Biology 4100 Minor Assignment 1 January 19, 2007

Transcription

1 Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on white paper. You may wish to incorporate figures in your assignment. A new biotechnology company called Brentitech has hired you. The company is interested in developing a line of commercial enzymes for a number of applications in the livestock, food and beverage, pulp and paper, pharmaceutical, and textiles industries. The company is bio-prospecting in a number of microbial ecosystems, including the rumen, soil and hot springs, for novel genetic material. You have been assigned to the R&D group responsible for expressing newly cloned genes. Your first project is to characterize a new clone containing a novel esterase/lipase gene that was isolated from a gene library made by ligating BamHI digested puc18 with Sau3AI digested genomic DNA from Pseudomonas pseudoalcaligenes strain 249. The resulting ligation was transformed into Escherichia coli DH5α and the transformed cells were plated on LB agar containing 100 µg/ml of ampicillin and 0.1% polycaprolactone (PCL). The plates were examined for colonies producing zones of clearing in the PCL precipitate (Figure 1). Five PCL hydrolyzing colonies were recovered from screening 10,000 colonies. The most active clone was clone 5 and it contains puc18 with a 4095 bp insert. This plasmid was named pcut5. The pcut5 insert was sequenced and the sequence data can be found in Appendix 1 below. Zymogram analysis on E. coli DH5α (pcut5) culture lysates identified a novel 32 kda protein with lipase activity. (Note: Zymograms are polyacrylamide gel electrophoresis gels (PAGE) that are stained for enzyme activity rather than protein bands.) 1) Restriction digestion analysis. Copy the pcut5 sequence from Appendix 1 below and paste the sequence into the NEBcutter V2.0 at Perform the following restriction digests: 1) with program default parameters, 2) with all of the restriction enzymes that cut in the puc18 multiple cloning site, and 3) with BamHI, EcoRI, HindIII and KpnI. Save these digestion images and incorporate them into your analysis report as figures. You can use the NEBcutter print function to do this. 6 Marks 2) Open reading frame (ORF) analysis. Notice that the NEBcutter tool identifies ORFs or potential coding regions in the submitted sequence. You may also use the ORF Finder tool at the NCBI site ( Find all of the ORFs in the 4095 bp insert that may potentially code for the P. pseudoalcaligenes lipase. Put this figure in your report. 10 Marks 3) Basic Local Alignment Search Tool (Blast) analyses. Blast analysis finds regions of similarity between sequences. In this exercise, you will use the BLAST feature of the NCBI site ( to identify the likely coding sequences in the 4095 bp insert. There are a number of search options available. For the purposes of this exercise you will perform a nucleotide nucleotide search (blastn) and translated query protein database search (blastx). In the blastx search, one submits nucleotide sequence data and the program translates the sequence into all six reading frames and compares the resulting amino acid sequences to the protein database. Note: Be sure you use the nr database option in your searches.

2 Biol 4100 Assignment 1, January 19, 2007 a) Compare the results of both searches (i.e., blastn and blastx) and prepare a table listing the five most closely related database entries for each search. In your table be sure to include columns for search program (blastn or blastx), accession number, source, E value and type of gene or polypeptide. A comparison of the above searches will reveal dramatically different results in terms of the database hits and their relatedness at the nucleic acid and polypeptide levels to the homologues found on the insert. You will find dramatically different results from these searches (e.g., related sequences, rankings as well as numbers of significant "hits" i.e., E values < for this exercise). Speculate why the blastn and blastp search results are so different. (10 marks) b) Identify the most likely ORF responsible for the observed lipase activity in the E. coli DH5α (pcut5) culture lysates. Be sure to provide justification for your answer. (10 marks) c) Describe the simplest experiment you could do in order to confirm empirically your answer in section 3b above. YOU CANNOT USE PCR IN YOUR EXPERIMENT. List the steps to be used in your experiment. Your description must be detailed enough so that someone skilled in the art could perform it in the laboratory (24 marks) 2

3 Biol 4100 Assignment 1, January 19, 2007 Figure 1. Polycaprolactone (PCL) hydrolysis plate assay with E. coli DH5α (pcut5). Zones of hydrolysis (i.e., clearance) were visible after incubating the plates at 37 C for 18 h. 3

4 4 Biol 4100 Assignment 1, January 19, 2007 Appendix 1. Nucleotide sequence data for pcut5 insert. (Note: the sequence data includes the puc18 multiple cloning site on either side of the BamHI site used in the cloning of the P. pseudoalcaligenes insert) gaattcgagctcggtacccggggatctgcccggctacccggagctcatctataaacgcctgatgggcgtc ggccggcagatgaaaatagtcccgtccctcgaccagttcggcctcacaggccttgaaccagcggaaactg gctcccttgggcagcccgttgagctcgtcgagctgacgcagactgagggtgtcagtgccggcgaagtgga ttggtgcaacagaagccatgcagattcccgtattggaccaggcaagcagagtggcaaccataacagaatc agcccggcttgagagcttgggaaagggcacagcgcgctccctgggacaagaacgatccatccccgcggca agtgttttgccctgcactttcactccctgctccggtccgaattatgagggacgttccggcggatgtgctg gtggtcggcaatccgcgcccgatcgtgcagcgataacaccacaacaactacaggagatttcatcatgccc tccaccattcgtcttcatcgcgttctgcaggccccagccgagcgggtctatcgtgccttccttgatccac cagccatggtcaagtggttgccaccgcatggcttcactggcgaggtgcagcatatggacgcccgggttgg cggctcctatcgcatgtcattcaccaacttcaccagccagcagaaacattcgttccacggtgaatatcag gagttgatacccggcgagcggatacgctacagcgacagcttcgatgatccgggcctgcccggcaccatcg aagtcacggtattgctcagggaagtgtcctgtggcaccgagctgaacatcacccaggaaggcgtgcccga cccgattccggccgaggcgtgttatctgggctggcaggagtcgctgaaccagctggcgaagctggtcgag gcggagattcccgatcaggaaccgagctgatcccggagtgcgatgatcatacctatgcactttttacacc gcagcgagtctgaagttggggtaagtccaggatccaggagaggcatcatgggaaataacaagctgatagg catagtgctgttggtggtcggtctgattctgctgtacttcggatggcaatcatcgcaatcggttggcgat caggtggtcgaaaccttcaccggacgtttcaccgacagcaccatgtggttcctgatcgtcggcgcggcag ctgcagtggccgggatattcatggcagtgctgaaaaagtgattcgccacctcggcgcagccggccagcac ggctatcggctggctgcgtcggaggtccagcatgcgttttccccggacgtagtaaggaggcctgttgaag accgcctttatccgagtcatgaaatggctgctgcttctggcgatcatcgccgtggtggtgctgagcaagc cctgggagcatatccctcccgagtggcacccgtggacgccgctttccatcgaccacccgatgacactggt cagcaaatggaagctggcgcaactcaaggacaatccgcaacaatgcctgagaccgtgctggagacagctc ccgacggagccattgattacctggcactggatgactacaccccggtggccggttgcccgctgagcaatgt ggtacgcgtacggcagtactggcgtgggcttcagctccaccttcaccgtcacctgcccgctggccgwggc ctgggtcatgttcgtagcgccagcaattgcaaccgcttgcacagaaacacatgggcagcgatctgttccg ggttgatcacctaggcagttttgcctgccgcaatatctaccatcgcggaaggtgcacggtgcagccagca cgcaacagccaatgccttcgatatcgccggctttcgcttcgagaatggacaacaggtctcggtactcagg cattgtaatgacaatacaaaccccgccagatcaatatttctcaaggaagcccacggtgctgcctgcggtt attttggtaccggctcggtcccgactacaatcagccgcacgaaaaccactttcatttcgatggcagtggc ttcggcttctgtcgttgacagtcagcccacactatcgaggccggccccatgtcggggccggctttctttc actgctgttgatcaataaggacagttgccacggtattcggaaaccctgcgatcggaagtgtgattcgggc cacagaggaactggctgtaacgagtgtcgttatccaggaagcgtttcatccaggatacgccaaggcggct gagtacatcgttgttcaaaccacccccgttggcacaatagtgcgacccgccactgatctcgacataggct ttctcgatatcattcggcaactggttatagaagggagaggcatgcacacctaccggtgcgatgatatccg cctggcaggcgaagatcagcgtcggtgcctggacactgcgggcattggtggtatcccagggggccaacgg aatggctgccttgatccggccctggctggccacgcgcagcgtgccgccaccgcccatggaccagccgatc acgcccagccggtcggtatcgatcatgccgttgaccgggctggttctgcgggaattctggtcgaccagat aatccagcgcgttgttgatctgccgggctcggctcggcggctggtcaaagccggtattggtatctatggt catgcacccgaagccgtgtgncgccagcttggggccccaacagtcgatggaggactccgccgacacaaag cccgggatgaccacgatcgccgccatggtaccggtagtgccggtgggatagtggatggtgccacccccga aaccactgaccaggccggaaacccggctggtacgcgtgctgtagggaccgctggaggcttcgaggaaggc cacggtcgggtccgggccacgggcataggagtcacccgggtcggtcggttcatccaccggtgggttggtc gccatgaccgaagtagatagcaacagggctcccgccgccaacatggaaagcagcgaattgggtagggttc tatttatcattgttactccagaagtattgttagttttattgtcaaccacatatcacgcttactgctgatg ccaagtacaacttcaccaacagcgccggagtattttgcttgtattaatcaaggtcaatgggaaaacacaa agttcacccgcacgggtgataagagaaagacctttagctataaattcattcagaaaaaatattcatatgt aataaacaaccaaactttcttattcaaaaccacactttcgagttaatagcgttgcaatgtcattcattac cctcgacaccatgcgctgccctgcccttctgggtcgcctgccctactgctgattgacgccagcccggcga cagcagatcattccaactgattgatcacaggggtaaaacatgtttgagaatgtggactggctgccggaca actttgtaatttccgatgccctgctgagcctgttggccagtacggtcattctgattgtggttattttcat cttgcgtgccctggctttatccagcgcacggtgcaatcaccggagctgcgcggcaaatggctggtcaact cccgcaacggtttcctgctgttgatgctgctcgggctggtgatgatctggggcgaggagctgcgtaccct ggcgctgtccatcgtcgccatcgcggtcgccttcgtggtcgccaccaaggagctgatcctttgtttcacc ggctcgatactcaagagcggctcgcgctccttcgtgctcggcgaccgcatccagatcaaggagctgcgtg gtgacgtcatcgatcagaccctgctggccaccaccattctggaggtcgggcccggcaagcacctgcacca gcgcactgggcggcgcatcgtcatccccaacgcgctgttcgtctccgagccggtggtcaatgaaagcttc

5 Biol 4100 Assignment 1, January 19, 2007 accacccattacgactttcacgtgttcaccgtgccgttcaagcgcgaagacaactggcaggctgcacaag ccgcgttgatgacctcggccacgcgccattgccagccgtatatggagttggtgcggcgctacatgagcaa gatcctctagagtcgacctgcaggcatgcaagctt 5