[Presented by: Andrew Howlett, Cruise Slater, Mahmud Hasan, Greg Dale]
|
|
- Erik Richards
- 5 years ago
- Views:
Transcription
1 Mutational Dissection [Presented by: Andrew Howlett, Cruise Slater, Mahmud Hasan, Greg Dale] Introduction What is the point of Mutational Dissection? It allows understanding of normal biological functions How? By genetic disruption of normal gene activity one can analyze the resulting phenotype of the mutant organism Forward vs Reverse Genetics: Forward Genetics: The classical approach to genetic analysis, in which genes are first identifed by mutant alles and mutant phenotypes and later cloned and subjected to molecular analysis. Reverse Genetics: An experimental procedure that begins with a cloned segment of DNA or a protien sequence and uses it (through directed mutagenesis) to introduce programmed mutations back into the genome to investigate function. Mutagens Choice of mutagen is important What needs to be achieved? What phenotype will result? Will it be relevant? Gene gives rise to phenotype Depending on mutagen being used... Results vary giving rise to gene target size The idea of saturating the system... To identify every component in the biological process being studied so that the mutagen affects the system with the best result
2 Is the mutagen random or specific? General Mutagens: -mutate at a constant frequency -produce a broad array of different mutational events -mutation target size hard to calculate -sometime don t produce the sought after mutant phenotype To use a general mutagen: -must be taken up in sufficient quantity to cause mutation -it must not be easily metabolized -must use a high dosage to provide a high mutation frequency while not being cytotoxic General mutagens and how they work: 1) Base-substitution mutagens 2) Indel Mutagens 3) Insertional Mutagens 4) Chromosomal Rearrangers Directed Mutations: -usually very specific -can inactivate a gene by changing DNA -useful for bacteria, yeast, and mice -can leave the gene intact but block activity of a gene product (mrna or Protein) 1) Targeted gene knockout 2) Site directed mutagenesis Related Techniques (the last resort) Inactivation of the Gene Product: Phenocopying: -mimicking a mutant phenotype without altering the structural gene by altering the environment of the cell Antisense RNA Double Stranded RNA interference (dsrnai): Modes of introduction, proposed mechanism 3) Chemical-library screening The Mutational Assay System Must detect mutations in a way that is appropriate to the mutagen. Somatic mutations are not passed to progeny. Germline mutations are passed to the next generation. Dominant and recessive germline mutations
3 In haploid, or sex chromosomes in diploid organisms, both dominant and recessive can be identified in F1 For autosomal genes of diploid organisms: Only dominant mutations visible in F1 (unless homozygous). Recessive mutations visible in F2 or F3, depending on: mutagenesis monoecious (self-fertilizes) or dioecious (has 2 cross-fertilizing sexes). Detecting autosomal recessive mutations In self-fertilizing species, F2 can be analyzed. In cross-fertilizing species, F3 must be analyzed. F3 screens more efficient with tracking of mutagenized chromosome, i.e. Drosophila balancer chromosomes. Recessive mutations of a specific locus can be recovered in F2. Accelerating the identification of autosomal recessive mutants Zebrafish Somatic recombination: Identification of mutations in clones of somatic cells Genetic Selections vs. Genetic Screens Genetic Selections: Involve killing off all individuals that lack the desired mutation. Every offspring that survives is a desired mutant Since mutations are rare, ~ % of offspring die. Therefore, this technique allows identification of a mutant that occurs on % of the time. Genetic Screens: Both mutated and non-mutated individuals are recovered, and the mutants are identified by their phenotype. Can be used for any phenotype, only limited by researcher s ingenuity. Labour Intensive. Genetic Selections Genetic selections are the most useful when dealing with microbes that can grow on defined media, due to the fact that microbes have many genes devoted to metabolic functioning. Genetic Screens General Phenotypes: Genetic screens require the researcher to come up with a phenotype that will reveal mutations of interest. Some examples of common phenotypes used are: Biochemical (auxotrophic) mutations Morphological mutations Lethal mutations Conditional mutations Behavioural mutations
4 Secondary Screens Not all genes can be identified by direct screens. Reasons? Some mutations may only affect homozygotes, but may also be recessive lethal. Some genes have redundancy, where one will cover the mutation of another. Modifier mutation: A mutation in one gene that suppresses or enhances the phenotype caused by a mutation in another gene. Somatic mosaics: Drosophila eye development Gene expression Analysis of the Recovered Mutations Once mutations have been detected and isolated, it is important to evaluate them and draw conclusions about their properties. One way for scientists to get the inside view of a process is by 1. Disrupting it in various ways including mutagenesis 2. Observing the consequences for each case 3. Using the information to understand each of the steps of the process Thus, understanding what has gone awry in different mutations always facilitates analysis. Mutations: A mini review Classification Systems for Mutations: The key point in any mutation is classifying the kind of alteration to gene function that occurs. An "Axle-Gear Mechanism" can be used to represent a cellular pathway. Modifying the way the gears are and by changing the speed of motion, a different result will be seen for each. The main difference is that in terms of the gear analogy, one can look inside the gearbox covering the gears to understand the process, but in terms of mutational analysis, it is seen that loss- versus gain-of-function mutations can be inferred by phenotypic analysis of different dosages of mutant and wild type genes. Counting genes in a biological process: Genetic Transmissional and Complementation Analysis are used to locate the genes represented by a mutant collection. Diagnostics for loss-of-function versus gain-of-function: Both loss-of-function and gain-of-function could be dominant or recessive. But how can we detect?
5 Let us consider dominant mutations. Knowing where any mutations map on a genome, it could be determined if chromosomal deletions or duplications of the gene exist. If they do, they can indicate definitively whether a dominant mutation is a loss-of-function or gain-of-function. For recessive mutations, gene dosage can be used to make similar distinctions between lose-of-function and gain-of-function alterations. Further Aspects of Mutational Analysis: What are the next steps once the basic genetic and phenotypic analysis of a set of mutations is accomplished? Certain procedures are taken including recombination mapping for positional cloning and insertional mutagenesis for molecular tagging, enable the molecular identification of genes, their mrna and protein products. With all these figured out, next question is where they are expressed, other products they might interact with, and how their expression is regulated.
Lecture 2: Using Mutants to study Biological processes
Lecture 2: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen for
More informationChapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )
Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products
More informationIntroduction to C. elegans and RNA interference
Introduction to C. elegans and RNA interference Why study model organisms? The problem: In order to understand biology, we need to learn about the function of the underlying genes How can we find out what
More informationLecture 2-3: Using Mutants to study Biological processes
Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen
More information4 Mutant Hunts - To Select or to Screen (Perhaps Even by Brute Force)
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 4 Mutant Hunts - To Select or to Screen
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationMelton, D.W. (1994) Gene targeting in the mouse. Bioessays 16:633-8
Reverse genetics - Knockouts Paper to read for this section : Melton, D.W. (1994) Gene targeting in the mouse. Bioessays 16:633-8 Up until now, we ve concentrated on ways to get a cloned gene. We ve seen
More informationLS50B Problem Set #7
LS50B Problem Set #7 Due Friday, March 25, 2016 at 5 PM Problem 1: Genetics warm up Answer the following questions about core concepts that will appear in more detail on the rest of the Pset. 1. For a
More information7.03 Final Exam Review 12/19/2006
7.03 Final Exam Review 12/19/2006 1. You have been studying eye color mutations in Drosophila, which normally have red eyes. White eyes is a recessive mutant trait that is caused by w, a mutant allele
More informationBiol 432L Midterm Oct 6, 2008 Name: 1. Midterm 1, Answer Key Oct. 26, 2009
Biol 432L Midterm Oct 6, 2008 Name: 1 Midterm 1, Answer Key Oct. 26, 2009 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1a. (2 pts) Imagine
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationChapter 2. Alleles at a Single Locus. Introduction
Chapter 2 Alleles at a Single Locus Figure 2-1 A flower called Camellia showing co-dominance of the red and white alleles of flower colour. (Flickr- darwin cruz-cc BY 2.0) Introduction mutation is any
More informationBSCI 410-Liu Homework#1 Key Spring 05
1. (8 points) The following is a list of mutational changes. For each of the specific mutations indicate which type of mutation best describes the change. Sometimes, more than one term could be used to
More informationMUTANT: A mutant is a strain that has suffered a mutation and exhibits a different phenotype from the parental strain.
OUTLINE OF GENETICS LECTURE #1 A. TERMS PHENOTYPE: Phenotype refers to the observable properties of an organism, such as morphology, growth rate, ability to grow under different conditions or media. For
More informationLac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.
Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon
More informationProblem Set 2
ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with
More informationChapter 12 (Part III) Complementation Analysis
Biology 234 J. G. Doheny Chapter 12 (Part III) Complementation Analysis You can use a Genetic Dissection analysis to find which genes and which proteins are involved in a biochemical process. (For example,
More informationGenome 371, 12 February 2010, Lecture 10. Analyzing mutants. Drosophila transposon mutagenesis. Genetics of cancer. Cloning genes
Genome 371, 12 February 2010, Lecture 10 Analyzing mutants Drosophila transposon mutagenesis Genetics of cancer Cloning genes Suppose you are setting up a transposon mutagenesis screen in fruit flies starting
More information(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony
1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been isolated that cannot grow
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationF 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011
3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein
More informationBio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
More informationSaccharomyces cerevisiae. haploid =
In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More informationLS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class
LS4 final exam Problem based, similar in style and length to the midterm Articles: just the information covered in class Complementation and recombination rii and others Neurospora haploid spores, heterokaryon,
More informationThe Evolution of Populations
The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether
More informationCentral Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein
Genetics Midterm 1 Chapter 1: Purines: Adenine (double bond), Guanine (Triple Bond) Pyrimidines: Thymine (double bond), Cytosine (Triple Bond), Uracil Central Dogma of genetics: DNA -> Transcription ->
More informationLecture 8: Transgenic Model Systems and RNAi
Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one
More informationA) (5 points) As the starting step isolate genomic DNA from
GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB
More informationTrasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationBefore starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationBIO 304 Genetics (Fall 2003) Exam #2 Name KEY SSN
BIO 304 Genetics (Fall 2003) Exam #2 Name KEY SSN transformation conditional mutation penetrance expressivity Southern blotting hybridization epistasis co-dominance nonsense mutation translocation amplification
More information7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young
7.03 Final Exam Name: TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young Section time: There are 13 pages including this cover page Please write your name
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the
More informationGENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.
!! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when
More informationGenetics Lecture Notes Lectures 6 9
Genetics Lecture Notes 7.03 2005 Lectures 6 9 Lecture 6 Until now our analysis of genes has focused on gene function as determined by phenotype differences brought about by different alleles or by a direct
More informationBISC403 Genetic and Evolutionary Biology Spring, Summary of requirements for Exam 2 (to be given on March 24) plus exam 2 from Fall, 2010.
BISC403 Genetic and Evolutionary Biology Spring, 2011 March 17, 2011 Summary of requirements for Exam 2 (to be given on March 24) plus exam 2 from Fall, 2010. The primary responsibility is for any topic
More informationAnalysis of gene function
Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or
More informationChapter 12. Mutations: things that go bump in the night. Prepared by Woojoo Choi
Chapter 12. Mutations: things that go bump in the night Prepared by Woojoo Choi Mutations alter the DNA 1) Mutation: alteration in the genetic information 2) Mutation is a change in the base sequence of
More informationModule 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
More informationA. Incorrect! This statement is true. Transposable elements can cause chromosome rearrangements.
Genetics - Problem Drill 17: Transposable Genetic Elements No. 1 of 10 1. Which of the following statements is NOT true? (A) Transposable elements can cause chromosome rearrangements. (B) Transposons can
More informationGenetics Transcription Translation Replication
Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.
More informationUNIT MOLECULAR GENETICS AND BIOTECHNOLOGY
UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4
More informationGENETICS - CLUTCH CH.17 MUTATION, REPAIR, AND RECOMBINATION
!! www.clutchprep.com CONCEPT: TYPES OF MUTATIONS There are many different types of The first way to classify mutations is to describe how they arise - Spontaneous mutations are changes that randomly occur
More informationAdvanced Genetics. Why Study Genetics?
Advanced Genetics Advanced Genetics Why Study Genetics? Why Study Genetics? 1. Historical and aesthetic appreciation Why Study Genetics? 1. Historical and aesthetic appreciation 2. Practical applications
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationLecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know
Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding
More informationGenetic analysis is extremely powerful, but also limited in the absence of other types of information
Genetic analysis is extremely powerful, but also limited in the absence of other types of information Mendel was interested in variation among peas as a formalism - because he realized that these phenotypes
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationExperimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
More information7.03 Problem Set 1 Due before 5 PM on Wednesday, September 19 Hand in answers in recitation section or in the box outside of
7.03 Problem Set 1 Due before 5 PM on Wednesday, September 19 Hand in answers in recitation section or in the box outside of 68-120 1. You have isolated a collection of yeast mutants that form small colonies
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationGene Mutation, DNA Repair, and Transposition
Gene Mutation, DNA Repair, and Transposition Mutations Are Classified in Various Ways Spontaneous mutations happen naturally and randomly and are usually linked to normal biological or chemical processes
More informationFINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?
FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents
More informationLecture 15: Functional Genomics II
Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation
More informationProblem Set 2B Name and Lab Section:
Problem Set 2B 9-26-06 Name and Lab Section: 1. Define each of the following rearrangements (mutations) (use one phrase or sentence for each). Then describe what kind of chromosomal structure you might
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationMutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene
Mutations Mutation The term mutation is derived from Latin word meaning to change.! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene!
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationFINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?
FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents
More information9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?
6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?
More informationBSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
More informationHeredity and DNA Assignment 1
Heredity and DNA Assignment 1 Name 1. Which sequence best represents the relationship between DNA and the traits of an organism? A B C D 2. In some people, the lack of a particular causes a disease. Scientists
More informationBSCI 410-Liu Homework#1 Spring 07. Due: Tuesday (Feb 13) at 11:00 AM in class
BSCI 410-Liu Homework#1 Spring 07 Due: Tuesday (Feb 13) at 11:00 AM in class KEY 1. (4 points) Following is a list of mutational changes. For each of the specific mutations indicate which type of mutation
More information2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.
2 nd year Medical Students - JU Bacterial genetics Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.T MSc, PhD/ UK Bacterial genetics ILOs: bacterial genome and replication
More informationCHAPTER 12 MECHANISMS OF EVOLUTION
CHAPTER 12 MECHANISMS OF EVOLUTION 12.1 Genetic Variation DNA biological code for inheritable traits GENES units of DNA molecule in a chromosome LOCI location of specific gene on DNA molecules DIPLOID
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationHuman Molecular Genetics Assignment 3 (Week 3)
Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationSingle-cell sequencing
Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant
More informationPlease sign below if you wish to have your grades posted by the last five digits of your SSN
BIO 226R EXAM III (Sample) PRINT YOUR NAME Please sign below if you wish to have your grades posted by the last five digits of your Signature BIO 226R Exam III has 8 pages, and 26 questions. There are
More informationMCB 421 Exam #1 (A) Fall There are 9 questions and 1 supplement on last page. Answer all 9 questions. Be sure your name is on each page
MCB 421 Exam #1 (A) Fall 2006 There are 9 questions and 1 supplement on last page. Answer all 9 questions. Be sure your name is on each page 1). (8 points) A Luria-Delbruck fluctuation test was done to
More informationBACTERIAL GENETICS. How does the DNA in the bacterial cell replicate
BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.
More informationBiology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005
1 Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1. (2 pts) If you see the following
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationCourse Overview. Interacting genes. Complementation. Complementation. February 15
Course Overview Interacting genes http://www.erin.utoronto.ca/~w3bio/bio207/index.htm February 15 Outline Week Topic Chapter 1 Course objectives and Introduction to genetics Ch. 1 & Ch. 2 2 Human Pedigrees
More informationa) Stock 4: 126 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males.
Drosophila Problem Set 2012 1) You have created P element transformants of a construct that contains the mini-white gene, which confers an orange eye color in a homozygous white mutant background. For
More informationGenetics - Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson
7.03 - Genetics - Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson 1 1. Consider an autosomal recessive trait that occurs at a frequency
More informationAS91159 Demonstrate understanding of gene expression
AS91159 Demonstrate understanding of gene expression Mutations and Metabolic Pathways (2015,2) In 1941 biologists George Beadle and Edward Tatum exposed the bread mould Neurospora crassa to radiation.
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationUnderstanding Sources of Variation. Part 1: Variation Overview (
Name: Per. Date: Understanding Sources of Variation Part 1: Variation Overview (http://learn.genetics.utah.edu/content/variation/sources/) After watching the variation presentation, answer the following
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationIntegrins are the receptors than mediate adhesion between the dorsal and ventral surfaces of the wing.
Problem set 8 answers 1. Integrins are alpha/beta heterodimeric receptors that bind to molecules in the extracellular matrix. A primary role of integrins is in adhesion, ensuring that cells attach to the
More informationEnhancer genetics Problem set E
Enhancer genetics Problem set E How are specific cell types generated during development? There are thought to be 10,000 different types of neurons in the human nervous system. How are all of these neural
More informationGenetics fundamentals and DNA toolkit. Partha Roy
Genetics fundamentals and DNA toolkit Partha Roy 1 (REVIEW of Terminologies and Concepts) Haploid organism: single copy of chromosome (ex: bacteria, yeast) Diploid organism: two copies of chromosome (paternal
More informationBiological Sciences 50 Practice Final Exam. Allocate your time wisely.
NAME: Fall 2005 TF: Biological Sciences 50 Practice Final Exam A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.
More informationCBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:
CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell
More informationMolecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:
Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationAnswer: Sequence overlap is required to align the sequenced segments relative to each other.
14 Genomes and Genomics WORKING WITH THE FIGURES 1. Based on Figure 14-2, why must the DNA fragments sequenced overlap in order to obtain a genome sequence? Answer: Sequence overlap is required to align
More informationGenetics IV: Biochemical Genetics
Genetics IV: Biochemical Genetics 1. Population Genetics This field was advanced by laws proposed by two people Hardy and Weinberg (1908) Suppose in a population there are 2 alleles for a given gene, A
More informationAdvantages of genetic analysis in bacteria/phage. Selections vs Screens. Mutations. Mutations lecture: March 4, 2009
Mutations lecture: March 4, 2009 1. Genetic analysis of bacteria: the whys, hows, and whats 2. Luria-Delbrück and beyond: we still care! 3. Analysis of essential genes! RNA pol, merodiploids and amber
More informationCHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationDNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
More informationChapter 17. Gene Mutations and DNA Repair (Part 1) What does this tell us?
Chapter 17 Gene Mutations and DNA Repair (Part 1) What does this tell us? 1 What does this tell us? Mutations will confer upon us a wide variety of super powers What does this tell us? Mutations will confer
More information