Wheat pre-breeding at NIAB: from germplasm to genomics. Alison Bentley
|
|
- Matilda Skinner
- 5 years ago
- Views:
Transcription
1 Wheat pre-breeding at NIAB: from germplasm to genomics Alison Bentley
2 NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC
3 NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC
4 Flowering time Why flowering time? Central to adaptation Early flowering varieties yield higher in hot, dry environments Climate change likely to effect areas with late season heat/drought stress Late flowering varieties perform well in environments with long growing seasons % Yield Change -1.8% +7.7% +33.0% Long Growing Season Short Growing Season
5 Photoperiod kb Genome coding region Ppd allele Allele donor Characteristic D Ppd - D1.e1 Ciano67/Soissons Early flowering A Ppd - A1.e1 Durum wheat Early flowering A B B Transposon Transposon Ppd - A1.e2 Ppd - B1.e1 Ppd - B1.e2 Durum wheat Recital Chinese Spring Early flowering Early flowering Early flowering B Transposon Ppd - B1.e3 Timstein Early flowering A ppd - A1.e1 Transposon D ppd - D1.4 D ppd - D1.5 Cappelle - Desprez Mercia Norstar Null allele? Neutral allele? Null allele? D ppd-d1.1 Synthetic wheat True wild - type allele Key: Deletion SNP
6 Understanding photoperiod response Bentley et al. (2011) Plant Breeding 130: Bentley et al. (2013) Journal of Experimental Botany 64:
7 Understanding photoperiod response Temp Treatment (Day) Temp (Night) Water T1_D1 18 C 15 C Field capacity T1_D2 18 C 15 C 50% F capacity T2_D1 23 C 18 C Field capacity T2_D2 23 C 18 C 50% F capacity
8 Understanding photoperiod response FT Ppd-A1a>Ppd-D1a>Ppd-B1a YLD Ppd-A1(0.06)>Ppd-D1(-0.53)>Ppd-B1(-1.97) FT Ppd-D1a>Ppd-A1a>Ppd-B1a YLD Ppd-B1(0.42)>Ppd-D1(0.21)>Ppd-A1(0.08) FT Ppd-A1a>Ppd-D1a>Ppd-B1a YLD Ppd-D1(2.72)>Ppd-B1(0.02)>Ppd-A1(-0.42) FT Ppd-D1a>Ppd-A1a>Ppd-B1a YLD Ppd-D1(1.89)>Ppd-B1(0.52)>Ppd-A1(0.18)
9 New understanding of photoperiod response? Ppd-D1a vs Ppd-D1b activate repress Pearce et al. BMC Plant Biology 2014, 14:368
10 NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC
11 Pre-breeding with CIMMYT synthetics 50 CIMMYT SHWs from ~440 crossed to Xi-19 and Paragon
12 NIAB re-synthesis and pre-breeding - WISP 1. Tetraploid diversity T. dicoccoides T. dicoccum T. durum 2. Novel diversity Ae. tauschii
13 Durum Ae. tauschii (AA, BB) x (DD) F 1 (ABD) Synthetic wheat (AA, BB, DD) Chromosome doubling NIAB Breeder s Toolkit Toolkit
14 KASP (LGC Genomics) ~7,000 SNPs iselect (Illumina) ~81,000 SNPs Axiom (Affymetrix) ~820,000 SNPs Winfield et al. (in press) Plant Biotechnology Journal
15 Days to GS Frequency Characterising Ae. tauschii diversity Number of tillers Ppd-D1 allele
16 Pre-breeding with NIAB synthetics Systematic crossing to Robigus (winter) and Paragon (spring). Development of 10,000 BC 1 F 5 pre-breeding lines (unselected). NAM analysis tools in development. Early generation selections/bulks available via the NIAB Breeder s Toolkit.
17 Developing Chromosome Segments Substitution Lines NIAB SHW-041 (Ent336) x Paragon WINTER 2012 F 1 x Paragon 1D 192 BC 1 F 1 Whole genome KASP; MAS 27 BC 1 F 1 27 BC 1 F 1 x Paragon 192 BC 2 F 1 Whole genome KASP; MAS 34 BC 2 F 1 34 BC 2 F 1 x Paragon 192 BC 3 F 1 Whole genome KASP; MAS 44 BC 3 F 1 44 BC 3 F 1 x Paragon BC 4 F 1 Genotyping; selfing SUMMER 2016 BC 4 F 3
18 NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC
19 MAGIC Multi-parent Advanced Generation InterCross complete pedigree
20 Frequency Mackay et al. (2014) G3 4: MAGIC line means Parent 2 Robigus Parent 1 Hereward Line/SNP 2A_SNP 3A_SNP 1A_SNP Alchemy R S S Brompton S S S Claire R S S Hereward S S R Rialto S R S Robigus S S S Soissons S S R Xi19 S R S MEL_1 R R R MEL_2 R R R Resistant progeny Marker BLUP (log2) Estimated effect 2D A A
21 Mapping Fusarium Head Blight (FHB) resistance
22
23 Variation in ear morphology: mapping in MAGIC Volume Surface area Internal density Relative position National Plant Phenomics Centre (Callum Scotson)
24 Generating the NIAB 8-way MAGIC map Gardner, Wittern and Mackay (submitted) A highly recombined, high-density, eight founder wheat MAGIC map reveals extensive segregation distortion and genomic locations of introgression segments.
25 Generating the NIAB 8-way MAGIC map Stringent error control on 90K iselect data, minimise amount of missing data Variable markers in MAGIC (MAGIC captures 81% of markers variable in UK wheat) Markers available for mapping Mapping 1. Recombination fractions calculated for co-dominant markers mpmap 2. Markers clustered into 300 groups using hierarchical clustering groups interactively combined to form 21 linkage groups 4. Linkage groups assigned to 21 chromosomes based on BLAST hits (IWGSC1), POPSEQ data(iwgsc2), 90k Consensus map (Wang et al 2014), MAGIC 9k map, Bristol deletion bins, Genome Zipper data 5. Chromosomes ordered interactively in mpmap 6. Unmapped dominant markers and markers previously dropped assigned to chromosomes by mapping them as traits. If mapped with log 10 P >16, then added to map on chromosome by chromosome basis, followed by reordering
26
27 3B physical vs genetic map distance
28 MAGIC QTL mapping - Awns
29 chisquare density per 10cM New opportunity to examine aspects of underlying genetic structure of UK wheat gene pool: blocks of markers detect known and unknown introgressions. These make mapping hard but their subsequent phenotypic characterisation and tagging in UK germplasm is easy. 800 Marker_density Segregation_distortion A 1B 1D 2A 2B 2D 3A 3B 3D 4A 4B 4D 5A 5B 5D 6A 6B 6D 7A 7B 7D
30 chisquare density per 10cM 800 Marker_density Segregation_distortion A 1B 1D 2A 2B 2D 3A 3B 3D 4A 4B 4D 5A 5B 5D 6A 6B 6D 7A 7B 7D
31 Investigating interspecific introgressions Robigus Important component of pedigrees in NW Europe Used to improve yield, OBM*, Septoria*, mildew, brown rust Pedigree thought to contain Triticum dicoccoides (wild emmer) Locations of introgressed fragments in Robigus (and its descendents) unknown Investigate Bristol University 820K Axiom array database ( Winfield et al. (2015) PBJ in press 17 known Robigus pedigree lines, 69 non-robigus pedigree lines 678 perfect Robigus markers assignable to chromosome
32 block size (number of markers) block size (number of markers) Investigating interspecific introgressions Perfect Robigus markers blocks (>1 marker) ordered by length Perfect Robigus markers blocks (>1 marker) ordered by length MAGIC 4AL SD linkage block (SD against Robigus allele) 23% of perfect Robigus markers in 820K dataset Perfect fit to biggest perfect Robigus linkage block 3x bigger than next largest block Also in Glasgow (contains T. dicoccoides) Matches all predictions of interspecific introgression fragment Instant MAGIC NILs
33 Gatsby
34 NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC
35 Association mapping European winter wheat Traits scored include: Yield Flowering time (GS55) Height Awns Ears/m 2 Tillering Establishment Winter kill Lodging Maturity Specific weight Thousand grain weight Grain protein content Callow, UK * * Arvalis, France Cambridge, UK * * Rosenthal, Germany
36 Association mapping European winter wheat FLOWERING TIME Ppd-D1a DArT Biogemma SNP DArT = 1,235 GbS = 108,871 Bentley et al. (2014) Theoretical and Applied Genetics 127:
37 Marco Scutari University of Oxford
38 Mackay et al. (2015) Food & Energy Security 4: 25-35
39 NIAB pre-breeding team Richard Horsnell Ahmad Shekhmous Tobias Barber Gemma Rose Phil Howell Fiona Leigh NIAB Trait Genetics Ian Mackay Keith Gardner Lukas Wittern (BBSRC/Cambridge/Bayer CropScience) Flowering time JIC (Dave Laurie, Adrian Turner) National Plant Phenomics Centre Anyela Carmargo-Rodriguez Re-synthesis CIMMYT University of Hohenheim WISP partners MAGIC Franziska Fischer/Marie Gantet (FHB) Funmi Ladejobi (Yield components) CSIRO (Rohan Shah/Emma Huang) Association mapping/gs TriticeaeGenome consortium Marco Scutari (Oxford) John Hickey (Roslin) Gregor Gorjanic (Roslin)
Plant Science into Practice: the Pre-Breeding Revolution
Plant Science into Practice: the Pre-Breeding Revolution Alison Bentley, Ian Mackay, Richard Horsnell, Phil Howell & Emma Wallington @AlisonRBentley NIAB is active at every point of the crop improvement
More informationMAGIC wheat Multi-parent populations for the genetic dissection of agronomic traits
MAGIC wheat Multi-parent populations for the genetic dissection of agronomic traits Alison Bentley, R Horsnell, P Howell, N Gosman, R Howells, G Rose, T Barber, J Cockram, A Greenland and I Mackay The
More informationIdentifying and exploiting natural variation
Identifying and exploiting natural variation New methods of fine mapping: association mapping MAGIC Methods for increasing diversity: synthetic wheat Advantages of new methods for fine mapping More efficient
More informationDesigning Future Wheat A coordinated UK wheat programme
Designing Future Wheat A coordinated UK wheat programme The emergence of modern wheat has left a trail of untapped variation for UK agriculture Modern varieties Artificial selection Wild relatives Triticum
More informationImproving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research
More informationDurum Wheat Genomics and Breeding EWG Annual report and action plan
Coordinating global research for wheat Durum Wheat Genomics and Breeding EWG Annual report and action plan NAME OF EXPERT WORKING GROUP EWG on DURUM WHEAT GENOMICS AND BREEDING LEADERSHIP & AUTHORSHIP
More informationAssociation Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
More informationInternational. Wheat Innovation Workshop
International 16 th - 17 th November 2015 Clermont-Ferrand, France Wheat Innovation Workshop Phenotyping for biomass potential, nutrient use efficiency and pest and pathogen resistance within the WISP
More informationSynthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB
an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,
More informationThe Interaction of Nitrogen with Yield in Wheat
The Interaction of Nitrogen with Yield in Wheat Peter Werner, Claire Fremann, Guillaume Barral-Baron KWS UK Ltd Bill Thomas, Allan Booth, Luke Ramsay JHI SP1 Improving Nitrogen Use Efficiency In Wheat
More informationUnderstanding yield potential and bread making quality in bread wheat. Simon Griffiths Crop Genetics John Innes Centre
Understanding yield potential and bread making quality in bread wheat Simon Griffiths Crop Genetics John Innes Centre The evolution of GRAIN yield and quality in wheat Ancient ield and quality alleles
More informationFHB Resistance in Durum -Progress and Challenge
FHB Resistance in Durum -Progress and Challenge Elias Elias, Shahryar Kianian, Shaobin Zhong, and Xiwen Cai North Dakota State University, Fargo, ND Steven Xu USDA-ARS, Fargo, ND Outline Sources of resistance
More informationWheat Chromosome Engineering and Breeding Jianli Chen
Wheat Chromosome Engineering and Breeding Jianli Chen Chromosome Engineering A process to transfer favorable alleles through inter-specific hybridization and interchange of chromatin using aneupolids Aneuploids?
More informationUK drought: WGIN Stakeholders Meeting. Clare Lister and Simon Griffiths 30/11/2017
UK drought: why we need DT wheat! WGIN Stakeholders Meeting Clare Lister and Simon Griffiths 30/11/2017 UK drought: why we need DT wheat! WGIN Stakeholders Meeting Clare Lister and Simon Griffiths 30/11/2017
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationDissecting the genetic basis of grain size in sorghum. Yongfu Tao DO NOT COPY. Postdoctoral Research Fellow
Dissecting the genetic basis of grain size in sorghum Yongfu Tao Postdoctoral Research Fellow Why study grain size? The importance of grain size: Key yield component Key quality issue for grain growers
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationTraits and technologies to design crop breeding systems for climate change
Genotype Breeding method Spectral signature Phenotype (yield) Environment Stress pattern Traits and technologies to design crop breeding systems for climate change SC Chapman1, MF Dreccer1, K Chenu2, D
More informationMolecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationGenomic Selection: A Step Change in Plant Breeding. Mark E. Sorrells
Genomic Selection: A Step Change in Plant Breeding Mark E. Sorrells People who contributed to research in this presentation Jean-Luc Jannink USDA/ARS, Cornell University Elliot Heffner Pioneer Hi-Bred
More informationUniversity of Bristol - Explore Bristol Research
Allen, A. M., Winfield, M. O., Burridge, A. J., Downie, R. C., Benbow, H. L., Barker, G. L. A.,... Edwards, K. J. (2017). Characterisation of a Wheat Breeders Array suitable for high throughput SNP genotyping
More informationModule 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
More informationA high density GBS map of bread wheat and its application for genetic improvement of the crop
A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement
More informationPublic-Private Partnership in Pre-Breeding
Public-Private Partnership in Pre-Breeding Combining Knowledge from Field and Laboratory for Pre-Breeding in Barley Ahmed Jahoor and Therese Bengtsson PPP barley field trial, Iceland 2012. Photo: Magnus
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population
More informationAlphaSim software for
AlphaSim software for simulating plant and animal breeding programs www.alphagenes.roslin.ed.ac.uk Serap Gonen*, Mara Battagin, Diarmaid de Burca, Chris Gaynor, Janez Jenko, David L Wilson, Anne- Michelle
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationDie Marktplatzpyramide in Karlsruhe. Pyramiding of target alleles PhD students Summer Seminar 2014 Wolfgang Link
Die Marktplatzpyramide in Karlsruhe Pyramiding of target alleles PhD students Summer Seminar 2014 Wolfgang Link 1 Genomic selection is revolutionizing both animal and plant breeding Genomic selection in
More informationHigh density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR Nils Stein, Joel Kuon, Uwe Scholz, Martin Mascher, Benjamin Kilian, Kerstin Neumann,
More informationlatestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe
Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina
More informationIdentifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s)
USDA-ARS/ U.S. Wheat and Barley Scab Initiative Due date: July 28, 2017 Cover Page Principle Investigator (PI): Brian Steffenson Institution: University of Minnesota E-mail: bsteffen@umn.edu Phone: 612-325-4735
More informationEnhancing diversity in UK wheat through a public sector pre-breeding programme
Enhancing diversity in UK wheat through a public sector pre-breeding programme Part 1A Previous research track record This proposal brings together internationally renowned experts in wheat research with
More informationImproving yield and quality traits of durum wheat by introgressing chromosome segments from hexaploid wheat
Improving yield and quality traits of durum wheat by introgressing chromosome segments from hexaploid wheat J. Ma 1,3 *, C.Y. Zhang 2 *, G.J. Yan 2,3 and C.J. Liu 1,2,3 1 Plant Industry, CSIRO, Brisbane,
More informationFunded by the Overseas Development Administration (ODA)
Centre for Arid Zones Studies, University of Wales, UK Cambridge Laboratory, Norwich, UK ICRISAT, India Funded by the Overseas Development Administration (ODA) Early papers on QTL mapping Staple food crop
More informationClimate change: Can wheat beat the heat? The future of wheat breeding in Europe
Climate change: Can wheat beat the heat? The future of wheat breeding in Europe Dr. Richard Summers Cereal Breeding Lead RAGT 2n (Vice Chairman British Society of Plant Breeders NIAB Board Member) Rouergue
More informationGene Discovery For UK Wheat Farming. Luzie Wingen, Simon Griffiths WGIN Stakeholder Meeting RRes 22 nd November 2011
Gene Discovery For UK Wheat Farming Luzie Wingen, Simon Griffiths WGIN Stakeholder Meeting RRes 22 nd November 2011 Overview Long term challenges to UK wheat farming The potential contribution of genetics
More informationPotential of human genome sequencing. Paul Pharoah Reader in Cancer Epidemiology University of Cambridge
Potential of human genome sequencing Paul Pharoah Reader in Cancer Epidemiology University of Cambridge Key considerations Strength of association Exposure Genetic model Outcome Quantitative trait Binary
More informationUSWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
More informationNutrient use efficiency in wheat What are the challenges?
Rothamsted Research where knowledge grows Nutrient use efficiency in wheat What are the challenges? Malcolm J. Hawkesford Crop Science Workshop, May, 2014 Outline: some NUE challenges? Yield and NUE Link
More informationA. COVER PAGE. Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%), and Marcelo Soria (20%).
A. COVER PAGE PROJECT TITLE Development of wheat varieties for California 2017-2018 PRINCIPAL INVESTIGATOR Jorge Dubcovsky OTHER INVESTIGATORS Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%),
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More informationQuestion. In the last 100 years. What is Feed Efficiency? Genetics of Feed Efficiency and Applications for the Dairy Industry
Question Genetics of Feed Efficiency and Applications for the Dairy Industry Can we increase milk yield while decreasing feed cost? If so, how can we accomplish this? Stephanie McKay University of Vermont
More informationThe international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
More informationConstruction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.)
Gali et al. BMC Plant Biology (2018) 18:172 https://doi.org/10.1186/s12870-018-1368-4 RESEARCH ARTICLE Open Access Construction of high-density linkage maps for mapping quantitative trait loci for multiple
More informationConstruction of dense linkage maps on the fly using early generation wheat breeding populations
DOI 10.1007/s11032-014-0116-1 Construction of dense linkage maps on the fly using early generation wheat breeding populations J. T. Eckard J. L. Gonzalez-Hernandez S. Chao P. St Amand G. Bai Received:
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationGenetic base broadening for cereals: problems and goals. Vytautas Ruzgas Lithuanian Institute of Agriculture
Genetic base broadening for cereals: problems and goals Vytautas Ruzgas Lithuanian Institute of Agriculture The main reason why we should think about genetic base broadening The majority of top varieties
More informationEvolutionary breeding in wheat for low input systems
Evolutionary breeding in wheat for low input systems Martin S. Wolfe*, Kay Hinchsliffe*, Sarah M. Clarke*, Hannah Jones*, Zoë Haigh*, John Snape** and Lesley Fish** * Elm Farm Research Centre, ** John
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Guihua Bai Institution: USDA-ARS E-mail: gbai@ksu.edu Phone:
More informationAn Integrated Approach To Stabilising HFN In Wheat: Screens, Genes And Understanding = HFN LINK. Peter Jack, RAGT
An Integrated Approach To Stabilising HFN In Wheat: Screens, Genes And Understanding = HFN LINK Peter Jack, RAGT HFN LINK Presentation Project overview & Industry Role Peter Jack (RAGT) WP1 Analysis of
More informationBreeding Climate-Smart Cowpeas for West Africa
Breeding Climate-Smart Cowpeas for West Africa Phil Roberts University of California Riverside, USA Tim Close, Bao-Lam Huynh, Stefano Lonardi Maria Munoz-Amatriain, Steve Wanamaker UC Riverside Issa Drabo
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationHigh-density SNP Genotyping Analysis of Broiler Breeding Lines
Animal Industry Report AS 653 ASL R2219 2007 High-density SNP Genotyping Analysis of Broiler Breeding Lines Abebe T. Hassen Jack C.M. Dekkers Susan J. Lamont Rohan L. Fernando Santiago Avendano Aviagen
More informationCurrent Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding Hermann Buerstmayr, Barbara Steiner, Marc Lemmens BOKU-University of Natural Resources
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationStrength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals
Strength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals Brian J. Steffenson Department of Plant Pathology University of Minnesota St. Paul 42 nd Barley Improvement Conference
More informationDESIGNS FOR QTL DETECTION IN LIVESTOCK AND THEIR IMPLICATIONS FOR MAS
DESIGNS FOR QTL DETECTION IN LIVESTOCK AND THEIR IMPLICATIONS FOR MAS D.J de Koning, J.C.M. Dekkers & C.S. Haley Roslin Institute, Roslin, EH25 9PS, United Kingdom, DJ.deKoning@BBSRC.ac.uk Iowa State University,
More informationUsing many genes for selection and cross prediction in plant breeding
Using many genes for selection and cross prediction in plant breeding Howard Eagles Karen Cane Russell Eastwood Gil Hollamby Haydn Kuchel Meiqin Lu Peter Martin Peter Sharp Neil Vallance Marie Appelbee
More informationApplication of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato
More informationGDMS Templates Documentation GDMS Templates Release 1.0
GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..
More informationQTL Mapping, MAS, and Genomic Selection
QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State
More informationWGIN Management Meeting 6 th November University of Nottingham. Draft Minutes
WGIN Management Meeting 6 th November 2012 @ University of Nottingham Draft Minutes Attendees:- Peter Shewry, Kim Hammond-Kosack, Malcolm Hawkesford, Simon Griffiths, John Foulkes, Cathy Mumford, Matt
More informationAssociation genetics in barley
Association genetics in barley Ildikó Karsai, Hungarian Academy of Sciences, Martonvásár, Hungary Frank Ordon, Dragan Perovic, Julius Kühn Institute, Quedlinburg, Germany Günther Schweizer, Bianca Büttner,
More informationUse of Doubled Haploids in the Context of Genetic Resource Exploitation in Maize
Use of Doubled Haploids in the Context of Genetic Resource Exploitation in Maize Thomas Lübberstedt Iowa State University, 1204 Agronomy Hall, Ames, IA, 50010, THOMASL@iastate.edu http://www.plantbreeding.iastate.edu/dhf/dhf.htm
More informationLecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013
Lecture 2: Height in Plants, Animals, and Humans Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Is height a polygenic trait? http://en.wikipedia.org/wiki/gregor_mendel Case Study
More informationBrassica carinata crop improvement & molecular tools for improving crop performance
Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationBackcross Breeding Usually associated with improving cultivar of self- pollinated species or an inbred
Backcross Breeding The hybrid and the progenies in the subsequent generations are repeatedly backcrossed to one of the original parents used in the cross The objective of backcrosses method is to improve
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationINVESTIGATORS: Chris Mundt, Botany and Plant Pathology, OSU C. James Peterson, Crop and Soil Science, OSU
STEEP PROGRESS REPORT RESEARCH PROJECT TITLE: Improving genetic resistance to Cephalosporium stripe of wheat through field screening and molecular mapping with novel genetic stocks INVESTIGATORS: Chris
More informationGlu-1 AND Glu-3 ALLELIC VARIABILITY OF GENUS Triticum GENETIC RESOURCES IN WHEAT BREEDING
Glu-1 AND Glu-3 ALLELIC VARIABILITY OF GENUS Triticum GENETIC RESOURCES IN WHEAT BREEDING D. OBREHT, M. DAVIDOVIC, Lj. VAPA University of Novi Sad, Faculty of Natural Sciences and Mathematics, 21000 Novi
More informationDiscovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.
Application note GAPP-0001 Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.) Keith J. Edwards, University of Bristol,
More informationModeling and simulation of plant breeding with applications in wheat and maize
The China - EU Workshop on Phenotypic Profiling and Technology Transfer on Crop Breeding, Barcelona, Spain, 17-21 September 2012 Modeling and simulation of plant breeding with applications in wheat and
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationGenotype and Growth Stage Effects on Heat Stress Susceptibility in Wheat
Genotype and Growth Stage Effects on Heat Stress Susceptibility in Wheat Henry M Barber Monogram 2016 Twitter: @henrybarber h.m.barber@pgr.reading.ac.uk Heat Stress Grain set failure in field grown UK
More informationSupplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationFinal Project Summary
Project title PhD: Understanding the genetics of wheat yield to deploy high and stable yielding wheat varieties across UK environments Project number 211130023 Final Project Report SR45 Start date Oct
More informationSAMPLE MIDTERM QUESTIONS (Prof. Schoen s lectures) Use the information below to answer the next two questions:
SAMPLE MIDTERM QUESTIONS (Prof. Schoen s lectures) Use the information below to answer the next two questions: Assume that high blood pressure is inherited as an autosomal dominant trait. You genotype
More informationDevelopment of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward
Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward Marcelo J. Carena Department of Plant Sciences, North Dakota State University (NDSU) I am
More informationExperimental Design and Sample Size Requirement for QTL Mapping
Experimental Design and Sample Size Requirement for QTL Mapping Zhao-Bang Zeng Bioinformatics Research Center Departments of Statistics and Genetics North Carolina State University zeng@stat.ncsu.edu 1
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationTrudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.
Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationPlant breeding programs producing inbred lines have two
Published August 3, 2017 RESEARCH A Two-Part Strategy for Using Genomic Selection to Develop Inbred Lines R. Chris Gaynor, Gregor Gorjanc, Alison R. Bentley, Eric S. Ober, Phil Howell, Robert Jackson,
More informationChapter 32 Enlargement of the Genetic Diversity for Grain Quality in Bread Wheat Through Alien Introgression
Chapter 32 Enlargement of the Genetic Diversity for Grain Quality in Bread Wheat Through Alien Introgression Tatyana A. Pshenichnikova, Alexander V. Simonov, Ludmila V. Shchukina, Evgeniya V. Morozova,
More informationBICD100 Midterm (10/27/10) KEY
BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration
More informationDevelopment of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower
Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower Lili Qi 1, Zahirul Talukder 2 Brent Hulke 1, Michael Foley 1 1 USDA-ARS, Northern Crop Science Laboratory 2 NDSU,
More informationInflorescence QTL, Canalization, and Selectable Cryptic Variation. Patrick J. Brown Department of Crop Sciences UIUC
Inflorescence QTL, Canalization, and Selectable Cryptic Variation Patrick J. Brown Department of Crop Sciences UIUC What is genetic architecture and why should we care? GENETIC ARCHITECTURE (ANY TRAIT
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationPackage SoyNAM. October 1, 2018
Type Package Package SoyNAM October 1, 2018 Title Soybean Nested Association Mapping Dataset Version 1.5 Date 2018-10-01 Author Alencar Xavier, William Beavis, James Specht, Brian Diers, Rouf Mian, Reka
More informationIntrogression of genetic material from primary synthetic hexaploids into an Australian bread wheat (Triticum aestivum L.)
Introgression of genetic material from primary synthetic hexaploids into an Australian bread wheat (Triticum aestivum L.) A thesis submitted in fulfilment of the requirements for the degree of Master of
More informationSNP genotyping and linkage map construction of the C417 mapping population
STSM Scientific Report COST STSM Reference Number: COST-STSM-FA1104-16278 Reference Code: COST-STSM-ECOST-STSM-FA1104-190114-039679 SNP genotyping and linkage map construction of the C417 mapping population
More informationGenomics and Developing World Agriculture. John Witcombe CAZS Natural Resources University Wales, Bangor
Genomics and Developing World Agriculture John Witcombe CAZS Natural Resources University Wales, Bangor Molecular markers 1. Pearl millet - downy mildew and drought tolerance 2. Upland rice drought tolerance
More informationSupplemental Figure Legends
Supplemental Figure Legends Fig. S1 Genetic linkage maps of T. gondii chromosomes using F1 progeny from the ME49 and VAND genetic cross. All the recombination points were identified by whole genome sequencing
More information