Bioinformatics for Cell Biologists
|
|
- Irma Robinson
- 5 years ago
- Views:
Transcription
1 Bioinformatics for Cell Biologists March 2010 Developmental Biology and Regnerative Medicine (DBRM)
2 Schedule Monday, March Introduction to course and Bioinformatics (L1) D224 Helena Storvall Core databases for bioinformatics (C1) Space Ersen Kavak, Helena Storvall, Daniel Ramskold Tuesday, March Alignments (L2) D224 Daniel Ramskold Phylogenetics (L3) D224 Prof. Bengt Persson, CMB and LIU Protein Sequence Bioinformatics (L4) D224 Prof. Bengt Persson, CMB and LIU Computer Excercise 1: Alignments, Genomes and Browsers (C2) Space Rickard Sandberg
3 Wednesday, March Computer Exercise 2: Phylogenetics and Proteins (C3) Space Rickard Sandberg Invited Speaker 1: D224 Transcriptome and translational regulation Dr. Ola Larsson, McGill University Next generation sequencing bioinformatics (L5) D224 Rickard Sandberg Thursday, March Computer Exercise 3: Tools for Next Gen Sequencing, Galaxy (C4) Space Rickard Sandberg Bioinformatics of microrna target predictions (L6) D Statistical issues with genome wide experiments (L7) D224 Yudi Pawitan, Dept of Medical Epidemiology and Biostatistics
4 Friday, March Project work Project presentations (20 min per group) Wrap up and course evaluation Rickard Sandberg
5 Examination Project in groups of 2 (or 3). Form groups today! Apply bioinformatics resources to gather all information possible about your gene of interest. Save all information in a wiki. Each group will present their project at the end of the course. Each group member is expected to participate in the presentation. Examination date: 19 March 2010 (Friday)
6 Getting to know you better Name Department Areas of research Bioinformatics resources currently using Expectations of the course 7
7 Introduction to bioinformatics Helena Storvall Department of Cell and Molecular Biology Karolinska Institutet Stockholm, Sweden
8 Overview What is bioinformatics? Why is it important? Uses of bioinformatics Example problems Databases and tools What databases solves the problem? Take home message Goals of the course
9 What is bioinformatics? Bioinformatics is the use of computer technology to manage, analyze and understand biological information Storage and sharing (databases) Computations and statistics Visualization of data Simulations Comparisons of data
10 Why is it important? Data is in abundance Genome assemblies Expression data Protein sequence and structure Challenges: Storing the data Visualizing data Translating it into knowledge!
11 Sequence data The amount of sequencing data is increasing exponentially 1988: ~ sequences 1998: ~ 3 milj sequences 2008: ~ 99 milj sequences
12 Examples of uses De novo genome assembly revolutionized by next generation sequencing Transcriptomics genome wide expression measurements Alignments structure and function prediction, heritage Protein folding simulation Blue Gene QSAR Quantitative structure activity relationship
13 Genome wide mindset HeLa cells transfected with microrna, expression measured by microarray Is downregulation due to direct interaction or secondary effect? Simple approach: search for sequence complem entarity to the mirna Bioinformatics approach: search for enriched sequence motifs Lim et al. Nature 2005
14 Scenarios
15 What kind of data is out there? Others: OMIM, PDB Pfam UniProt
16 Sequence databases are synchronized
17 Entrez Cross database search in NCBI resources Results include: PubMed Entrez Gene RefSeq OMIM Protein sequence Protein structure
18 Entrez gene Focuses on the genomes that have been completely sequenced, have an active research community to contribute gene specific information, or that are scheduled for intense sequence analysis. Content of Entrez Gene: RefSeq collaborating model organism databases many other databases available from NCBI.
19 Gene Annotations Annotation = descriptive summary Gene annotations encompass Genomic position, strand information Intron exon boundaries Gene name Isoforms RefSeq Manually curated Ensembl Gene set and UCSC known genes Automatic annotations
20 RefSeq RefSeq represents the NCBI curated reference sequences. Contains useful annotations and it is manually curated RefSeq are either genomic, mrna or protein sequences. All RefSeq sequences are assembled/taken from data deposited into GenBank. Not all sequences are in RefSeq
21 Ensemble Gene set and UCSC known genes UniProt RefSeq Automatically annotated Contains predicted genes Contains more non proteincoding genes
22 Gene ontology GO describes how gene products behave in a cellular context. Three organizing principles: Molecular function: describes activities, such as catalytic or binding activities, at the molecular level. Biological process: involvement in multistep process, eg signal transduction, cell physiological process. Cellular component: what the gene product is localized to or a subcomponent of, eg localized to nucleus, subcomponent of ribosome.
23 OMIM OMIM = Online mendelian inheritance in man Summaries of human gene function Manually curated Focused on relationship between genotype and phenotype Originally focused on human disease, now encompass all kinds of genes Good place to start searching information about a gene
24 Alignment tools Alignment = match your sequence to known sequences BLAST Basic Local Alignment Search Tool Nucleotide, protein, translated nucleotides Maps against all known sequences Inheritance maps to several organisms
25 Alignment tools BLAT BLAST Like Alignment Tool Faster than BLAST Simultaneous queries Maps only to genome assembly Only one organism at a time Might miss divergent or short alignments Connected to UCSC genome browser
26 Genome browsers UCSC genome browser and Ensembl Collects genomic information Alignments to the genome Expression data Different isoforms Position on the genome Provides a comprehensive visualization of this collection Among the most important tools in bioinformatics!
27 UCSC genome browser
28 Protein annotations UniProt reviewed proteins = swiss prot protein sequence and annotation data merge between SWISS PROT and PIR Both reviewed and un reviewed proteins Manually curated brings together experimental results, computed features and scientific conclusions unreviewed proteins = TrEMBL (Translated EMBL) contains the translations of all coding sequences (CDS) present in the EMBL Nucleotide Sequence Database not yet integrated in SWISSPROT.
29 UniProt
30 Pfam Pfam Protein Family database Collection of protein domain families Pfam A built from UniProt Pfam B un annotated, automatically rendered Pfam entries are classified in one of four ways: Family: A collection of related proteins Domain: A structural unit which can be found in multiple protein contexts Repeat: A short unit which is unstable in isolation but forms a stable structure when multiple copies are present Motifs: A short unit found outside globular domains
31 Other protein tools PDB Protein Data Bank protein structures (NMR, x ray chrystallography) STRING Protein protein interactions Emboss pepinfo Physico chemical properties of protein Hydrophobicity, polarity, charge
32 Pathways KEGG biochemical pathways BioCarta intracellular signaling pathways
33 Functional enrichment in gene sets DAVID functional annotation tool DAVID = Database for Annotation, Visualization and Integrated Discovery Screens both gene ontology and pathways Searches for enrichment of functional features
34 Expression patterns Antibody based data Human Protein Atlas Mamep mouse development Allen brain map mouse and human brain Sequencing and array data Gene expression omnibus Array express
35 Scenario 1 Entrez > OMIM, PubMed UCSC genome browser UCSC genome browser BLAST OMIM BLAST > OMIM 1
36 Scenario 2 BLAT, UCSC genome browser BLAST Emboss pepinfo Uniprot Pfam 2
37 Scenario 3 STRING Gene Ontology KEGG BioCarta PDB 3
38 Take home messages Bioinformatics is needed to translate data into knowledge A genome wide approach gives a broader result There are many tools and databases out there, this lecture only covers a selection Several ways to solve a problem find your own preference
39 Goals of the course After taking this course: you will know about the most commonly used bioinformatic databases have a better understanding of how they work know how to find and use genomic data and genome wide datasets, such as transcriptomes see how bioinformatics can be part of your own research projects
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES
More informationAnnotation. (Chapter 8)
Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store
More informationRetrieval of gene information at NCBI
Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SGBC-SLU 2016 VALIDATION Experimental Literature Manual or semi-automatic computational analysis EXPERIMENTAL Costs Needs skilled manpower
More informationThe Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationImportant gene-information's
Sequences, domains and databases. How to gather information on a gene. Jens Bohnekamp, Institute for Biochemistry Important gene-information's Protein sequence Nucleotide sequence Gene structure Protein
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationDatabases/Resources on the web
Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org
More informationApplied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
More informationWeb-based Bioinformatics Applications in Proteomics
Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationFinal exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the
More informationPATHWAY ANALYSIS. Susan LM Coort, PhD Department of Bioinformatics, Maastricht University. PET course: Toxicogenomics
PATHWAY ANALYSIS Susan LM Coort, PhD Department of Bioinformatics, Maastricht University 1 Data analysis overview Microarray scans Slide based on a slide from J. Pennings, RIVM, NL Image analysis Preprocessing
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationA WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING
A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationBig picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
More informationGuided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationWeb based Bioinformatics Applications in Proteomics. Genbank
Web based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu February 9, 2010 Genbank Primary nucleic acid sequence database Maintained by NCBI National Center for Biotechnology
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationComputers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationSequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases
Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around
More informationIntroduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic
More informationThe RNA tools registry
university of copenhagen f a c u lt y o f h e a lt h a n d m e d i c a l s c i e n c e s The RNA tools registry A community effort to catalog RNA bioinformatics resources and their relationships Anne Wenzel
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationA White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment
A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment I. Abstract: The three- year SCan- MarK Explorer Phase I and II NCI Small Business Innovation Research (SBIR) Project
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationWhat You NEED to Know
What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM
More informationIntroduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
More information