Supporting Information for

Transcription

1 Supporting Information for Spiro-Ring Formation is Catalyzed by A Multifunctional Dioxygenase in Austinol Biosynthesis Yudai Matsuda, Takayoshi Awakawa, Toshiyuki Wakimoto, and Ikuro Abe*, Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3- ongo, Bunkyo-ku, Tokyo -0033, Japan. Material and Methods References Primers used in this study Supplementary figures and tables Table of Contents S2-S6 S6 S7 S8-S9 S

2 Materials and Methods General PCR was performed using a TaKaRa PCR Thermal Cycler Dice Gradient (TaKaRa) with iproof DNA polymerase (BI-RAD). Sequence analysis was performed on a PRISM-300 automated DNA sequencer (ABI). Analytical and preparative PLC were performed on a Shimadzu Prominence system, using a TSK-gel DS-80T S column (Tosoh Co. Ltd.) 4.6 i.d. x 50 mm, and an DS-80T M column (Tosoh Co. Ltd.) 7.8 i.d. x 300 mm, respectively. Column chromatography was performed using Wakogel C-200. NMR spectra were obtained at 500 Mz ( ) and 25 Mz ( C) with a JEL ECX-500 spectrometer, and the data were recorded as chemical shifts. The LC-RMS analysis was performed with an Agilent 00 series PLC-microTF mass spectrometer (Bruker Daltonics), using Electrospray Ionization with a Cadenza CD-C8 column (2.0 i.d. x 50 mm; Imtakt Co. Ltd.). The LC-MS/MS analysis was performed with an Agilent 00 series PLC-Esquire 4000 mass spectrometer (Bruker Daltonics), using Electrospray Ionization with a Cadenza CD-C8 column (2.0 i.d. x 50 mm; Imtakt Co. Ltd.). Strains and media Aspergillus nidulans FGSC A4 was cultivated at 30 in DPY medium (2% dextrin, % polypeptone, 0.5% yeast extract (Difco), 0.5% K 2 P 4, and 0.05% MgS ) for 3 days and used as a source for cloning each gene in the aus cluster. Aspergillus oryzae NSAR (niad -, sc -, ΔargB, adea - ) was used as the host for fungal expression. A. oryzae transformants were grown in DPY medium with shaking at 60 rpm for six days at 30 C. The cells were then transferred into Czapek-Dox (CD) medium with polypeptone (0 g/l), starch (20 g/l), and the substrate (30 mg/l), to induce expression under the α-amylase promoter, and were incubated as above for three more days. Standard DNA engineering experiments were performed using Escherichia coli D5α from Clontech (Mountain View, CA). E. coli transformants bearing each plasmid were grown in Luria-Bertani medium and selected with appropriate antibiotics. E. coli Rosetta TM (DE3) plyss (Novagen) was used for the expression of AusE. Materials Solvents and chemicals were purchased from Wako Chemicals Ltd. (Tokyo), unless noted otherwise. ligonucleotide primers were purchased from peron Biotechnologies (Tokyo). The genomic DNA was extracted from the A. nidulans FGSC A4 strain by the standard S2

3 method. Protoaustinoid A (2) was prepared as described previously. 2 Construction of the ausb, ausc, and ause co-expression system To co-express ausb, ausc, and ause, the genes were introduced into the fungal expression vectors ptaex3, 3 pusa, 4 and padea, respectively. The full-length ausb gene was amplified with the primers EcoRI-ausB-F and EcoRI-ausB-R, using the following step program: 98, 30 s; (98, 0 s; 63, 5 s; 72, min) x 30 cycles; 72, 5 min. The PCR product was purified and digested with EcoRI. The resultant fragment was subcloned into ptaex3, which had been digested with EcoRI and dephosphorylated, to produce pta-ausb. The full-length ausc gene was amplified with the primers KpnI-ausC-F and KpnI-ausC-R, using the following step program: 98, 30 s; (98, 0 s; 63, 5 s; 72, min) x 30 cycles; 72, 5 min. The PCR product was purified and digested with KpnI. The resultant fragment was subcloned into pusa, which had been digested with KpnI and dephosphorylated, to yield pusa-ausc. Since padea lacks a promoter and a terminator, ause was first introduced into ptaex3, harboring the α-amylase promoter and terminator, and then the fragment containing the promoter-gene-terminator was amplified by PCR and inserted into the padea vector. The full-length ause gene was amplified with the primers EcoRI-ausE-F and EcoRI-ausE-R, using the following step program: 98, 30 s; (98, 0 s; 63, 5 s; 72, 30 s) x 30 cycles; 72, 5 min. The PCR product was purified and digested with EcoRI. The resultant fragment was subcloned into ptaex3, which had been digested with EcoRI and dephosphorylated, to yield pta-ause. Subsequently, the fragment containing the promoter-ause-terminator was amplified with the primers pta-spei-f and pta-spei-r, using the following step program: 98, 30 s; (98, 0 s; 66, 0 s; 72, 30 s) x 30 cycles; 72, 5 min. The PCR product was purified and digested with SpeI. The resultant fragment was subcloned into the padea vector, which had been digested with SpeI and dephosphorylated, to yield padea-ause. These expression plasmids were used to transform A. oryzae NSAR, by the protoplast polyethylene glycol method, 5 to co-express ausb, ausc, and ause. To construct the transformants that do not express one or more of the three genes, the corresponding empty vectors were used for the transformation. PLC analysis of each product Products from each of the transformants were analyzed by PLC, with a solvent system of 0.5% acetic acid (solvent A) and acetonitrile containing 0.5% acetic acid (solvent B), at a flow rate of.0 ml/min and a column temperature of 40. Separation was performed with solvent B/solvent A (20:80) for 5 min, a linear gradient from 20:80 to 00:0 during the S3

4 following 20 min, 00:0 for 5 additional min, and a linear gradient from 00:0 to 20:80 for the following 3 min. Purification of berkeleyone A (3) Two liters of medium from the induced culture of the transformant expressing AusB were extracted with ethyl acetate. The extract was subjected to silica-gel column chromatography, and eluted stepwise with a chloroform:methanol gradient (00:0 to 98:2). The fractions that contained 3 were further purified by reverse-phase preparative PLC (60% aqueous acetonitrile, 3.0 ml/min), to yield 6.36 mg of a white powder. RMS detected m/z [M+] + (calc'd for C ). The optical rotation of 3 is [α] 20 D -8.7 (c.47, CCl 3 ). The NMR data agreed well with the reported data. 6 Purification of preaustinoid A (4), 5-hydroxyberkeleyone A (8), preaustinoid C (9), and austinoid C (0) Four liters of medium from the induced culture of the transformant expressing AusB and AusE were extracted with ethyl acetate. The extract was subjected to silica-gel column chromatography, and eluted stepwise using a chloroform:methanol gradient (0:0 to 9:). Fractions that contained 4, 8, 9, and 0 were further purified by reverse-phase preparative PLC (55% aqueous acetonitrile, 3.0 ml/min). 4 (0.8 mg) was obtained as a white powder. RMS detected m/z [M+Na] + (calc'd for C Na). The optical rotation of 4 is [α] 20 D -7.4 (c 0.33, CCl 3 ). The NMR data for 4 agreed well with the reported data. 7 8 (5.58 mg) was obtained as a colorless oil. RMS detected m/z [M+K] + (calc'd for C K). The optical rotation of 8 is [α] 2 D -4.0 (c 0.47, CCl 3 ). 9 (3.38 mg) was obtained as a white powder. RMS detected m/z [M+] + (calc'd for C ). The optical rotation of 9 is [α] 2 D -0.5 (c 0.32, CCl 3 ). 0 (9.9 mg) was obtained as a white powder. RMS detected m/z [M+] + (calc'd for C ). The optical rotation of 0 is [α] 22 D (c 0.76, CCl 3 ). Purification of preaustinoid A2 (6) and preaustinoid A3 (7) Two liters of medium from the induced culture of the transformant expressing AusB, AusE, and AusC were extracted with ethyl acetate. The extract was subjected to silica-gel column chromatography, and eluted stepwise using a chloroform:methanol gradient (00:0 to 95:5). Fractions that contained 6 and 7 were further purified by reverse-phase preparative PLC (50% aqueous acetonitrile, 3.0 ml/min). S4

5 6 (.94 mg) was obtained as a white powder. RMS detected m/z [M+] + (calc'd for C ). The optical rotation of 6 is [α] 22 D -6.5 (c 0.6, CCl 3 ). 7 (9.04 mg) was obtained as a white powder. RMS detected m/z [M+] + (calc'd for C ). The optical rotation of 7 is [α] 23 D (c 0.76, CCl 3 ). The NMR data for 6 and 7 agreed well with the reported data. 8,9 Expression and purification of AusE To express ause in E. coli, the gene was introduced into the pet-28a(+) vector (Novagen). The full-length ause gene was amplified from padea-ause with the primers NdeI-ausE-F and EcoRI-ausE-R, using the following step program: 98, 30 s; (98, 0 s; 63, 0 s; 72, 5 s) x 30 cycles; 72, 5 min. The PCR product was purified and digested with NdeI and EcoRI. The resultant fragment was subcloned into pet-28a(+), which had been digested with NdeI and EcoRI and dephosphorylated, to produce pet-28a(+)-ause. E. coli Rosetta TM (DE3) plyss was transformed with the expression plasmid. The transformant was incubated at 37 with shaking at 80 rpm, in LB medium with 50 mg/l kanamycin sulfate. Gene expression was induced by the addition of 0.05 mm IPTG when the cultures had attained an D 600 of 0.6, and the incubation was continued for 5 h at 28 /80 rpm. The cells were harvested by centrifugation and resuspended in lysis buffer (50 mm Tris, p 7.5, 50 mm NaCl, 5 mm imidazole, 5% glycerol). The cells were lysed on ice by sonication, and the debris was removed by centrifugation. The supernatant was loaded onto a Ni-NTA affinity column, which was washed with 00 column volumes of wash buffer (50 mm Tris, p 7.5, 50 mm NaCl, 0 mm imidazole, 5% glycerol). The is-tagged protein was eluted with 5 column volumes of elution buffer (50 mm Tris, p 7.5, 50 mm NaCl, 300 mm imidazole, 5% glycerol). The purity of the enzymes was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was determined using a UV-700 PharmaSpec Spectrophotometer (Shimadzu). Enzymatic reaction assay of AusE The enzymatic reactions of AusE with berkeleyone A (3) and preaustinoid A2 (6) were performed in reaction mixtures containing 50 mm Tris-Cl buffer (p 7.5), 500 μm of 3 or 6, 0. mm FeS 4, 2.5 mm α-ketoglutarate, 4 mm ascorbate, and 2 μm AusE, in a final volume of 00 μl. After an incubation at 30 C for 2 hours, the reaction was terminated by adding 00 μl of methanol and vortex mixing. After centrifugation, the supernatant was analyzed by PLC with a solvent system of 0.5% acetic acid (solvent A) and acetonitrile containing 0.5% acetic acid (solvent B), at a flow rate of.0 ml/min and a column S5

6 temperature of 40. Separation was performed with solvent B/solvent A (50:50) for 5 min, a linear gradient from 50:50 to 00:0 during the following 0 min, 00:0 for 5 additional min, and a linear gradient from 00:0 to 50:50 during the following 3 min. The enzymatic reaction products were also subjected to an LC-MS/MS analysis, to identify each product by comparison with the authentic samples (50% aqueous acetonitrile with % acetic acid, 0.2 ml/min). References () Jin, F.; Maruyama, J.; Juvvadi, P.; Arioka, M.; Kitamoto, K. Biosci. Biotechnol. Biochem. 2004, 68, 656. (2) Matsuda, Y.; Awakawa, T.; Itoh, T.; Wakimoto, T.; Kushiro, T.; Fujii, I.; Ebizuka, Y.; Abe, I. ChemBioChem 202,, 738. (3) Fujii, T.; Yamaoka,.; Gomi, K.; Kitamoto, K.; Kumagai, C. Biosci. Biotechnol. Biochem. 995, 59, 869. (4) Yamada,.; Na Nan, S.; Akao, T.; Tominaga, M.; Watanabe,.; Satoh, T.; Enei,.; Akita,. J. Biosci. Bioeng. 2003, 95, 82. (5) Gomi, K.; Iimura, Y.; ara, S. Agric. Biol. Chem. 987, 5, (6) Stierle, D.; Stierle, A.; Patacini, B.; McIntyre, K.; Girtsman, T.; Bolstad, E. J. Nat. Prod. 20, 74, (7) Geris dos Santos, R.; Rodrigues-Fo, E. Phytochemistry 2002, 6, 907. (8) Geris dos Santos, R. M.; Rodrigues-Fo, E. Z. Naturforsch. 2003, 58, 663. (9) Fill, T. P.; Pereira, G. K.; Geris dos Santos, R. M.; Rodrigues-Fo, E. Z. Naturforsch. 2007, 62, 035. S6

7 Primer sequences used in this study EcoRI-ausB-F 5 - TACCACAGAATTCATGGGCACCTCTGAAGA -3 EcoRI-ausB-R 5 - GTGCTGAGAATTCCTACCTGGAACCCTCAG -3 KpnI-ausC-F 5 - TACGGATTTGGTACCATGACTATTACACCC -3 KpnI-ausC-R 5 - CCTTGGTACCTCAAAACTTCGCAAAAAAAG -3 EcoRI-ausE-F 5 - AGTAACAGAATTCATGGGCTCAGCTACTCC -3 EcoRI-ausE-R 5 - CTCCAAGAATTCCTAAGCGCTGGAGATCAA -3 pta-spei-f 5'- GAGGAACTAGTTCATGGTGTTTTGATCATTTTAA -3' pta-spei-r 5'- GACCATACTAGTTTCCGTTCCTTTGCTTTCTGC -3' NdeI-ausE-F 5 - GTAACACATATGGGCTCAGCTACTCCATCC -3 S7

8 A) Database sequence A T G G C C A A G G T A A A T G T C A C G C A C C C A T T A T C G C C A G T G C A A T A C A C G G G C A T T C T C A A T 60 Database sequence A C T T T G G C G G T A A T T A G C G A T G T C A T G G A A A C T A C T G G A T G G A C G A T A A A T T T G T T A C C A 20 Database sequence G T T G T A C T A C A T G C C T T A C A T T T T C A A T G A A G G A A T G C C C C T T G C G T C C G G T C C T C C A A C 80 Database sequence A C T C C C G G A A G A C T T T A C A C C C G A G A A A T C T G G A T T C A G G G T A C T T G T C G A G G T T C G G C G 240 Database sequence A A T G A A A G G A C A T T T T C C A G C T C A G A A A T G G C G A A A A A G G A A T C A G G A A T G G C A G T G C A T 300 Database sequence C A A T A A T G A A A C A C T A C T C C C T G A C C A C G T A A G G A A C G G G C A C C T T G C C A A G A A C G T G C C 360 Database sequence C T A C C G T C C A T A C C G T C C A G T A T A T G T C C C T T T T G G T C A G T T C A G A C C T G T G A G A C T G T T 420 Database sequence T T G G C A A G T T T G G A A T T T C G A C T G A A C C G G C A A A A G C A T A T A C T A C T T T G G C T A A A A G T C 480 Database sequence C T A A A C C T C T T G T A C T T T C T C C T G G A A T G G T G T T G T C C G T A T A C T T G G G T G C C A C C A A C A 540 Database sequence A C C A A C A A C A G C T A T G A C T G T G A G C C C T A C C A C A G A C G C T A T G G G C A C C T C T G A A G A A A C 600 Revised sequence A T G G G C A C C T C T G A A G A A A C 20 Database sequence A C G A T C C A A A C A A A C C A A A G G G T C A A A C G A C G A T A T T T T G A G C G C G A A G A T A G C T G G A A G 660 Revised sequence A C G A T C C A A A C A A A C C A A A G G G T C A A A C G A C G A T A T T T T G A G C G C G A A G A T A G C T G G A A G 80 Database sequence A G T T G C T C G C C C C G T T T A T C A C T G C A C A A G C G C A C G G C T C C A T G A C C T A G C C T A C G A C C C 720 Revised sequence A G T T G C T C G C C C C G T T T A T C A C T G C A C A A G C G C A C G G C T C C A T G A C C T A G C C T A C G A C C C 40 B) Database sequence A T G T A T G C A T C G A A T A A G A C G T A T C C G T C T T C T A G G G C G C T C C C T T G C C T C G T T G A G A A G 60 Database sequence G T C G A G G C A C A A C A C G T T G A C G G G G C G A T T A G A G T A A G G A T C A C A A C G C T G G A G C A G A G T 20 Database sequence A C G C G T C G T A A A C C A T C C C G A G C A G A T T A T C T A T A C T T T T G T G A A G C C T T T G A G C T T T T G 80 Database sequence A A C A C C T T G A G G T C G T T C T C A G T A C G G A T T T G C C A G T A T G A C T A T T A C A C C C A A C A T T C T 240 Revised sequence A T G A C T A T T A C A C C C A A C A T T C T 23 Database sequence A G A A G A C T G G C G T C A A G C C A A A G C C G C C G C T G T T G A A G C C A A A T A C G A A G C G G A A C G C G A 300 Revised sequence A G A A G A C T G G C G T C A A G C C A A A G C C G C C G C T G T T G A A G C C A A A T A C G A A G C G G A A C G C G A 83 Database sequence G A T C C A A C T T C G A G C T C A C G G A A A C G T G A A A G A C A T T G A A A T C A C C C G C G A G T C A G C C T T 360 Revised sequence G A T C C A A C T T C G A G C T C A C G G A A A C G T G A A A G A C A T T G A A A T C A C C C G C G A G T C A G C C T T 43 Figure S Comparison of the revised 5'-terminal DNA sequences of A) ausb and B) ausc with the original database sequences. The regions highlighted in magenta are predicted introns in the database. S8

9 A) B) Figure S2 Time (min) Time (min) Production of the minor products, 4, 9, and 6. PLC analyses of the fractions containing A) 0 and B) 7, after silica gel chromatography. The chromatograms were monitored at 90 nm x) ix) viii) vii) vi) 0 v) iv) 0 0 iii) ii) i) Figure S Time (min) PLC profiles of culture supernatant extracts from each transformant incubated with various compounds: i), iii), v), vii), and ix) transformant harboring empty vectors incubated with 0, 9, 4, 3, and 2, respectively; ii), iv), vi), viii), and x) transformant that expresses AusC and AusE incubated with 0, 9, 4, 3, and 2, respectively. The chromatograms were monitored at 90 nm. S9

10 ' 9 6 3' ' 2' 7' 5' ' 8' 6' 0' '' Table S NMR data for 5-hydroxyberkeleyone A (8) C position δ (ppm) δ (ppm) intensitiy multiplicity MBC correlation CSY correlation NESY correlation (α) m 0 -β, -2α, -2β.6 (β) m -α, -2α, -2β (α) m 4 -α, -β, -2β, (β) m 3 -α, -β, -2α, dd (J =.9, 5. z) 4, 4, 5-2α, -2β -β, -2β, (α) td (J =.9, 4.5 z) 7-6β, -7α, -7β -2, -, (β) m 8-6α, -7α, -7β (α) m 5, 6, 8, 9, 2-6α, -6β, -7β (β) td (J =.9, 4.5 z) 6, 8, 2, 7' -6α, -6β, -7α m 8, 9, 0,, -β -7β (α) m 8, 9, 0, 3' -β -2, -, -9', -''.78 (β) m 8, 9, 0, 2', 4' -9, -α s 7, 8, 9, 7' -6α, -7α, -α, -, -'' s, 5, 9, 0-2α, -6α, -α, -2, s 3, 4, 5, 5-3, -6β s 3, 4, 5, 4-2α, -6α, - ' (a) brs 2', 3', 7' -'b -2, -'' 5.35 (b) brs 2', 3' -'a -9' 2' ' 5. 4' ' ' ' ' ' s, 2', 3', 4' -α, -'b 0' s 4', 5', 6' -9 '' s 8' -α, -2, -'a 3. brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) S0

11 parts per Million : Figure S4 NMR spectrum of 5-hydroxyberkeleyone A (8) parts per Million : C Figure S5 C NMR spectrum of 5-hydroxyberkeleyone A (8) S

12 ' 9 6 3' ' 2' 7' 5' ' 8' 6' 0' '' Table S2 NMR data for preaustinoid C (9) C position δ (ppm) δ (ppm) intensitiy multiplicity MBC correlation CSY correlation NESY correlation d (J = 0.2 z) 3, , -9, -β d (J = 0.2 z) dd (J =.9, 2.8 z) 6, 4, 5-4, -7β, (α) m -5, -7α, -7β.56 (β) m -5, -7α, -7β (α) dt (J =.6, 3.4 z) -6α, -6β, -7β (β) td (J =.6, 4.0 z) -6α, -6β, -7α dd (J =.6, 2.8 z) -α, -β -, -5, -β, -0' (α) t (J =.0 z) 9, 3', 4' -9, -β -2, -, -9' 2. (β) dd (J =.0, 2.8 z) 8, 2' -9, -α -9, -9' s 7, 8, 9, 7' -7α, -α, -, -'' s, 5, 9, 0 -α, -2, s 3, 4, 5, 5-5, s 3, 4, 5, 4 -, -4 ' (a) brs 3', 7' -'b -2, -'' 5.42 (b) brs 3', 7' -'a -9' 2' ' 5.0 4' ' ' ' ' ' s, 2', 3', 4' -'b, -α, -β 0' s 4', 5', 6' '' s 8' -'a 3.26 brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) Note: Stereochemistry of C-0 was determined by comparing the structure with the reported compounds as berkeleyone A (3) and preaustinoid A3 (7) S2

13 parts per Million : Figure S6 NMR spectrum of preaustinoid C (9) parts per Million : C Figure S7 C NMR spectrum of preaustinoid C (9) S

14 2 3 ' 0 4 9' ' ' 2' 7' 5' ' 8' 6' 0' '' Table S3 NMR data for austinoid C (0) C position δ (ppm) δ (ppm) intensitiy multiplicity MBC correlation CSY correlation NESY correlation d (J = 5.9 z) 2, 3, 4, , -6β, -7β d (J = 5.9 z), 3, 4, (α) m 8-7α, -7β -7α, (β) m 7, 0-7α, -7β -, (α) m 6-6α, -6β, -7β -6α, (β) m 6-6α, -6β, -7α (α) dd (J = 2.3,. z) 9, 3', 4' -β, (β) d (J = 2.3 z) 8, 9, 2', 3', 4' -α s 7, 8, 9, 7' -7α, -α d (J =. z) 5, 9, 0 -α -β, s 3, 4, 5, 5-6α, -6β, s 3, 4, 5, 4 -, -4 ' (a) brs 3', 7' -'b -'' 5.47 (b) brs 3', 7' -'a -9' 2' ' 5.3 4' ' ' ' ' ' s, 2', 3', 4' -'b 0' s 4', 5', 6' '' s 8' -'a 2.9 brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) Note: Stereochemistry of C-0' was determined by comparing the structure with the reported compounds as berkeleyone A (3) and preaustinoid A3 (7) S4

15 parts per Million : Figure S8 NMR spectrum of austinoid C (0) parts per Million : C Figure S9 C NMR spectrum of austinoid C (0) S5

16 ' 9 6 3' ' 2' 7' 5' ' 8' 6' 0' '' Table S4 NMR data for berkeleyone A (3) C position δ (ppm) δ (ppm) intensitiy multiplicity (α) m 0.6 (β) m (α) m.5 (β) m dd (J =.3, 4.0 z) m (α) m.60 (β) m (α) dt (J =.6, 3.4 z) 2.02 (β) td (J =.6, 4.0 z) m (α) m.92 (β) dd (J =.0, 3.4 z) s s s s ' (a) brs 5.36 (b) brs 2' ' 5. 4' ' ' ' ' ' s 0' s '' s NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) S6

17 ' 9 6 3' ' 2' 7' 5' ' 8' 6' 0' '' Table S5 NMR data for preaustinoid A (4) C position δ (ppm) δ (ppm) intensitiy multiplicity (α) m.09 (β) m (α) m 2.38 (β) m m (α) m.53 (β) m (α) dt (J =.6, 3.4 z) 2.02 (β) m dd (J =.6, 2.8 z) (α) t (J =.0 z).93 (β) dd (J =.0, 2.8 z) s s s s ' (a) brs 5.39 (b) brs 2' ' 5. 4' ' ' ' ' ' s 0' s '' s 3.24 brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) S7

18 ' 9 6 3' 8 7 4' 2' 7' 5' ' 6' 8' 0' '' Table S6 NMR data for preaustionoid A2 (6) C position δ (ppm) δ (ppm) intensitiy multiplicity d (J =.9 z) d (J =.9 z) m (α) m.50 (β) m (α) dt (J =.6, 2.8 z).87 (β) td (J =.6, 2.8 z) dd (J =.6, 2.3 z) (α) m 2.00 (β) dd (J =.6, 2.3 z) s s s s ' (a) brs 5.45 (b) brs 2' ' 5.2 4' ' ' ' ' ' s 0' s '' s 3.24 brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) S8

19 ' ' ' 2' 7' 5' ' 8' 6' 0' '' Table S7 NMR data for preaustionoid A3 (7) C position δ (ppm) δ (ppm) intensitiy multiplicity d (J = 9.6 z) d (J = 9.6 z) dd (J =.3, 4.0 z) m (α) m.60 (β) m (α) dt (J = 4.7, 3.4 z) 2.65 (β) td (J = 4.7, 3.4 z) m (α) dd (J = 5.3,.7 z) 2.94 (β) d (J = 5.3 z) s s s s ' (a) brs 5.48 (b) brs 2' ' 5.2 4' ' ' ' 7.6 8' ' s 0' s '' s 2.90 brs NMR: 500 Mz, C NMR: 25 Mz (in CDCl 3 ) S9