Retrieval of gene information at NCBI

Size: px
Start display at page:

Download "Retrieval of gene information at NCBI"

Transcription

1 Retrieval of gene information at NCBI

2 Some notes Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in your own language, give necessary reference, should be logic and slides are connected. Besides the main ideas in the paper, you can have yours from elsewhere. It is not expected for you to understand every detail or present everything in the paper. 3. Keep practicing programming.

3 What is a gene? From wiki 1. A gene is the molecular unit of heredity of a living organism. It is used extensively by the scientific community as a name given to some stretches of deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) that code for a polypeptide or for an RNA chain that has a function in the organism. Living beings depend on genes, as they specify all proteins and functional RNA chains. Genes hold the information to build and maintain an organism's cells and pass genetic traits to offspring Bioinformatics is indispensible for biological research. 2. A modern working definition of a gene is "a locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions, and or other functional sequence regions.

4 Given a gene name, if you want to know what is known about this gene, you can find answers at NCBI By choosing gene in the search menu and inputting the gene name.

5 An example: STAT1 Gene ID Gene ID, also called Entrez ID or locus link previously, corresponds to the systematic feature qualifier used by the international sequence collaboration (DDBJ/EMBL/GenBank), and can be assigned by sequence submitters as a unique, systematic gene descriptor. When such a value is not available from submitted sequence, the identifier from a collaborating model organism database is used. Gene ID is often used to anchor a link to a database other than Entrez Gene.

6 An example: STAT1 HGNC HUGO Gene nomenclature Committee. For each known human gene the committee approves a gene name and symbol (shortform abbreviation). All approved symbols are stored in the HGNC database. Each symbol is unique and each gene is only given one approved gene symbol.

7 An example: STAT1 HPRD You can download all entries contained in HPRD including features of proteins such as post translational modifications, tissue expression, subcellular localization and protein protein interactions in tab delimited file format as per the users request. PhosphoMotif Finder contains known kinase/phosphatase substrate as well as binding motifs that are curated from the published literature. It reports the PRESENCE of any literaturederived motif in the query sequence.

8 An example: STAT1 OMIM Online Mendelian Inheritance in Man. OMIM is a comprehensive and authoritative compendium of human genes and genetic phenotypes. The full text, referenced overviews in OMIM contain information on all known mendelian disorders and over 14,000 genes. OMIM focuses on the relationship between phenotype and genotype. It is updated daily, and the entries contain copious links to other genetics resources

9 An example: STAT1

10 cellular component, biological process and molecular function. A gene product might be associated with or located in one or more cellular components; it is active in one or more biological processes, during which it performs one or more molecular functions. For example, the gene product cytochrome c can be described by the molecular function term oxidoreductase activity, the biological process terms oxidative phosphorylation and induction of cell death, and the cellular component terms mitochondrial matrix and mitochondrial inner membrane.

11 Cellular component A cellular component is just that, a component of a cell, but with the proviso that it is part of some larger object; this may be an anatomical structure (e.g. rough endoplasmic reticulum or nucleus) or a gene product group (e.g. ribosome, proteasome or a protein dimer). See the documentation on the cellular component ontology for more details.

12 Biological process A biological process is series of events accomplished by one or more ordered assemblies of molecular functions. Examples of broad biological process terms are cellular physiological process or signal transduction. Examples of more specific terms are pyrimidine metabolism or alpha glucoside transport. It can be difficult to distinguish between a biological process and a molecular function, but the general rule is that a process must have more than one distinct steps. A biological process is not equivalent to a pathway; at present, GO does not try to represent the dynamics or dependencies that would be required to fully describe a pathway. Further information can be found in the process ontology documentation.

13 Molecular function Molecular function describes activities, such as catalytic or binding activities, that occur at the molecular level. GO molecular function terms represent activities rather than the entities (molecules or complexes) that perform the actions, and do not specify where or when, or in what context, the action takes place. Molecular functions generally correspond to activities that can be performed by individual gene products, but some activities are performed by assembled complexes of gene products. Examples of broad functional terms are catalytic activity, transporter activity, or binding; examples of narrower functional terms are adenylate cyclase activity or Toll receptor binding.

14

15

16 Another example: OCT4 What is your example?

17 Summary Entrez gene IDs and HGNC IDs are standard. HPRD provide good PPI and PTM. Function terms and gene annotation by GO. OMIM provides Phenotype information.

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able

More information

Data analysis: YeastMine, GO tools, and use cases

Data analysis: YeastMine, GO tools, and use cases Data analysis: YeastMine, GO tools, and use cases SGD: YeastMine: Email: sgd-helpdesk@lists.stanford.edu Rob Nash Senior Biocuration Scientist rnash@stanford.edu About SGD Started by David Botstein in

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

1-Microbial Taxonomy: classification nomenclature identification

1-Microbial Taxonomy: classification nomenclature identification Part 1 Basic Medical Microbiology 1-Microbial Taxonomy: Taxonomy is the area of biologic science comprising three distinct, but highly interrelated, disciplines that include classification, nomenclature,

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

PROTEIN SYNTHESIS. Higher Level

PROTEIN SYNTHESIS. Higher Level PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand

More information

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Information Extraction from Biomedical Text

Information Extraction from Biomedical Text Information Extraction from Biomedical Text BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2009 The Information Extraction Task: Named Entity Recognition Analysis of

More information

Genetics and Heredity Power Point Questions

Genetics and Heredity Power Point Questions Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is

More information

Where Are The Protein-synthesizing Instructions Stored On A Dna Molecule

Where Are The Protein-synthesizing Instructions Stored On A Dna Molecule Where Are The Protein-synthesizing Instructions Stored On A Dna Molecule DNA contains all the information a cell needs in order to make certain proteins. Where are the protein-synthesizing instructions

More information

2017 VCE Biology (NHT) examination report

2017 VCE Biology (NHT) examination report 2017 VCE Biology (NHT) examination report General comments This was the first Biology examination sat on the Northern Hemisphere Timetable and was the final examination for the VCE Biology Study Design

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Chemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18

Chemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18 Chemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18 By the end of this session, you should be able to 1. Know the general scheme of tissue organization, from

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

More information

The Gene Gateway Workbook

The Gene Gateway Workbook The Gene Gateway Workbook A collection of activities derived from the tutorials at Gene Gateway, a guide to online data sources for learning about genetic disorders, genes, and proteins. To view the chromosomes

More information

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data

More information

MS bioinformatics analysis for proteomics. Protein anotations

MS bioinformatics analysis for proteomics. Protein anotations MS bioinformatics analysis for proteomics Protein anotations UCO - Córdoba Organized by: ProteoRed, EUPA and Seprot Alberto Medina January, 23rd 2009 Summary Introduction Some issues Software: Fatigo -

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell

More information

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement: AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following

More information

Online Mendelian Inheritance in Man (OMIM)

Online Mendelian Inheritance in Man (OMIM) HUMAN MUTATION 15:57 61 (2000) MDI SPECIAL ARTICLE Online Mendelian Inheritance in Man (OMIM) Ada Hamosh, Alan F. Scott,* Joanna Amberger, David Valle, and Victor A. McKusick McKusick-Nathans Institute

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928 HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Niemann-Pick Type C Disease Gene Variation Database ( )

Niemann-Pick Type C Disease Gene Variation Database (   ) NPC-db (vs. 1.1) User Manual An introduction to the Niemann-Pick Type C Disease Gene Variation Database ( http://npc.fzk.de ) curated 2007/2008 by Dirk Dolle and Heiko Runz, Institute of Human Genetics,

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell

Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell Information Contained Within Each Cell Lecture 8 Nucleic Acids and Protein Synthesis Chapter 23: Section 1-5 Most higher organisms reproduce sexually! Sperm cell + Egg cell! Fertilized egg The wondrous

More information

BIO CURSE LEVEL OUTCOMES 1

BIO CURSE LEVEL OUTCOMES 1 BIO CURSE LEVEL OUTCOMES 1 SUBJECT COURSE # STUDENT LEARNING OUTCOMES BIO 1 Given the solute concentration of a solution, students will predict the movement of water by osmosis into or out of a cell. Given

More information

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding

More information

Four levels of protein Structure

Four levels of protein Structure Proteins (polypeptides) Four levels of protein Structure Primary Structure (1 structure): Secondary Structure (2 structure): Tertiary Structure (3 structure): Quaternary Structure (4 structure): Proteins

More information

Concepts of Genetics, 10e (Klug/Cummings/Spencer/Palladino) Chapter 1 Introduction to Genetics

Concepts of Genetics, 10e (Klug/Cummings/Spencer/Palladino) Chapter 1 Introduction to Genetics 1 Concepts of Genetics, 10e (Klug/Cummings/Spencer/Palladino) Chapter 1 Introduction to Genetics 1) What is the name of the company or institution that has access to the health, genealogical, and genetic

More information

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the

More information

What is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution =

What is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution = What is Genetics? Genetics The study of how heredity information is passed from parents to offspring The Modern Theory of Evolution = Genetics + Darwin s Theory of Natural Selection Gregor Mendel Father

More information

Protein Synthesis Transcription And Translation Lab Answers

Protein Synthesis Transcription And Translation Lab Answers Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

The 6 well-studied model organisms, with species names: roundworm. Caenorhabditis elegans fruit fly

The 6 well-studied model organisms, with species names: roundworm. Caenorhabditis elegans fruit fly Creating a Gene dossier Your project is to compile a dossier about a gene that you choose and its corresponding protein. Each student will create a Google website on which to compile all materials related

More information

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Protein Synthesis Foldable

Protein Synthesis Foldable Ameoba Sisters Protein Synthesis Foldable Transcription What? How? What are the steps? Location? Why? Draw a picture to represent this. Translation What? How? What are the steps? Location? Why? Draw a

More information

Gene Annotation and Gene Set Analysis

Gene Annotation and Gene Set Analysis Gene Annotation and Gene Set Analysis After you obtain a short list of genes/clusters/classifiers what next? For each gene, you may ask What it is What is does What processes is it involved in Which chromosome

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Keystone Biology Remediation B2: Genetics

Keystone Biology Remediation B2: Genetics Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,

More information

Research proposal. Title: Development and Implementation of a Data Model for Pathway Mapping. Student: Linghao Yi

Research proposal. Title: Development and Implementation of a Data Model for Pathway Mapping. Student: Linghao Yi Research proposal Title: Development and Implementation of a Data Model for Pathway Mapping Student: Linghao Yi Supervisors: Kevin Robertson Muriel Mewissen Peter Ghazal Douglas Armstrong (GTI), (GTI),

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

More information

Augmenting DIAMOnD: A Method for Improving Disease Networks Among Human Genes

Augmenting DIAMOnD: A Method for Improving Disease Networks Among Human Genes Augmenting DIAMOnD: A Method for Improving Disease Networks Among Human Genes A Major Qualifying Project submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE in partial fulfillment of the requirements

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

What is a chromosome and where is it located and what does it

What is a chromosome and where is it located and what does it What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Biology From gene to protein

Biology From gene to protein Biology 205 5.3.06 From gene to protein Shorthand abbreviation of part of the DNA sequence of the SRY gene >gi 17488858 ref XM_010627.4 Homo sapiens SRY (sex determining region Y chromosome) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGG

More information

Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm

Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Jay McTighe and Grant Wiggins,

Jay McTighe and Grant Wiggins, Course: Integrated Science 3/4 Unit #3: (DNA & RNA) Instructions for Life Stage 1: Identify Desired Results Enduring Understandings: Students will understand that Nearly all human traits, even many diseases,

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

3. A form of a gene that is only expressed in the absence of a dominant alternative is:

3. A form of a gene that is only expressed in the absence of a dominant alternative is: Student Name: Teacher: Date: District: Robeson Assessment: 9_12 Agriculture AU71 - Biotech and Agrisci Rsch I Test 3 Description: Obj 12 - Simple Mendelian Genetics Form: 501 1. The genotype of an organism

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction

More information

hgu95av2 March 17, 2019 Bioconductor annotation data package hgu95av2 Description

hgu95av2 March 17, 2019 Bioconductor annotation data package hgu95av2 Description hgu95av2 March 17, 2019 hgu95av2 Bioconductor annotation data package The annotation package was built using a downloadable R package - AnnBuilder (download and build your own) from www.bioconductor.org

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

Course Competencies Template - Form 112

Course Competencies Template - Form 112 Course Competencies Template - Form 112 GENERAL INFORMATION Name: Drs. Susan Neimand and Edwin Ginés- Candelaria Course Prefix/Number: PCB 3060 Number of Credits: 3 Degree Type Phone #: (305) 237-6152,

More information