Introduction to BIOINFORMATICS

Size: px
Start display at page:

Download "Introduction to BIOINFORMATICS"

Transcription

1 Introduction to BIOINFORMATICS

2 Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel

3 What is Bioinformatics? The marriage between biology and informatics

4 What is Bioinformatics? Bioinformatics is a field which uses computers to store and analyze molecular biological information. Using this information in a digital format, bioinformatics can then solve problems of molecular biology.

5 Understanding nature s mute elegant language of living cells is the question of modern molecular biology. From an alphabet of only four letters representing the chemical subunits of DNA, emerges a syntax of life processes whose most complex expression is man. From the National Centre for Biotechnology Information (NCBI),

6

7 Information Complexity

8 Components of Bioinformatics

9 Factors that made bioinformatics so important Rapid and cheap techniques for DNA sequencing The development of powerful computers Internet and the Wide World Web

10 Bioinformatics has three principal components: The creation of databases allowing the storage and management of large biological data sets. The development of algorithms and statistics to determine relationships among members of large data sets. The use of these tools for the analysis and interpretation of various types of biological data, including DNA, RNA and protein sequences, protein structures, gene expression profiles, and biochemical pathways

11 Bioinformatic Developers They develop tools for bioinformatics Experts in Mathematics, Statistics and Informatics Computational biologists Bioinformatics Users They use the tools of bioinformatics Researchers (Biologists, Biotechnologist, )

12 2007 marked the 30th anniversary of the development of the 'dideoxy' sequencing methods of Fred Sanger and his colleagues at the MRC Laboratory of Molecular Biology in Cambridge, UK that formed the basis for automated DNA sequencing technology and which led to the establishment of human and many other genome sequences. Although other methods were also invented (notably that of Maxam/Gilbert), Sanger's methods have stood the test of time and it is only in recent years that newer DNA sequencing techniques have started to emerge as contenders. NAR 35 (2007), no.12

13 Sanger DNA analyzer can process: 96 samples a time 800 bp read lenght 1,6 Mbp/day Human Genome sequencing / = days!

14 2001: draft sequence of human genome 10 years + $3 bilions

15 Next generation sequencing High-throughput sequencing technologies that parallelize the sequencing process, producing thousands or millions of sequences at once. Metzker ML Sequencing technologies - the next generation. Nat Rev Genet. 11(1):31-46.

16 2008: DNA sequence of a diploid genome of a single individual, James D. Watson, in two months using massively parallel sequencing and spending $ !

17

18

19

20

21 For individuals, the new price will be $19,500, while groups of five or more customers using the same ordering physician will pay $14,500 per person. In addition, individuals with serious medical conditions for whom whole-genome sequencing could be of clinical value will pay $9,500 to have their genome sequenced. (June 2010)

22 Drew Sheneman, New Jersey -- The Newark Star Ledger

23 Speed in the capability of Data production Data interpretation

24 Bioinformatics application areas BEFORE THE GENOMIC REVOLUTION Creation and maintenance of databases to store biological information, such as nucleotide and amino acid sequences. Development of complex interfaces whereby researchers could both access existing data as well as submit new or revised data.

25 Bioinformatics application areas AFTER THE GENOMIC REVOLUTION Analysis and interpretation of various types of data, including nucleotide and amino acid sequences, protein domains, and protein structures. The actual process of analyzing and interpreting data is referred to as computational biology.

26 development and implementation of tools that enable efficient access to, and use and management of, various types of information. development of new algorithms (mathematical formulas) and statistics with which to assess relationships among members of large data sets, such as methods to locate a gene within a sequence, predict protein structure and/or function, and cluster protein sequences into families of related sequences

27 Sequence analysis Genome annotation Literature analysis Analysis of gene expression Analysis of regulation Analysis of protein expression Analysis of mutations in cancer Comparative genomics Computational evolutionary biology Modeling biological systems High-throughput image analysis

28 Bioinformatics challenges Biological redundancy and multiplicity Different sequences with similar structures Organism with similar genes Multiple functions of similar genes Grouping of genes in pathways Sequence redundancy in genomes Significance of relationships and similarities Signal vs Noise Lack of data

29 What is database?

30

31 Database is a collection of data that has a regular structure and is organized in such a way that a computer can easily find and retrieve information.

32

33 Redundancy - Errors

34 Relational databases Data are stored in tables with rows and columns. Each table is composed of records and each record is identified by a field (attribute) containing a unique value.

35 Table Row = Record Column = Field that describe each record

36 Relational databases Every table shares at least one field with another table in 'one to one,' 'one to many,' or 'many to many' relationships.

37 These relationships allow the database user to access the data in almost an unlimited number of ways, and to combine the tables as building blocks to create complex and very large databases.

38 A database management system (DBMS) such as Access, FileMaker, Oracle or SQL Server provides the software tools needeed to organize that data in a flexible manner. It includes tools to add, modify or delete data from the database, ask questions (or queries) about the data stored in the database and produce reports summarizing selected contents.

39 1965 First idea of molecular database M. Dayhoff et al. published Atlas of Protein Sequences and Strucures

40 When does DNA sequence collection start? 1982 EMBL - Heidelberg 1983 GenBank USA 1984 DDBJ - Japan

41 Sites where the integration among and between databases is developed USA NCBI (National Center for Biotechnology Information) Europe EBI (European Bioinformatics Institute,Hinxton, UK) Japan NIG (National Institute of Genetics)

42 1988: The International Sequence Database Collaboration Entrez Submissions Updates CIB NCBI GenBank DDBJ EMBL EBI Submissions Updates Submissions Updates SRS Getentry

43

44

45

46

47 NCBI (National Center for Biotechnology Information) Bethesda,Maryland

48 The National Center for Biotechnology Information (NCBI) Created as a part of the National Library of Medicine in 1988 Establish public databases Research in computational biology Develop software tools for sequence analysis Disseminate biomedical information Tools: BLAST(1990), Entrez (1992) GenBank (1992) Free MEDLINE (PubMed, 1997) Other databases: dbest, dbgss, dbsts, MMDB, OMIM, UniGene, GeneMap, Taxonomy, CGAP, SAGE, Gene, RefSeq

49 Data Resources at NCBI Databases: Primary and Derivative Primary Databases Archival submissions of experimental results Database staff organize but don t add additional information Genbank dbest dbsnp Probe Derivative Databases Curated/expert review Computationally derived Combinations Refseq Genomes UniGene UniSTS Homologene

50 Biological complexity COMPLEXITY Ecological processes & populations Tissue & organism physiology Cellular & developmental processes Biochemical pathways & processes Complete genomes Genes, Proteins, RNA. Introduction to Bioinformatics:

51 Database Retrieval Sequencing Project Management Restriction Mapping DNA/RNA Folding Seeking Coding regions Translation to amino acids Protein Sequence analysis Nucleic Acid Sequences Database Retrieval Protein Sequences Pair wise Sequence Comparison Nucleic Acid Sequence Analysis Database Similarity Searching Multiple Sequence Alignment Prediction of Function Phylogeny Motifs and Patterns Structure prediction Structure analysis

52

53

54

55

56 Databases connections

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part

This software/database/presentation is a United States Government Work under the terms of the United States Copyright Act. It was written as part This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

Deakin Research Online

Deakin Research Online Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

More information

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab Bioinformatics Lab ACTIVITY AT A GLANCE "Understanding nature's mute but elegant language of living cells is the quest of modern molecular biology. From an alphabet of only four letters representing the

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

SECTION ONE Introduction and Biological Databases

SECTION ONE Introduction and Biological Databases SECTION ONE Introduction and Biological Databases CHAPTER ONE Introduction Quantitation and quantitative tools are indispensable in modern biology. Most biological research involves application of some

More information

Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges

Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges Opinion TheScientificWorldJOURNAL (2009) 9, 420 423 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2009.57 Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

(Very) Basic Molecular Biology

(Very) Basic Molecular Biology (Very) Basic Molecular Biology (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix DNA molecule (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

A New Database of Genetic and. Molecular Pathways. Minoru Kanehisa. sequencing projects have been. Mbp) and for several bacteria including

A New Database of Genetic and. Molecular Pathways. Minoru Kanehisa. sequencing projects have been. Mbp) and for several bacteria including Toward Pathway Engineering: A New Database of Genetic and Molecular Pathways Minoru Kanehisa Institute for Chemical Research, Kyoto University From Genome Sequences to Functions The Human Genome Project

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic

More information

Introduction on Several Popular Nucleic Acids Databases

Introduction on Several Popular Nucleic Acids Databases Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological

More information

Bioinformatics Databases

Bioinformatics Databases Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Entrez Gene: gene-centered information at NCBI

Entrez Gene: gene-centered information at NCBI D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National

More information

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

What You NEED to Know

What You NEED to Know What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching!

What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching! What I hope you ll learn Introduction to NCBI & Ensembl tools including BLAST and database searching What do we learn from database searching and sequence alignments What tools are available at NCBI What

More information

Proteomics: New Discipline, New Resources. Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY

Proteomics: New Discipline, New Resources. Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY Proteomics: New Discipline, New Resources Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY What is Proteomics? Systematic analysis of protein expression of normal and diseased tissues that involves

More information

Computational Genomics ( )

Computational Genomics ( ) Computational Genomics (0382.3102) http://www.cs.tau.ac.il/ bchor/comp-genom.html Prof. Benny Chor benny@cs.tau.ac.il Tel-Aviv University Fall Semester, 2002-2003 c Benny Chor p.1 AdministraTrivia Students

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in

More information

DNA Sequence Alignment based on Bioinformatics

DNA Sequence Alignment based on Bioinformatics DNA Sequence Alignment based on Bioinformatics Shivani Sharma, Amardeep singh Computer Engineering,Punjabi University,Patiala,India Email: Shivanisharma89@hotmail.com Abstract: DNA Sequence alignmentis

More information

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized 1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio

More information

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Textbook. Web sites. Literature references

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Textbook. Web sites. Literature references Introduction to Bioinformatics Who is taking this course? People with very diverse backgrounds in biology Some people with backgrounds in computer science and biostatistics Most people (will) have a favorite

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Klinisk kemisk diagnostik BIOINFORMATICS

Klinisk kemisk diagnostik BIOINFORMATICS Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,

More information

Clinical and Translational Bioinformatics

Clinical and Translational Bioinformatics Clinical and Translational Bioinformatics An Overview Jussi Paananen Institute of Biomedicine September 4 th, 2015 Bioinformatics Bioinformatics combines statistics, computer science and information technology

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement

More information

Examination Assignments

Examination Assignments Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007 Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information