lindblad, MD, FACEP. Where Did you Hear

IND - Cell Therapy. Robert W. Lindblad, MD, FACEP. Where Did you Hear IND - Cell Therapy Robert W. Lindblad, MD, FACEP Where Did you Hear The EMMES Corporation CRO Coordinating Center Cell Therapy PACT Production Assistance for Cellular Therapy Bone Marrow Transplant Network

More information

CMC Considerations for Stem Cell-based. Donald W. Fink, Jr., Ph.D.

CMC Considerations for Stem Cell-based. Donald W. Fink, Jr., Ph.D. Food and Drug Administration Center for Biologics Evaluation and Research CMC Considerations for Stem Cell-based Products Donald W. Fink, Jr., Ph.D. Phone: (301) 827-5153 E-Mail: donald.fink@fda.hhs.gov

More information

Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan

Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan Stem Cells & Neurological Disorders Said Ismail Faculty of Medicine University of Jordan Outline: - Introduction - Types & Potency of Stem Cells - Embryonic Stem Cells - Adult Stem Cells - ipscs -Tissue

More information

Induced Pluripotent Stem Cell

Induced Pluripotent Stem Cell Induced Pluripotent Stem Cell When eventually mastered, the processes involved in the obtaining, cultivating and differencing ESC into cells of clinical interest, another practical limitation should be

More information

hpsc Growth Medium DXF Dr. Lorna Whyte

hpsc Growth Medium DXF Dr. Lorna Whyte hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Current Considerations on Chemistry, Manufacturing and Control of Cell Therapy Products (CTPs)

Current Considerations on Chemistry, Manufacturing and Control of Cell Therapy Products (CTPs) Current Considerations on Chemistry, Manufacturing and Control of Cell Therapy Products (CTPs) Wei Wei Ph.D Center for Drug Evaluation, National Medical Products Administration (CDE,NMPA) 2018/12/04 Tokyo

More information

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent

More information

Stem Cel s Key Words:

Stem Cel s Key Words: Stem Cells Key Words: Embryonic stem cells, Adult stem cells, ips cells, self-renewal, differentiation, pluripotent, multipotent, Inner cell mass, Nuclear transfer (Therapeutic cloning), Feeder cells,

More information

Future of Stem Cell Engineering. Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST

Future of Stem Cell Engineering. Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST Future of Stem Cell Engineering i Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST Keywords of Stem Cell Engineering g Embryo and Fetus (Foetus) Adult stem cells and embryonic stem cells

More information

NPTEL Biotechnology Tissue Engineering. Stem cells

NPTEL Biotechnology Tissue Engineering. Stem cells Stem cells S. Swaminathan Director Centre for Nanotechnology & Advanced Biomaterials School of Chemical & Biotechnology SASTRA University Thanjavur 613 401 Tamil Nadu Joint Initiative of IITs and IISc

More information

Assuring Pluripotency of ESC and ipsc Lines

Assuring Pluripotency of ESC and ipsc Lines Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells

More information

Will Stem Cells Finally Deliver Without Controversy?

Will Stem Cells Finally Deliver Without Controversy? Will Stem Cells Finally Deliver Without Controversy? Keith Gary, Ph.D. Director of Program Development Kansas City Area Life Sciences Institute Olathe North Life Sciences 1 February 2012 What s the Buzz?

More information

Molecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics

Molecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics Molecular Medicine Molecular Medicine Stem cell therapy Gene therapy Tumor therapy Immunotherapy Other therapies Vaccines Genetic diagnostics Medical genomics Medication Diagnostics medicine: old desire

More information

Lecture 17. Transgenics. Definition Overview Goals Production p , ,

Lecture 17. Transgenics. Definition Overview Goals Production p , , Lecture 17 Reading Lecture 17: p. 251-256, 260-261 & 264-266 Lecture 18: p. 258-264, 508-524 Transgenics Definition Overview Goals Production p.251-256, 260-261, 264-266 315 Definition A transgenic animal

More information

Stem Cells, Regenerative Medicine and cgmp (GTP)

Stem Cells, Regenerative Medicine and cgmp (GTP) Stem Cells, Regenerative Medicine and cgmp (GTP) Encompass Stem cell based therapies activities Collection source Purification Isolation from other cell types if needed Manipulation Minimal vs Moderate

More information

Beth Hutchins, PhD PhRMA ICH Gene Therapy Discussion Group

Beth Hutchins, PhD PhRMA ICH Gene Therapy Discussion Group ICH Considerations on General Principles to Address the Risk of Inadvertent Germline Integration of Gene Therapy Vectors and Current Topics on Gene Therapy in USA Beth Hutchins, PhD PhRMA ICH Gene Therapy

More information

PRIME-XV Cell Therapy Products by

PRIME-XV Cell Therapy Products by PRIME-XV Cell Therapy Products by Product List 2017 TRINOVA BIOCHEM now distributes the PRIME-XV Cell Therapy line by Irvine Scientific in Germany, Austria and Switzerland. Irvine Scientific is a worldwide

More information

Case Study: Examples Relating to the Quality Control of Cell-based Products

Case Study: Examples Relating to the Quality Control of Cell-based Products Case Study: Examples Relating to the Quality Control of Cell-based Products CMC Strategy Forum Japan 2014 Yuuki Miyatake1), 2) 1) TEIJIN PHARMA LIMITED 2) Japan Pharmaceutical Manufacturers Association

More information

Outcomes in Mesenchymal Stem Cell Manufacturing. Athena Russell, MT(AAB) Human Cellular Therapy Laboratory Mayo Clinic Jacksonville, FL

Outcomes in Mesenchymal Stem Cell Manufacturing. Athena Russell, MT(AAB) Human Cellular Therapy Laboratory Mayo Clinic Jacksonville, FL Outcomes in Mesenchymal Stem Cell Manufacturing Athena Russell, MT(AAB) Human Cellular Therapy Laboratory Mayo Clinic Jacksonville, FL Background HCTL established in 1992 to support BMT programs of Mayo

More information

FDA Update. Scott A. Brubaker, CTBS Director, Division of Human Tissues Office of Tissues and Advanced Therapies CBER/FDA

FDA Update. Scott A. Brubaker, CTBS Director, Division of Human Tissues Office of Tissues and Advanced Therapies CBER/FDA FDA Update Scott A. Brubaker, CTBS Director, Division of Human Tissues Office of Tissues and Advanced Therapies CBER/FDA 13 th Annual FDA and the Changing Paradigm for HCT/P Regulation February 13, 2017

More information

Specifications. February 19, 2015, TOKYO, JAPAN. Takao Hayakawa, Ph.D. Director, Pharmaceutical Research and Technology Institute, Kindai University

Specifications. February 19, 2015, TOKYO, JAPAN. Takao Hayakawa, Ph.D. Director, Pharmaceutical Research and Technology Institute, Kindai University Specifications February 19, 2015, TOKYO, JAPAN Takao Hayakawa, Ph.D. Director, Pharmaceutical Research and Technology Institute, Kindai University Norihisa Sakamoto, M.D., Ph.D. Deputy Review Director

More information

PRIME-XV Cell Therapy Products by

PRIME-XV Cell Therapy Products by PRIME-XV Cell Therapy Products by Product List 2017 TRINOVA BIOCHEM now distributes the PRIME-XV Cell Therapy line by Irvine Scientific in Germany, Austria and Switzerland. Irvine Scientific is a worldwide

More information

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION Stem Cell Research Solutions Promotional offers Stem Cell research products For more than a decade, we have provided you with key tools to address challenges

More information

for SCI: Challenges for Entry and Execution of Phase 1 Clinical Trials Challenges and Opportunities of Cellular Therapeutic Development

for SCI: Challenges for Entry and Execution of Phase 1 Clinical Trials Challenges and Opportunities of Cellular Therapeutic Development Case Study: Human Embryonic Stem Cell Based Therapy for SCI: Challenges for Entry and Execution of Phase 1 Clinical Trials Jane S Lebkowski Ph.D NHLBI-PACT Workshop Sept 15, 2011 Challenges and Opportunities

More information

Cellular and Gene Therapy Products - CBER Update

Cellular and Gene Therapy Products - CBER Update DEPARTMENT OF HEALTH AND HUMAN SERVICES CENTER FOR BIOLOGICS EVALUATION and RESEARCH Cellular and Gene Therapy Products - CBER Update Well Characterized Biological Products January 12-14, 2009 Kimberly

More information

Stem Cells: Introduction and Prospects in Regenerative Medicine.

Stem Cells: Introduction and Prospects in Regenerative Medicine. Stem Cells: Introduction and Prospects in Regenerative Medicine www.gothamgazette.com/.../stemcell/stem_cell.jpg Ode to a Stem Cell, Part II by VCW There once was stem cell stuck in the hood Dividing endlessly,

More information

Ancillary Materials for Cell & Tissue Therapies Definitions, US Regulatory Approach, and USP s Risk-Tiered Approach

Ancillary Materials for Cell & Tissue Therapies Definitions, US Regulatory Approach, and USP s Risk-Tiered Approach USP/ISCT Workshop 2012 Seattle, WA, USA Ancillary Materials for Cell & Tissue Therapies Definitions, US Regulatory Approach, and USP s Risk-Tiered Approach Elizabeth Read, MD Head of Product Development

More information

A simple choice. Essential 8 Media

A simple choice. Essential 8 Media A simple choice Essential 8 Media Your stem cells thrive with the essentials Gibco Essential 8 Medium is a feeder-free, xeno-free medium originally developed in the laboratory of stem cell research pioneer

More information

Stem Cell Research 101

Stem Cell Research 101 Stem Cell Research : A promising type of bioscience research The Stem Cell debate and the impact of the induced pluripotent stem cell procedure Why Is Vocabulary Important? Key terms frame the debate Mature

More information

Developing Targeted Stem Cell Therapeutics for Cancer. Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013

Developing Targeted Stem Cell Therapeutics for Cancer. Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013 Developing Targeted Stem Cell Therapeutics for Cancer Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013 The Challenge of Drug Delivery for Brain Cancer Stem Cells

More information

GENERATION OF OFF-THE-SHELF TCR-LESS CAR T CELLS FROM RENEWABLE PLURIPOTENT CELLS

GENERATION OF OFF-THE-SHELF TCR-LESS CAR T CELLS FROM RENEWABLE PLURIPOTENT CELLS GENERATION OF OFF-THE-SHELF TCR-LESS CAR T CELLS FROM RENEWABLE PLURIPOTENT CELLS Bob Valamehr, PhD Vice President, Fate Therapeutics AACR Annual Meeting 2018 Press Program McCormick Place North/South

More information

Genetic Technologies

Genetic Technologies Genetic Technologies Distinguish the terms biotechnology, recombinant DNA technology, transgenic organisms, genetic engineering Understand the two basic techniques to obtain selective fragments of DNA

More information

Des cellules-souches dans le poumon : pourquoi faire?

Des cellules-souches dans le poumon : pourquoi faire? Des cellules-souches dans le poumon : pourquoi faire? Karl-Heinz Krause Dept. of Pathology and Immunology, Medical Faculty Dept. of Genetic and Laboratory Medicine, University Hospitals Geneva, Switzerland

More information

STEM CELL ETHICS: THE NEGLECTED ISSUES. Dr. Christie Holland Rev. Dr. Karen Lebacqz

STEM CELL ETHICS: THE NEGLECTED ISSUES. Dr. Christie Holland Rev. Dr. Karen Lebacqz STEM CELL ETHICS: THE NEGLECTED ISSUES Dr. Christie Holland Rev. Dr. Karen Lebacqz Stem Cell Science -- some basic terms totipotent = able to make an entire organism. pluripotent = able to make all types

More information

Regulatory considerations for manufacturing and testing of investigational chimeric antigen receptor (CAR) T-cell products

Regulatory considerations for manufacturing and testing of investigational chimeric antigen receptor (CAR) T-cell products Regulatory considerations for manufacturing and testing of investigational chimeric antigen receptor (CAR) T-cell products Xiaobin Victor Lu Product Reviewer Gene Therapies Branch DCGT/OCTGT/CBER/FDA MEASUREMENT

More information

Sabrina Jedlicka. Interactions of Neurons and Materials

Sabrina Jedlicka. Interactions of Neurons and Materials Sabrina Jedlicka Interactions of Neurons and Materials Developmental Cell Biology Some Perspective Stem cells: Undifferentiated cells that are capable of proliferation, self-maintenance and differentiation

More information

Raw Materials: Sourcing and Qualification Testing

Raw Materials: Sourcing and Qualification Testing Raw Materials: Sourcing and Qualification Testing Scott R. Burger, MD Advanced Cell & Gene Therapy Technical Applications Track 2 ISCT 2009 Sourcing Raw Materials Raw materials for cell/gene therapy manufacturing

More information

Manufacturing Challenges with Cell and Gene Therapy Products: A Health Canada Perspective

Manufacturing Challenges with Cell and Gene Therapy Products: A Health Canada Perspective Manufacturing Challenges with Cell and Gene Therapy Products: A Health Canada Perspective CASSS CMC Summer Forum 2017 Chris Storbeck, PhD Health Canada Outline Health Canada organization Regulation of

More information

A Life Cycle Approach to Raw Material Qualification for Cell and Gene Therapy Products

A Life Cycle Approach to Raw Material Qualification for Cell and Gene Therapy Products A Life Cycle Approach to Raw Material Qualification for Cell and Gene Therapy Products Angela Whatley, Ph.D. Office of Tissues and Advanced Therapies CBER/FDA CMC Strategy Forum on Cell & Gene Therapies

More information

Stem Cell Principle -

Stem Cell Principle - Effective Date: 31.10.2017 Doc ID: 20290214 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Stem Cell Principle - Rationale Research on human stem cells and their

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

BME 177. Engineering stem cells. Gayatri Pal Lecturer Biomolecular Engineering

BME 177. Engineering stem cells. Gayatri Pal Lecturer Biomolecular Engineering BME 177 Engineering stem cells Gayatri Pal Lecturer Biomolecular Engineering Introduction Graduated from MCD Biology (Yeast Cell Cycle) -CIRM classes (Introduction to stem cell biology) Post-doc training

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

FDA Inspections: FDA Inspections: An Overview Overview

FDA Inspections: FDA Inspections: An Overview Overview FDA Inspections: An Overview Robert Lindblad, MD The EMMES Corporation August 11, 2011 researchcartoons.com Why Inspections? Why Inspections? To evaluate compliance with regulations To establish that an

More information

Dec 04, 2013

Dec 04, 2013 Stem Cells Junfeng Ji ( 纪俊峰 ), PhD Professor Research Center of Stem Cell and Developmental Biology School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cn Dec 04, 2013 Totipotent Pluripotent

More information

First xeno-free serum replacement for pluripotent stem cells

First xeno-free serum replacement for pluripotent stem cells Stem Cell Research First xeno-free serum replacement for pluripotent stem cells KnockOut SR XenoFree Stem Cell Research New, xeno-free growth and expansion of hescs and human ipscs KnockOut SR XenoFree

More information

Directed differentiation of human embryonic stem cells

Directed differentiation of human embryonic stem cells Directed differentiation of human embryonic stem cells TECAN Symposium 2008 Biologics - From Benchtop to Production Wednesday 17 September 2008 Andrew Elefanty Embryonic Stem Cell Differentiation Laboratory,

More information

Therapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota

Therapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Neuronal Death Neurons are lost due to four main causes: Trauma Toxin Hypoxia (typically loss of air or blood

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Realizing the Future that Regenerative Medicine Will Open

Realizing the Future that Regenerative Medicine Will Open 470 Hitachi Review Vol. 65 (2016), No. 9 Featured Articles Realizing the Future that Regenerative Medicine Will Open Shizu Takeda, Ph.D. OVERVIEW: Regenerative medicine is an innovative approach to medicine

More information

BIOTECHNOLOGY. Unit 8

BIOTECHNOLOGY. Unit 8 BIOTECHNOLOGY Unit 8 PART 1 BASIC/FUNDAMENTAL SCIENCE VS. APPLIED SCIENCE! Basic/Fundamental Science the development and establishment of information to aid our understanding of the world.! Applied Science

More information

Regulation of Biologics in The United States: From a Rich Tradition To A Challenging Future

Regulation of Biologics in The United States: From a Rich Tradition To A Challenging Future Regulation of Biologics in The United States: From a Rich Tradition To A Challenging Future Chris Joneckis,, Ph.D. Senior Advisor For CMC Issues Center For Biologics Evaluation And Research Food and Drug

More information

Matrices sourcebook. Your guide to Gibco extracellular matrices products

Matrices sourcebook. Your guide to Gibco extracellular matrices products Matrices sourcebook Your guide to Gibco extracellular matrices products Introduction Gibco products, including extracellular matrices, 3D scaffolds, and attachment proteins, are essential tools for providing

More information

Ips Cells Can Be Efficiently Differentiated Back To Mscs Using A Short Exposure To Tgfβ

Ips Cells Can Be Efficiently Differentiated Back To Mscs Using A Short Exposure To Tgfβ Ips Cells Can Be Efficiently Differentiated Back To Mscs Using A Short Exposure To Tgfβ Dmitriy Sheyn, PhD 1, Shiran Ben-David, BSc 1, Sandra Ann De Mel, BSc 1, Loren Ornelas, BSc 1, Anais Sahabian, MSc

More information

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency

More information

Versatility and performance of Lipofectamine Stem Transfection Reagent

Versatility and performance of Lipofectamine Stem Transfection Reagent PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types

More information

Células madre con pluripotencia inducida: posibles aplicaciones clínicas

Células madre con pluripotencia inducida: posibles aplicaciones clínicas Células madre con pluripotencia inducida: posibles aplicaciones clínicas Angel Raya ICREA Research Professor Control of Stem Cell Potency Group Institute for Bioengineering of Catalonia Barcelona, Spain

More information

Yoji SATO, Ph.D. Head, Division of Cellular & Gene Therapy Products National Institute of Health Sciences, Tokyo, Japan

Yoji SATO, Ph.D. Head, Division of Cellular & Gene Therapy Products National Institute of Health Sciences, Tokyo, Japan NIHS Since 1874 Yoji SATO, Ph.D. Head, Division of Cellular & Gene Therapy Products National Institute of Health Sciences, Tokyo, Japan October 21, 2013 DISCLAIMER: The views and opinions expressed in

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

Cell Characterization: Developing Assays to Address the Biological Parameters of Identity and Potency

Cell Characterization: Developing Assays to Address the Biological Parameters of Identity and Potency Cell Characterization: Developing Assays to Address the Biological Parameters of Identity and Potency Jessica Carmen Ph.D and Jon Rowley Ph.D., LBS-TCS, May 2011 Disclaimer Certain matters discussed in

More information

The Elite Provider. Cell & Gene. Therapy Manufacturing

The Elite Provider. Cell & Gene. Therapy Manufacturing The Elite Provider Cell & Gene Therapy Manufacturing GMP Manufacturing Services The cgmp manufacturing in Vigene is compliant with US FDA and EU EMA regulatory requirements. The manufacturing area consists

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

MOUSE EMBRYONIC STEM CELL PRODUCTS FBS- ES QUALIFIED MESENCHYMAL STEM CELL QUALIFIED MEDIA STEM CELL PRODUCTS

MOUSE EMBRYONIC STEM CELL PRODUCTS FBS- ES QUALIFIED MESENCHYMAL STEM CELL QUALIFIED MEDIA STEM CELL PRODUCTS www.lifetechindia.com NUTRISTEM HUMAN EMBROYNIC STEM CELL MEDIA MOUSE EMBRYONIC STEM CELL PRODUCTS FBS- ES QUALIFIED MESENCHYMAL STEM CELL QUALIFIED MEDIA STEM CELL PRODUCTS To order contact: 36, Aggarwal

More information

Quality of raw materials and manufacturing of advanced therapies. Fouad Atouf, Ph.D. Head, Global Biologics July 12, 2018

Quality of raw materials and manufacturing of advanced therapies. Fouad Atouf, Ph.D. Head, Global Biologics July 12, 2018 Quality of raw materials and manufacturing of advanced therapies Fouad Atouf, Ph.D. Head, Global Biologics July 12, 2018 Evolution of the compendia 1820: a single recipe book 2018: Procedures and acceptance

More information

CQAs for C&GT Products to Enable Comparability Assessment. Ben Thompson Snr Director, Biopharmaceutical CMC RA GlaxoSmithKline

CQAs for C&GT Products to Enable Comparability Assessment. Ben Thompson Snr Director, Biopharmaceutical CMC RA GlaxoSmithKline CQAs for C&GT Products to Enable Comparability Assessment Ben Thompson Snr Director, Biopharmaceutical CMC RA GlaxoSmithKline Overview Demonstrate the value of defining CQAs early in product development

More information

ANAT 2341 Embryology Lecture 18 Stem Cells

ANAT 2341 Embryology Lecture 18 Stem Cells ANAT 2341 Embryology Lecture 18 Stem Cells 29 September 2010 Dr Antonio Lee Neuromuscular & Regenera

More information

Regulatory Approval of Modern Gene-Based Cancer Immunotherapies CAR T Cells A product perspective

Regulatory Approval of Modern Gene-Based Cancer Immunotherapies CAR T Cells A product perspective Regulatory Approval of Modern Gene-Based Cancer Immunotherapies CAR T Cells A product perspective ASQ509 Biomed/Biotech SIG 2/1/18 Xiaobin Victor Lu Division of Cellular and Gene Therapies Office of Tissues

More information

Longevity Leaders Conference. February 4, 2019

Longevity Leaders Conference. February 4, 2019 Longevity Leaders Conference February 4, 2019 Forward Looking Statements The matters discussed in this presentation include forward looking statements which are subject to various risks, uncertainties,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Cloning. 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms:

Cloning. 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms: Cloning 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms: cell division, morphogenesis, differentiation 2. Plant cloning 3. Animal cloning

More information

PluriQ TM Serum Replacement (PluriQ TM SR)

PluriQ TM Serum Replacement (PluriQ TM SR) PluriQ TM Serum Replacement (PluriQ TM SR) (PluriQ SR) is a defined, serum-free supplement formulated as a direct replacement for FBS (fetal bovine serum) used in the growth and maintenance of undifferentiated

More information

Andrew Finnerty General Manager - CCMI

Andrew Finnerty General Manager - CCMI Andrew Finnerty General Manager - CCMI Manufacturing Human Mesenchymal Stem Cells for Clinical Trials Quality Considerations Biopharma and Pharma RQA Regional Forum Bioclin Laboratories, Athlone 13 May

More information

Therapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota

Therapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Coffee Hour Wednesday (Dec 13) Thursday (Dec 14) Friday (Dec 15) 9:00-10:00am Surdyk s Café in

More information

Process and guidelines for applications for approval of trials involving gene and other biotechnology therapies. November 2015

Process and guidelines for applications for approval of trials involving gene and other biotechnology therapies. November 2015 Process and guidelines for applications for approval of trials involving gene and other biotechnology therapies November 2015 HRC Gene Technology Advisory Committee For further information contact: Professor

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

FDA Regulation of Stem-Cell Based Therapies Dina Gould Halme, Ph.D., and David A. Kessler, M.D.

FDA Regulation of Stem-Cell Based Therapies Dina Gould Halme, Ph.D., and David A. Kessler, M.D. The new england journal of medicine health policy report FDA Regulation of Stem-Cell Based Therapies Dina Gould Halme, Ph.D., and David A. Kessler, M.D. In the interest of public safety, the Food and Drug

More information

Cell therapies to treat haematopoietic disorders

Cell therapies to treat haematopoietic disorders Cell therapies to treat haematopoietic disorders Haematopoietic Stem Cells (CD34) RBCs Platelets Limitations A donor required for each treatment Transfusion-transmitted infection Immunological (HLA/AB0)

More information

Regulatory science insights into cellular products and practical microscale technologies for their assessment

Regulatory science insights into cellular products and practical microscale technologies for their assessment Regulatory science insights into cellular products and practical microscale technologies for their assessment Kyung Sung Johnny Lam November 9, 2018 Cellular and Tissue Therapies Branch Division of Cellular

More information

BGEN Laboratory Methods in Human and Medical Genetics

BGEN Laboratory Methods in Human and Medical Genetics BMG COURSES BGEN 7000 - Research Seminar MSc Consists of presentations of the student's current research. For Master s students only. 1.0 credit hours. BGEN 7020 Proteins (Formerly 137.702) Three hours

More information

ADVANCED MEDIA TECHNOLOGY

ADVANCED MEDIA TECHNOLOGY ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,

More information

The NYSCF Research Institute

The NYSCF Research Institute Regenerative Medicine Research Update Susan L. Solomon The NYSCF Research Institute New York Pharma Forum February 25, 2016 Regenerative Medicine Research Regenerative medicine uses laboratory grown human

More information

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division stem cell stem cell skin muscle nerve Properties of STEM cells Plasticity

More information

Regulatory Implications for Global Manufacturing Development of Regenerative Medicines

Regulatory Implications for Global Manufacturing Development of Regenerative Medicines Regulatory Implications for Global Manufacturing Development of Regenerative Medicines Katherine Tsokas, JD June 2017 Global Regulatory Affairs Janssen Research & Development, LLC Jessica Riley, Shells

More information

Xcelthera, Inc. San Diego Regenerative Medicine Institute

Xcelthera, Inc. San Diego Regenerative Medicine Institute Direct Conversion of Pluripotent Human Embryonic Stem Cells into Functional Human Neuronal or Cardiomyocyte Cell Therapy Derivatives for Regenerative Medicine Xuejun H Parsons, PhD Xcelthera, Inc. San

More information

Stem cells and motor neurone disease

Stem cells and motor neurone disease Stem cells and motor neurone disease F Stem cell research has fuelled hope of a treatment for a variety of conditions. This information sheet explains what these cells are and includes details of the current

More information

Reporting Deviations of Biological Products and HCT/Ps. Ellen Areman Senior Consultant Biologics Consulting Group, Inc.

Reporting Deviations of Biological Products and HCT/Ps. Ellen Areman Senior Consultant Biologics Consulting Group, Inc. Reporting Deviations of Biological Products and HCT/Ps Ellen Areman Senior Consultant Biologics Consulting Group, Inc. Relevant Legislation Public Health Service (PHS) Act Regulates biological products

More information

Disease Clinical features Genotype

Disease Clinical features Genotype Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient

More information

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5 HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives

More information

Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation

Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Learning Goals I can explain the concept of cell differentiation and cell specialization. I can explain how the cell structure relates

More information

Edexcel (B) Biology A-level

Edexcel (B) Biology A-level Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify

More information

Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH

Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH MONITOR CELL FATE TRANSITIONS Improve Differentiation and Reprogramming Outcomes Adult Fibroblast Cells Reprogramming (ips Cells)

More information

Comparability Is Not a Nightmare, Just Think Ahead!

Comparability Is Not a Nightmare, Just Think Ahead! Comparability Is Not a Nightmare, Just Think Ahead! Margarida Menezes Ferreira Senior Assessor at INFARMED PT expert at BWP/CHMP - EMA member of the CAT - EMA (margarida.menezes@infarmed.pt) I attend this

More information

ANNOUNCEMENTS. HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134)

ANNOUNCEMENTS. HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134) ANNOUNCEMENTS HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134) Lecture 5: Kinetics of Cell Growth in Culture Phenomenological mathematical

More information

Matrices Sourcebook Life Technologies extracellular matrices products

Matrices Sourcebook Life Technologies extracellular matrices products Matrices Sourcebook Life Technologies extracellular matrices products Introduction Our Gibco products, including extracellular matrices, 3D scaffolds, and attachment proteins, are essential tools for providing

More information

Stem Cells: Ethics and Oversight May 24, Sidney H. Golub, Ph.D. Interim Director Sue & Bill Gross Stem Cell Research Center

Stem Cells: Ethics and Oversight May 24, Sidney H. Golub, Ph.D. Interim Director Sue & Bill Gross Stem Cell Research Center Stem Cells: Ethics and Oversight May 24, 2017 Sidney H. Golub, Ph.D. Interim Director Sue & Bill Gross Stem Cell Research Center Nobel Laureates 2012 John Gurdon Shinya Yamanaka Pluripotent Stem Cell PLURIPOTENT

More information

Cell-based therapies in tissue engineering and regenerative medicine (TE/RM)

Cell-based therapies in tissue engineering and regenerative medicine (TE/RM) Cell-based therapies in tissue engineering and regenerative medicine (TE/RM) Pamela Gehron Robey, Ph.D. Craniofacial and Skeletal Diseases Branch National Institutes of Dental and Craniofacial Research

More information

Product Information and Testing - Amended. Product Information

Product Information and Testing - Amended. Product Information Product Information and Testing - Amended Product Information Product Name Lot Number Parent Material Depositor Banked by Thaw Recommendation Culture Platform Protocol Passage Number Date Vialed Vial Label

More information

Lisa Griffin (BSc Hons Biology), David Hughes August 2013

Lisa Griffin (BSc Hons Biology), David Hughes August 2013 Title Authors Contact Target level Publication date Lisa Griffin (BSc Hons Biology), David Hughes Maggy.fostier@manchester.ac.uk KS4 science, GCSE August 2013 Activity Length Content related to the GCSE

More information

University of California Department of Bioengineering & Molecular & Cell Biology

University of California Department of Bioengineering & Molecular & Cell Biology University of California Department of Bioengineering & Molecular & Cell Biology Course Number: BioE C218 & MCB C237 Course Title: Stem Cells and Directed Organogenesis Offered: Spring Instructor: Irina

More information