Food Safety (Bio-)Informatics
|
|
- Blanche Paul
- 6 years ago
- Views:
Transcription
1 Food Safety (Bio-)Informatics Henk C. den Bakker Assistant Professor in Bioinformatics and Epidemiology Center for Food Safety University of Georgia
2 Overview Short introduction of Food Safety Informatics The digital immune system
3 Food Safety Informatics? The use of information and computer science to advance food safety A combination of different individual disciplines: Statistics Computer science Epidemiology Bioinformatics Using Big Data approaches, The Internet of Things
4 The rise of a digital immune system (DIS) Coined by David Lipman Further worked out by Michael Schatz and Adam Phillippy in 2012* Would work in much the same way as an adaptive, biological immune system: Observe the microbial landscape Detect potential threats Neutralize threads before they can cause widespread harm Distributed sensor sequencing and bioinformatics where a network of mobile sequencing devices serves a real-time stream of microbial genomes to a global compute cloud for analysis. *Schatz, M.C, & A. Phillippy GigaScience 1 (1): 4. doi: / x-1-4.
5 What is necessary for a digital immune system? A catalogue of microbial diversity, so we can tell the normal from the abnormal (a potential thread) Centralized (genome) databases, such as NCBI, EMBL and DDBJ Rapid bioinformatics tools to deal with the growing amount of (realtime) data sequencing devices (preferably inexpensive and portable) that can act as the sensors in a distributed, real-time sequencing network
6 The digital immune system
7 Applying the digital immune system to food safety: The GenomeTrakr project Project spear-headed by the FDA* GenomeTrakr is the first distributed network of labs to utilize whole genome sequencing for pathogen identification Consists of 15 federal labs, 25 state health and university labs, 1 U.S. hospital lab, 2 other labs located in the U.S., 20 labs located outside of the U.S., and collaborations with independent academic researchers. Data curation and bioinformatic analyses and support are provided by the National Center for Biotechnology Information (NCBI) at the National Institutes of Health The GenomeTrakr network has sequenced more than 167,000 isolates, and closed more than 175 genomes. The network is regularly sequencing over 5,000 isolates each month. *
8 The sensors and the network Illumina short read sequencers, in particular the MiSeq Generate genome sequences as short reads, typically >> 200,000 per bacterial genome
9 The sensors and the network
10 Using whole genome sequencing (WGS) data in outbreak investigations WGS data give unprecedented resolution Ability to use genomic changes that can help us to infer relatedness with strains in past and present (Single Nucleotide Polymorphisms). After ~ 2 years of using WGS for outbreak investigations*: aid in finding the food vehicle for cold cases and sporadic cases, as WGS can phylogenetically link isolates from human cases and food. Sequencing of both food product and patient derived isolates, outbreaks can be confirmed following product testing, allowing for an early association of an outbreak with a contaminated food. WGS can help in a rapid and precise outbreak case definition, and thus productively redirect epidemiological resources * Jackson et al Clin Infect Dis.;63(3):380-6
11 NCBI Pathogen detection
12 The database is growing
13 How close is the GenomeTrakr network to a digital immune system? Close, but far from real-time: Still dependent on classical microbiology to isolate pathogens, which adds days to weeks to the protocol Sequenchers are state of the art, but the sequencing procedure takes 2 to 3 days The increasing size of the database becomes prohibitively large for real-time searches
14 New sequencing technologies and (quasi- )metagenome sequencing Novel sequencing protocols that need either no or very limited steps for enrichment of target organisms Novel sequencing technologies e.g., Oxford Nanopore
15 The databases are getting larger and larger
16 Fortunately we can surf the Big Data wave Source:
17 A rediscovery of old data structures/algorithms Big Data is years ahead of the big increase in genomic data In an effort to speed up analyses and searches of genomic data, old data structures and algorithms are rediscovered and/or reimplemented: De Bruijn Graph (De Bruijn, 1946) genome assembly Bloom filter (Bloom, 1970) MinHash (Broder, 1997); efficient comparison of datasets
18 MinHash; comparing large datasets with smaller sketches Originally developed to compare large electronic documents (Broder, 1998) Summarizes documents as subsets (sketch) of a fixed size of their information, using a specific criterion to select the members of the subset Example: a sketch of a thousand words is approximately large enough to infer the similarity of a document with millions of words Translated to bacterial genomes, we can use the same strategy to divide genomes up in words (kmers) and use a MinHash approach to estimate the relatedness of these genomes Ondov, Brian D. et al Genome Biology 17 (1): 132.
19 BIGSI: Searching microbial big data BLAST has been the traditional search algorithm for genetic and genomic database centers such as NCBI (US), EBI (Europe). However the majority of genomic data (by now hundreds of thousands) are stored as un-assembled genomes, consisting of hundreds of thousands to millions of small reads BLAST is generally not fast enough to search these databases realtime
20 From Bloom filters to BIGSI By David Eppstein - self-made, originally for a talk at WADS 2007, Public Domain, Advantages: small storage for large sets of elements Fast search Disadvantage: False positives
21 BIGSI: extension of the bloom filter bitsliced genomic signature index (BIGSI) Allows for superfast search of big sequence data databases 3 antibiotic resistance genes (MCR-1, MCR-2, MCR3) could be searched in 1.73 seconds in a data-base of 447,833 viral and bacterial genomes. P. Bradley, H.C. den Bakker, E. Rocha, G. McVean, Z. Iqbal biorxiv ; doi:
22 Summary In food safety, the Genome Trackr network is the closest thing we have to a digital immune system In order to use this network to detect early threads we need further improvements: Improvement of sample preparation methods/culture free methods Sequenching technology (faster, easier, smaller) Bioinformatics These improvements are coming fast
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate
More informationChallenges and opportunities for whole genome sequencing based surveillance of antibiotic resistance
Challenges and opportunities for whole genome sequencing based surveillance of antibiotic resistance Prof. Willem van Schaik Professor in Microbiology and Infection Institute of Microbiology and Infection
More informationBioinformatics- Data Analysis
Bioinformatics- Data Analysis Erin H. Graf, PhD, D(ABMM) Infectious Disease Diagnostics Laboratory, Children s Hospital of Philadelphia Department of Pathology and Laboratory Medicine, University of Pennsylvania
More informationGMI: Global Microbial Identifier
GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge through the use of Whole Genome Sequencing (WGS) Jørgen Schlundt Professor Technical University of
More informationWhole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study
Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study Dr Edward Hayes Date: July 2016, Version 1 Foodborne Pathogens 280,000 cases of Campylobacter,
More informationWhole Genome Sequencing for TB diagnostics. Adam Witney. Institute for Infection and Immunity St George s, University of London
Whole Genome Sequencing for TB diagnostics Adam Witney Institute for Infection and Immunity St George s, University of London INSTITUTE FOR INFECTION & IMMUNITY WGS applications in TB diagnostics Resistance
More informationWhole Genome Sequence Data Quality Control and Validation
Whole Genome Sequence Data Quality Control and Validation GoSeqIt ApS / Ved Klædebo 9 / 2970 Hørsholm VAT No. DK37842524 / Phone +45 26 97 90 82 / Web: www.goseqit.com / mail: mail@goseqit.com Table of
More informationDeveloping Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and
More informationNext Generation Sequencing Applications in Food Safety and Quality
Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee
More informationThe Genomic Transformation of Health
The Genomic Transformation of Health or: an introduction to the potential of genomics in healthcare Dr Tom Connor School of Biosciences and Systems Immunity University Research Institute Cardiff University
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationUsing New ThiNGS on Small Things. Shane Byrne
Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion
More informationBioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance
Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Errol Strain, Ph.D. Chief, Biostatistics Branch FDA/OFVM/CFSAN/OAO/DPHIA 3/24/2014 Overview 1. Validation and Proficiency Testing
More informationAUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE
We provide: AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE State of the art genomics and bioinformatics analysis Training in experimental techniques, analysis and modelling
More informationFood Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH
Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH HTS Initiative's Palantir, May 30-31, 2018 Chicago Marriott
More informationSetting the Course: Virginia's experience navigating information technology and bioinformatics needs for whole genome sequencing
Setting the Course: Virginia's experience navigating information technology and bioinformatics needs for whole genome sequencing Lauren Turner, Ph.D. Virginia Division of Consolidated Laboratory Services
More informationCanada's IRIDA platform for genomic epidemiology. Gary Van Domselaar Chief, Bioinformatics National Microbiology Lab Public Health Agency of Canada
Canada's IRIDA platform for genomic epidemiology Gary Van Domselaar Chief, Bioinformatics National Microbiology Lab Public Health Agency of Canada Integrated Rapid Infectious Disease Analysis informatics
More informationGlobal outbreak of severe Mycobacterium chimaera disease after cardiac surgery: a molecular epidemiological study
Global outbreak of severe Mycobacterium chimaera disease after cardiac surgery: a molecular epidemiological study Jakko van Ingen et al www.thelancet.com/infection Vol 17 October 2017 Background Since
More informationNational Institute of Biology - NIB
National Institute of Biology - NIB NIB was established by the Republic of Slovenia as a public, non-profit research institute in 1960 and is today the leading research institution in biological sciences.
More informationDevelopment and Implementation of a Quality System for Next-Generation Sequencing
Development and Implementation of a Quality System for Next-Generation Sequencing Lauren Turner, PhD Lead Scientist Virginia Division of Consolidated Laboratory Services DCLS Phased Implementation of NGS
More informationNext generation sequencing in diagnostic laboratories: opportunities and challenges
Next generation sequencing in diagnostic laboratories: opportunities and challenges Vitali Sintchenko Marie Bashir Institute for Emerging Infectious Diseases & Biosecurity Declaration No conflict of interest
More informationIntroduction to Whole Genome Sequencing and its Applications in Microbial Diagnostics
Introduction to Whole Genome Sequencing and its Applications in Microbial Diagnostics Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Whole genome sequencing is currently revolutionising
More informationFUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS
FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationGenomics and its Impact on Diagnostic Microbiology
Genomics and its Impact on Diagnostic Microbiology Rick Holliman Lead Public Health Microbiologist for London Outline Where are we now? What is coming our way? How will things change? Where will we be?
More informationImplementation of genomics technologies in regulatory food microbiology testing
Implementation of genomics technologies in regulatory food microbiology testing Dr. Catherine Carrillo Canadian Food Inspection Agency 2011 Her Majesty the Queen in Right of Canada (Canadian Food Inspection
More informationFood Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH
Food Safety & High-Throughput Sequencing (HTS) What Does the Future Hold? Perspectives from the Industry, Governmental Agencies and Academia An IFSH HTS Initiative's Palantir, May 30-31, 2018 Chicago Marriott
More informationBioinformatics and computational tools
Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the
More informationFunctional profiling of metagenomic short reads: How complex are complex microbial communities?
Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationThe EMBL-Bioinformatics and Data-Intensive Informatics
The EMBL-Bioinformatics and Data-Intensive Informatics Graham Cameron EMBL-EBI What is the EMBL-EBI? Non-profit organization Part of the European Molecular Biology Laboratory Based on the Wellcome Trust
More informationExperimental Design Microbial Sequencing
Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing
More informationCBC Data Therapy. Metagenomics Discussion
CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian
Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics
More informationBioinformatics Sequence And Genome Analysis David W Mount
Bioinformatics Sequence And Genome Analysis David W Mount We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationLooking Ahead: Improving Workflows for SMRT Sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences
More informationWhat can whole genome sequencing do for you? Michael Deason
What can whole genome sequencing do for you? Michael Deason Unprecedented resolution Entirely new technological approach Increasingly inexpensive Obvious uses retain challenges of interpretation Are there
More informationUnlocking Genomic Diversity! without Assembly or Alignment!
Unlocking Genomic Diversity! without Assembly or Alignment!!! Borevitz Laboratory! Division of Plant Sciences and! Division of Ecology, Evolution and Genetics! Research School of Biology (RSB)! The Australian
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next Generation
More informationPathogenic organisms no thanks: Use of next generation sequencing techniques in risk assessment and HACCP
Pathogenic organisms no thanks: Use of next generation sequencing techniques in risk assessment and HACCP Lisbeth Truelstrup Hansen Professor Microbial Food Safety and Environmental Hygiene Mail: litr@food.dtu.dk
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationMachine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria
Machine Learning and Data Fusion Methods for Phenotype-based Threat Assessment of Unknown Bacteria Dr. Paul Sheehan Program Manager, BTO SBIR/STTR Industry Day DARPA Conference Center Arlington, VA August
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationProgramme Manager GROW Colombia JOB VACANCY
Programme Manager GROW Colombia JOB VACANCY Job details Salary: 39,150-47,850 Post No: 1003398 Contract length: 46 months Department: Organisms & Ecosystems Opening date: 22 January 2018 Closing date:
More informationBeef Industry Safety Summit Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX March 1-3
1 USDA, Food Safety and Inspection Service Beef Industry Safety Summit - 2016 Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX 78759 March 1-3 Uday Dessai MPH, MS, PhD Senior Public Health Advisor
More informationHybrid Error Correction and De Novo Assembly with Oxford Nanopore
Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Michael Schatz Jan 13, 2015 PAG Bioinformatics @mike_schatz / #PAGXXIII Oxford Nanopore MinION Thumb drive sized sequencer powered over
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationCENTER FOR BIOTECHNOLOGY
CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.
More information(Big) Data Analytics for strain and product development
(Big) Data Analytics for strain and product development Wynand Alkema Principal Scientist Data Analytics @NIZO Head of Bioinformatics @Nijmegen University 1 NIZO in short Independent, private contract
More informationVisit our Career Flowchart to get more information on some of these career paths.
Visit our Career Flowchart to get more information on some of these career paths. Academic Research Faculty: This career path consists of university or college professors who conduct research. They select
More informationAdvanced Technology in Phytoplasma Research
Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm
More informationMicrobial sequencing solutions
Microbial sequencing solutions Scalable, simple, fast TARGETED GENOME Sequencing f every lab, every budget, every application Ion Trent semiconduct sequencing Ion Trent technology has pioneered an entirely
More informationEURL WORKING GROUP ON WHOLE GENOME SEQUENCING AND PULSENET INTERNATIONAL
EURL WORKING GROUP ON WHOLE GENOME SEQUENCING AND PULSENET INTERNATIONAL EURL-Campylobacter workshop, 9/10-2018 Joakim Skarin, SVA Objectives of the WG-NGS To promote the use of NGS across the EURL networks
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationFrom classical molecular typing to WGS in a food safety context: WGS at EFSA
From classical molecular typing to WGS in a food safety context: WGS at EFSA Beatriz Guerra EURL-AR WGS Training, Copenhage, Denmark, 27.09.17 WGS FOR FOOD SAFETY AT EFSA Molecular Typing Recent Past:
More informationBiomedical Informatics in BIG DATA Era
Biomedical Informatics in BIG DATA Era Yang C. Fann, Ph.D. Director, Intramural IT and Bioinformatics Program National Institute of Neurological Disorders and Stroke Disclaimer The opinions or assertions
More information2014 APHL Next Generation Sequencing (NGS) Survey
APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and
More informationNew York State s experience with analyzing, interpreting, and sharing whole genome sequence data for surveillance of enteric organisms.
New York State s experience with analyzing, interpreting, and sharing whole genome sequence data for surveillance of enteric organisms. InForm 11/18/15 William Wolfgang, PhD Wadsworth Center, NYSDOH william.wolfgang@health.ny.gov
More informationIntroduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018
Introduction to NGS Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Life science data deluge Massive unstructured data from several areas DNA, patient journals,
More informationState strategies for bioinformatics in BRICs and the UK. Professor Brian Salter
State strategies for bioinformatics in BRICs and the UK Professor Brian Salter This new facility is the embodiment of our investment in big data and bioinformatics. We are not only ensuring that people
More informationCarl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life
METAGENOMICS Carl Woese Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationLecture 21. Microbiology & Metagenomics
Lecture 21. Microbiology & Metagenomics Michael Schatz April 16, 2018 JHU 600.749: Applied Comparative Genomics Part I: Introduction Microbial Taxonomy Towards a natural system of organisms: proposal for
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes Gene calling The simpliest thing is to look
More informationAntimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data
Antimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data PRIMES Research Report by: Andrew Zhang Mentor: Dr. Gil Alterovitz PRIMES Conference October
More informationProNNaC Whole Genome Sequencing. Staphylococcus aureus
ProNNaC Whole Genome Sequencing and Staphylococcus aureus NRL for Coagulase Positive Staphylococci including S.aureus Angelo Romano National Reference Laboratory for Coagulase Positive Staphylococci, including
More informationOverview of CIDT Challenges and Opportunities
Overview of CIDT Challenges and Opportunities Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 19 November 2015 National Center for Emerging and Zoonotic Infectious
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationRue Juliette Wytsmanstraat Brussels Belgium T F
Kevin Vanneste, PhD Bioinformatics Platform Platform Biotechnology and Molecular Biology Department Expertise, Service Provision and Customer Relations Collaboration between the EURL-VTEC and the Platform
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationWhole-Genome Sequencing (WGS) for Food Safety
Whole-Genome Sequencing (WGS) for Food Safety Errol Strain, Ph.D. Director, Biostatistics and Bioinformatics Staff Center for Food Safety and Applied Nutrition U.S. Food Drug Administration IFSH Meeting
More informationELIXIR: data for molecular biology and points of entry for marine scientists
ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More information10. BIOTECHNOLOGY (Code No. 045)
10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant
More informationQuestionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network
Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Massimo Palmarini MRC-University of Glasgow Centre for Virus
More informationMeet the iseq 100 System.
Meet your new lab partner our smallest, most accessible, and affordable next-generation sequencing (NGS) solution ever. Want deeper biological insights, better experimental efficiency, and greater discovery
More informationILSI Europe The European branch of the International Life Sciences Institute
ILSI Europe The European branch of the International Life Sciences Institute 1 Who we are Vision We build multi-stakeholder science-based solutions for a sustainable and healthier world. 2 What we do Mission
More informationFaramarz Valafar.
Faramarz Valafar faramarz@sciences.sdsu.edu http://informatics.sdsu.edu/ Biomedical Informatics Research Center (BMIRC) Office: GMCS 625 San Diego State University Molecular Diagnostics for Drug Resistant
More informationNew Lab Tech. Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory
New Lab Tech Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory WSLHA July 9, 2015 Usefulness Se/Sp Throughput Turnaround New Technologies MALDI TOF Next Generation Sequencing
More informationLecture 8: Predicting metagenomic composition from 16S survey data
Lecture 8: Predicting metagenomic composition from 16S survey data Taxonomic and functional stability of microbiota Nature. 2012; 486(7402): 207 214. doi:10.1038/nature11234 2 1 7/6/16 A model of functional
More informationMB 668 Microbial Bioinformatics and Genome Evolution. 4 credits Spring, 2017
MB 668 Microbial Bioinformatics and Genome Evolution 4 credits Spring, 2017 Instructors: T. Sharpton, R. Mueller and S. Giovannoni Thomas Sharpton (Microbiology): thomas.sharpton@oregonstate.edu Office
More informationAn Industrial Lab s Experience of NGS. Dr Greg Jones
An Industrial Lab s Experience of NGS Dr Greg Jones Campden BRI The partner of choice for the development and application of technical knowledge and commercially relevant solutions for the food and drink
More informationCarl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life
METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary
More informationFunctional annotation of metagenomes
Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:
More informationFRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis
FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries
More informationPractical Bioinformatics for Biologists (BIOS 441/641)
Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationAssembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k
Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data
More information