human genome 3.2 billion bases Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT

Transcription

1 Biotechnology A Brve New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT humn genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA 3.2 billion bses CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA TCATCCGATCAGATCATGCTAGTACATCGATCGATACT

2 Biotechnology tody Genetic Engineering mnipultion of DNA if you re going to engineer DNA & genes & orgnisms, then you need set of tools to work with this unit is survey of those tools Our tool kit Bcteri Bcteri review one-celled prokryotes reproduce by mitosis rpid growth binry fission genertion every ~20 minutes 108 (100 million) colony overnight! dominnt form of life on Erth incredibly diverse Bcteril genome Single circulr chromosome hploid nked DNA ~4 million bse pirs no histone proteins ~4300 genes 1/1000 DNA in eukryote How hve these little guys gotten to be so diverse??

3 Trnsformtion promiscuous!? Bcteri re opportunists pick up nked foreign DNA wherever it my be hnging out mix het-killed pthogenic & non-pthogenic bcteri hve surfce trnsport proteins tht re specilized for the uptke of nked DNA import bits of chromosomes from other bcteri incorporte the DNA bits into their own chromosome express new genes trnsformtion form of recombintion mice die Plsmids Smll supplementl circles of DNA ,000 bse pirs self-replicting crry extr genes 2-30 genes genes for ntibiotic resistnce cn be exchnged between bcteri bcteril sex!! (conjugtion) rpid evolution cn be imported from environment How cn plsmids help us? A wy to get genes into bcteri esily insert new gene into plsmid insert plsmid into bcteri = vector bcteri now expresses new gene bcteri mke new protein gene from other orgnism cut DNA plsmid recombinnt plsmid + vector glue DNA trnsformed bcteri

4 Biotechnology Plsmids used to insert new genes into bcteri cut DNA gene we wnt like wht? insulin HGH lctse cut plsmid DNA Cut DNA? DNA scissors? ligse recombinnt plsmid insert gene we wnt into plsmid... glue together How do we cut DNA? Restriction enzymes restriction endonucleses discovered in 1960s evolved in bcteri to cut up foreign DNA restrict the ction of the ttcking orgnism protection ginst viruses & other bcteri bcteri protect their own DNA by methyltion & by not using the bse sequences recognized by the enzymes in their own DNA Wht do you notice bout these phrses? rdr plindromes rcecr Mdm I m Adm Able ws I ere I sw Elb mn, pln, cnl, Pnm Ws it br or bt I sw? go hng slmi I m lsgn hog

5 Mdm I m Adm Restriction enzymes Action of enzyme cut DNA t specific sequences CTGAATTCCG GACTTAAGGC restriction site symmetricl plindrome produces protruding ends CTG AATTCCG GACTTAA GGC sticky ends will bind to ny complementry DNA Mny different enzymes nmed fter orgnism they re found in EcoRI, HindIII, BmHI, SmI 1960s 1978 Discovery of restriction enzymes Werner Arber Dniel Nthns Hmilton O. Smith Restriction enzymes re nmed for the orgnism they come from: EcoRI = 1st restriction enzyme found in E. coli Sticky ends Cut other DNA with sme enzymes leve sticky ends on both cn glue DNA together t sticky ends GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you wnt GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome wnt to dd gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

6 Sticky ends help glue genes together cut sites gene you wnt cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA sticky ends isolted gene AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA cut sites chromosome wnt to dd gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA Recombinnt DNA molecule DNA ligse joins the strnds sticky ends stick together chromosome with new gene dded TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC How cn bcteri red humn DNA? Why mix genes together? Gene produces protein in different orgnism or different individul humn insulin gene in bcteri TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC new protein from orgnism ex: humn insulin from bcteri bcteri The code is nerly universl Since lmost ll living orgnisms use the sme DNA use the sme code book red their genes the sme wy humn insulin

7 Copy (& Red) DNA Trnsformtion insert recombinnt plsmid into bcteri grow recombinnt bcteri in gr cultures bcteri mke lots of copies of plsmid cloning the plsmid production of mny copies of inserted gene production of new protein trnsformed phenotype DNA RNA protein trit Grow bcteri mke more gene from other orgnism recombinnt plsmid + trnsformed bcteri vector plsmid grow bcteri hrvest (purify) protein Uses of genetic engineering Geneticlly modified orgnisms (GMO) enbling plnts to produce new proteins Protect crops from insects: BT corn corn produces bcteril toxin tht kills corn borer (cterpillr pest of corn) Extend growing seson: fishberries strwberries with n nti-freezing gene from flounder Improve qulity of food: golden rice rice producing vitmin A improves nutritionl vlue

8 Green with envy?? Jelly fish GFP Trnsformed vertebrtes Cut, Pste, Copy, Find Word processing metphor cut pste copy restriction enzymes ligse plsmids bcteril trnsformtion is there n esier wy?? find???? I m very specil pig! Got ny Questions?