[Presented by: Andrew Howlett, Cruise Slater, Mahmud Hasan, Greg Dale]

Size: px
Start display at page:

Download "[Presented by: Andrew Howlett, Cruise Slater, Mahmud Hasan, Greg Dale]"

Transcription

1 Mutational Dissection [Presented by: Andrew Howlett, Cruise Slater, Mahmud Hasan, Greg Dale] Introduction What is the point of Mutational Dissection? It allows understanding of normal biological functions How? By genetic disruption of normal gene activity one can analyze the resulting phenotype of the mutant organism Forward vs Reverse Genetics: Forward Genetics: The classical approach to genetic analysis, in which genes are first identifed by mutant alles and mutant phenotypes and later cloned and subjected to molecular analysis. Reverse Genetics: An experimental procedure that begins with a cloned segment of DNA or a protien sequence and uses it (through directed mutagenesis) to introduce programmed mutations back into the genome to investigate function. Mutagens Choice of mutagen is important What needs to be achieved? What phenotype will result? Will it be relevant? Gene gives rise to phenotype Depending on mutagen being used... Results vary giving rise to gene target size The idea of saturating the system... To identify every component in the biological process being studied so that the mutagen affects the system with the best result

2 Is the mutagen random or specific? General Mutagens: -mutate at a constant frequency -produce a broad array of different mutational events -mutation target size hard to calculate -sometime don t produce the sought after mutant phenotype To use a general mutagen: -must be taken up in sufficient quantity to cause mutation -it must not be easily metabolized -must use a high dosage to provide a high mutation frequency while not being cytotoxic General mutagens and how they work: 1) Base-substitution mutagens 2) Indel Mutagens 3) Insertional Mutagens 4) Chromosomal Rearrangers Directed Mutations: -usually very specific -can inactivate a gene by changing DNA -useful for bacteria, yeast, and mice -can leave the gene intact but block activity of a gene product (mrna or Protein) 1) Targeted gene knockout 2) Site directed mutagenesis Related Techniques (the last resort) Inactivation of the Gene Product: Phenocopying: -mimicking a mutant phenotype without altering the structural gene by altering the environment of the cell Antisense RNA Double Stranded RNA interference (dsrnai): Modes of introduction, proposed mechanism 3) Chemical-library screening The Mutational Assay System Must detect mutations in a way that is appropriate to the mutagen. Somatic mutations are not passed to progeny. Germline mutations are passed to the next generation. Dominant and recessive germline mutations

3 In haploid, or sex chromosomes in diploid organisms, both dominant and recessive can be identified in F1 For autosomal genes of diploid organisms: Only dominant mutations visible in F1 (unless homozygous). Recessive mutations visible in F2 or F3, depending on: mutagenesis monoecious (self-fertilizes) or dioecious (has 2 cross-fertilizing sexes). Detecting autosomal recessive mutations In self-fertilizing species, F2 can be analyzed. In cross-fertilizing species, F3 must be analyzed. F3 screens more efficient with tracking of mutagenized chromosome, i.e. Drosophila balancer chromosomes. Recessive mutations of a specific locus can be recovered in F2. Accelerating the identification of autosomal recessive mutants Zebrafish Somatic recombination: Identification of mutations in clones of somatic cells Genetic Selections vs. Genetic Screens Genetic Selections: Involve killing off all individuals that lack the desired mutation. Every offspring that survives is a desired mutant Since mutations are rare, ~ % of offspring die. Therefore, this technique allows identification of a mutant that occurs on % of the time. Genetic Screens: Both mutated and non-mutated individuals are recovered, and the mutants are identified by their phenotype. Can be used for any phenotype, only limited by researcher s ingenuity. Labour Intensive. Genetic Selections Genetic selections are the most useful when dealing with microbes that can grow on defined media, due to the fact that microbes have many genes devoted to metabolic functioning. Genetic Screens General Phenotypes: Genetic screens require the researcher to come up with a phenotype that will reveal mutations of interest. Some examples of common phenotypes used are: Biochemical (auxotrophic) mutations Morphological mutations Lethal mutations Conditional mutations Behavioural mutations

4 Secondary Screens Not all genes can be identified by direct screens. Reasons? Some mutations may only affect homozygotes, but may also be recessive lethal. Some genes have redundancy, where one will cover the mutation of another. Modifier mutation: A mutation in one gene that suppresses or enhances the phenotype caused by a mutation in another gene. Somatic mosaics: Drosophila eye development Gene expression Analysis of the Recovered Mutations Once mutations have been detected and isolated, it is important to evaluate them and draw conclusions about their properties. One way for scientists to get the inside view of a process is by 1. Disrupting it in various ways including mutagenesis 2. Observing the consequences for each case 3. Using the information to understand each of the steps of the process Thus, understanding what has gone awry in different mutations always facilitates analysis. Mutations: A mini review Classification Systems for Mutations: The key point in any mutation is classifying the kind of alteration to gene function that occurs. An "Axle-Gear Mechanism" can be used to represent a cellular pathway. Modifying the way the gears are and by changing the speed of motion, a different result will be seen for each. The main difference is that in terms of the gear analogy, one can look inside the gearbox covering the gears to understand the process, but in terms of mutational analysis, it is seen that loss- versus gain-of-function mutations can be inferred by phenotypic analysis of different dosages of mutant and wild type genes. Counting genes in a biological process: Genetic Transmissional and Complementation Analysis are used to locate the genes represented by a mutant collection. Diagnostics for loss-of-function versus gain-of-function: Both loss-of-function and gain-of-function could be dominant or recessive. But how can we detect?

5 Let us consider dominant mutations. Knowing where any mutations map on a genome, it could be determined if chromosomal deletions or duplications of the gene exist. If they do, they can indicate definitively whether a dominant mutation is a loss-of-function or gain-of-function. For recessive mutations, gene dosage can be used to make similar distinctions between lose-of-function and gain-of-function alterations. Further Aspects of Mutational Analysis: What are the next steps once the basic genetic and phenotypic analysis of a set of mutations is accomplished? Certain procedures are taken including recombination mapping for positional cloning and insertional mutagenesis for molecular tagging, enable the molecular identification of genes, their mrna and protein products. With all these figured out, next question is where they are expressed, other products they might interact with, and how their expression is regulated.

Lecture 2: Using Mutants to study Biological processes

Lecture 2: Using Mutants to study Biological processes Lecture 2: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen for

More information

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: ) Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

More information

Introduction to C. elegans and RNA interference

Introduction to C. elegans and RNA interference Introduction to C. elegans and RNA interference Why study model organisms? The problem: In order to understand biology, we need to learn about the function of the underlying genes How can we find out what

More information

Lecture 2-3: Using Mutants to study Biological processes

Lecture 2-3: Using Mutants to study Biological processes Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen

More information

4 Mutant Hunts - To Select or to Screen (Perhaps Even by Brute Force)

4 Mutant Hunts - To Select or to Screen (Perhaps Even by Brute Force) Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 4 Mutant Hunts - To Select or to Screen

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

Melton, D.W. (1994) Gene targeting in the mouse. Bioessays 16:633-8

Melton, D.W. (1994) Gene targeting in the mouse. Bioessays 16:633-8 Reverse genetics - Knockouts Paper to read for this section : Melton, D.W. (1994) Gene targeting in the mouse. Bioessays 16:633-8 Up until now, we ve concentrated on ways to get a cloned gene. We ve seen

More information

LS50B Problem Set #7

LS50B Problem Set #7 LS50B Problem Set #7 Due Friday, March 25, 2016 at 5 PM Problem 1: Genetics warm up Answer the following questions about core concepts that will appear in more detail on the rest of the Pset. 1. For a

More information

7.03 Final Exam Review 12/19/2006

7.03 Final Exam Review 12/19/2006 7.03 Final Exam Review 12/19/2006 1. You have been studying eye color mutations in Drosophila, which normally have red eyes. White eyes is a recessive mutant trait that is caused by w, a mutant allele

More information

Biol 432L Midterm Oct 6, 2008 Name: 1. Midterm 1, Answer Key Oct. 26, 2009

Biol 432L Midterm Oct 6, 2008 Name: 1. Midterm 1, Answer Key Oct. 26, 2009 Biol 432L Midterm Oct 6, 2008 Name: 1 Midterm 1, Answer Key Oct. 26, 2009 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1a. (2 pts) Imagine

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Chapter 2. Alleles at a Single Locus. Introduction

Chapter 2. Alleles at a Single Locus. Introduction Chapter 2 Alleles at a Single Locus Figure 2-1 A flower called Camellia showing co-dominance of the red and white alleles of flower colour. (Flickr- darwin cruz-cc BY 2.0) Introduction mutation is any

More information

BSCI 410-Liu Homework#1 Key Spring 05

BSCI 410-Liu Homework#1 Key Spring 05 1. (8 points) The following is a list of mutational changes. For each of the specific mutations indicate which type of mutation best describes the change. Sometimes, more than one term could be used to

More information

MUTANT: A mutant is a strain that has suffered a mutation and exhibits a different phenotype from the parental strain.

MUTANT: A mutant is a strain that has suffered a mutation and exhibits a different phenotype from the parental strain. OUTLINE OF GENETICS LECTURE #1 A. TERMS PHENOTYPE: Phenotype refers to the observable properties of an organism, such as morphology, growth rate, ability to grow under different conditions or media. For

More information

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell. Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon

More information

Problem Set 2

Problem Set 2 ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with

More information

Chapter 12 (Part III) Complementation Analysis

Chapter 12 (Part III) Complementation Analysis Biology 234 J. G. Doheny Chapter 12 (Part III) Complementation Analysis You can use a Genetic Dissection analysis to find which genes and which proteins are involved in a biochemical process. (For example,

More information

Genome 371, 12 February 2010, Lecture 10. Analyzing mutants. Drosophila transposon mutagenesis. Genetics of cancer. Cloning genes

Genome 371, 12 February 2010, Lecture 10. Analyzing mutants. Drosophila transposon mutagenesis. Genetics of cancer. Cloning genes Genome 371, 12 February 2010, Lecture 10 Analyzing mutants Drosophila transposon mutagenesis Genetics of cancer Cloning genes Suppose you are setting up a transposon mutagenesis screen in fruit flies starting

More information

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been isolated that cannot grow

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011 3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

Saccharomyces cerevisiae. haploid =

Saccharomyces cerevisiae. haploid = In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

LS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class

LS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class LS4 final exam Problem based, similar in style and length to the midterm Articles: just the information covered in class Complementation and recombination rii and others Neurospora haploid spores, heterokaryon,

More information

The Evolution of Populations

The Evolution of Populations The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether

More information

Central Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein

Central Dogma of genetics: DNA -> Transcription -> RNA -> Translation > Protein Genetics Midterm 1 Chapter 1: Purines: Adenine (double bond), Guanine (Triple Bond) Pyrimidines: Thymine (double bond), Cytosine (Triple Bond), Uracil Central Dogma of genetics: DNA -> Transcription ->

More information

Lecture 8: Transgenic Model Systems and RNAi

Lecture 8: Transgenic Model Systems and RNAi Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

BIO 304 Genetics (Fall 2003) Exam #2 Name KEY SSN

BIO 304 Genetics (Fall 2003) Exam #2 Name KEY SSN BIO 304 Genetics (Fall 2003) Exam #2 Name KEY SSN transformation conditional mutation penetrance expressivity Southern blotting hybridization epistasis co-dominance nonsense mutation translocation amplification

More information

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young 7.03 Final Exam Name: TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young Section time: There are 13 pages including this cover page Please write your name

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the

More information

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES. !! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when

More information

Genetics Lecture Notes Lectures 6 9

Genetics Lecture Notes Lectures 6 9 Genetics Lecture Notes 7.03 2005 Lectures 6 9 Lecture 6 Until now our analysis of genes has focused on gene function as determined by phenotype differences brought about by different alleles or by a direct

More information

BISC403 Genetic and Evolutionary Biology Spring, Summary of requirements for Exam 2 (to be given on March 24) plus exam 2 from Fall, 2010.

BISC403 Genetic and Evolutionary Biology Spring, Summary of requirements for Exam 2 (to be given on March 24) plus exam 2 from Fall, 2010. BISC403 Genetic and Evolutionary Biology Spring, 2011 March 17, 2011 Summary of requirements for Exam 2 (to be given on March 24) plus exam 2 from Fall, 2010. The primary responsibility is for any topic

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

Chapter 12. Mutations: things that go bump in the night. Prepared by Woojoo Choi

Chapter 12. Mutations: things that go bump in the night. Prepared by Woojoo Choi Chapter 12. Mutations: things that go bump in the night Prepared by Woojoo Choi Mutations alter the DNA 1) Mutation: alteration in the genetic information 2) Mutation is a change in the base sequence of

More information

Module 6 Microbial Genetics. Chapter 8

Module 6 Microbial Genetics. Chapter 8 Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry

More information

A. Incorrect! This statement is true. Transposable elements can cause chromosome rearrangements.

A. Incorrect! This statement is true. Transposable elements can cause chromosome rearrangements. Genetics - Problem Drill 17: Transposable Genetic Elements No. 1 of 10 1. Which of the following statements is NOT true? (A) Transposable elements can cause chromosome rearrangements. (B) Transposons can

More information

Genetics Transcription Translation Replication

Genetics Transcription Translation Replication Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

GENETICS - CLUTCH CH.17 MUTATION, REPAIR, AND RECOMBINATION

GENETICS - CLUTCH CH.17 MUTATION, REPAIR, AND RECOMBINATION !! www.clutchprep.com CONCEPT: TYPES OF MUTATIONS There are many different types of The first way to classify mutations is to describe how they arise - Spontaneous mutations are changes that randomly occur

More information

Advanced Genetics. Why Study Genetics?

Advanced Genetics. Why Study Genetics? Advanced Genetics Advanced Genetics Why Study Genetics? Why Study Genetics? 1. Historical and aesthetic appreciation Why Study Genetics? 1. Historical and aesthetic appreciation 2. Practical applications

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding

More information

Genetic analysis is extremely powerful, but also limited in the absence of other types of information

Genetic analysis is extremely powerful, but also limited in the absence of other types of information Genetic analysis is extremely powerful, but also limited in the absence of other types of information Mendel was interested in variation among peas as a formalism - because he realized that these phenotypes

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order

More information

7.03 Problem Set 1 Due before 5 PM on Wednesday, September 19 Hand in answers in recitation section or in the box outside of

7.03 Problem Set 1 Due before 5 PM on Wednesday, September 19 Hand in answers in recitation section or in the box outside of 7.03 Problem Set 1 Due before 5 PM on Wednesday, September 19 Hand in answers in recitation section or in the box outside of 68-120 1. You have isolated a collection of yeast mutants that form small colonies

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Gene Mutation, DNA Repair, and Transposition

Gene Mutation, DNA Repair, and Transposition Gene Mutation, DNA Repair, and Transposition Mutations Are Classified in Various Ways Spontaneous mutations happen naturally and randomly and are usually linked to normal biological or chemical processes

More information

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents

More information

Lecture 15: Functional Genomics II

Lecture 15: Functional Genomics II Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation

More information

Problem Set 2B Name and Lab Section:

Problem Set 2B Name and Lab Section: Problem Set 2B 9-26-06 Name and Lab Section: 1. Define each of the following rearrangements (mutations) (use one phrase or sentence for each). Then describe what kind of chromosomal structure you might

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene Mutations Mutation The term mutation is derived from Latin word meaning to change.! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene!

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents

More information

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements? 6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

More information

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06 Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

More information

Heredity and DNA Assignment 1

Heredity and DNA Assignment 1 Heredity and DNA Assignment 1 Name 1. Which sequence best represents the relationship between DNA and the traits of an organism? A B C D 2. In some people, the lack of a particular causes a disease. Scientists

More information

BSCI 410-Liu Homework#1 Spring 07. Due: Tuesday (Feb 13) at 11:00 AM in class

BSCI 410-Liu Homework#1 Spring 07. Due: Tuesday (Feb 13) at 11:00 AM in class BSCI 410-Liu Homework#1 Spring 07 Due: Tuesday (Feb 13) at 11:00 AM in class KEY 1. (4 points) Following is a list of mutational changes. For each of the specific mutations indicate which type of mutation

More information

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S. 2 nd year Medical Students - JU Bacterial genetics Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.T MSc, PhD/ UK Bacterial genetics ILOs: bacterial genome and replication

More information

CHAPTER 12 MECHANISMS OF EVOLUTION

CHAPTER 12 MECHANISMS OF EVOLUTION CHAPTER 12 MECHANISMS OF EVOLUTION 12.1 Genetic Variation DNA biological code for inheritable traits GENES units of DNA molecule in a chromosome LOCI location of specific gene on DNA molecules DIPLOID

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

Human Molecular Genetics Assignment 3 (Week 3)

Human Molecular Genetics Assignment 3 (Week 3) Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein

More information

PV92 PCR Bio Informatics

PV92 PCR Bio Informatics Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure

More information

Single-cell sequencing

Single-cell sequencing Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant

More information

Please sign below if you wish to have your grades posted by the last five digits of your SSN

Please sign below if you wish to have your grades posted by the last five digits of your SSN BIO 226R EXAM III (Sample) PRINT YOUR NAME Please sign below if you wish to have your grades posted by the last five digits of your Signature BIO 226R Exam III has 8 pages, and 26 questions. There are

More information

MCB 421 Exam #1 (A) Fall There are 9 questions and 1 supplement on last page. Answer all 9 questions. Be sure your name is on each page

MCB 421 Exam #1 (A) Fall There are 9 questions and 1 supplement on last page. Answer all 9 questions. Be sure your name is on each page MCB 421 Exam #1 (A) Fall 2006 There are 9 questions and 1 supplement on last page. Answer all 9 questions. Be sure your name is on each page 1). (8 points) A Luria-Delbruck fluctuation test was done to

More information

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.

More information

Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005

Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 1 Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1. (2 pts) If you see the following

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Course Overview. Interacting genes. Complementation. Complementation. February 15

Course Overview. Interacting genes. Complementation. Complementation. February 15 Course Overview Interacting genes http://www.erin.utoronto.ca/~w3bio/bio207/index.htm February 15 Outline Week Topic Chapter 1 Course objectives and Introduction to genetics Ch. 1 & Ch. 2 2 Human Pedigrees

More information

a) Stock 4: 126 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males.

a) Stock 4: 126 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males. Drosophila Problem Set 2012 1) You have created P element transformants of a construct that contains the mini-white gene, which confers an orange eye color in a homozygous white mutant background. For

More information

Genetics - Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson

Genetics - Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson 7.03 - Genetics - Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson 1 1. Consider an autosomal recessive trait that occurs at a frequency

More information

AS91159 Demonstrate understanding of gene expression

AS91159 Demonstrate understanding of gene expression AS91159 Demonstrate understanding of gene expression Mutations and Metabolic Pathways (2015,2) In 1941 biologists George Beadle and Edward Tatum exposed the bread mould Neurospora crassa to radiation.

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Understanding Sources of Variation. Part 1: Variation Overview (

Understanding Sources of Variation. Part 1: Variation Overview ( Name: Per. Date: Understanding Sources of Variation Part 1: Variation Overview (http://learn.genetics.utah.edu/content/variation/sources/) After watching the variation presentation, answer the following

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Integrins are the receptors than mediate adhesion between the dorsal and ventral surfaces of the wing.

Integrins are the receptors than mediate adhesion between the dorsal and ventral surfaces of the wing. Problem set 8 answers 1. Integrins are alpha/beta heterodimeric receptors that bind to molecules in the extracellular matrix. A primary role of integrins is in adhesion, ensuring that cells attach to the

More information

Enhancer genetics Problem set E

Enhancer genetics Problem set E Enhancer genetics Problem set E How are specific cell types generated during development? There are thought to be 10,000 different types of neurons in the human nervous system. How are all of these neural

More information

Genetics fundamentals and DNA toolkit. Partha Roy

Genetics fundamentals and DNA toolkit. Partha Roy Genetics fundamentals and DNA toolkit Partha Roy 1 (REVIEW of Terminologies and Concepts) Haploid organism: single copy of chromosome (ex: bacteria, yeast) Diploid organism: two copies of chromosome (paternal

More information

Biological Sciences 50 Practice Final Exam. Allocate your time wisely.

Biological Sciences 50 Practice Final Exam. Allocate your time wisely. NAME: Fall 2005 TF: Biological Sciences 50 Practice Final Exam A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.

More information

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell

More information

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name: Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Answer: Sequence overlap is required to align the sequenced segments relative to each other.

Answer: Sequence overlap is required to align the sequenced segments relative to each other. 14 Genomes and Genomics WORKING WITH THE FIGURES 1. Based on Figure 14-2, why must the DNA fragments sequenced overlap in order to obtain a genome sequence? Answer: Sequence overlap is required to align

More information

Genetics IV: Biochemical Genetics

Genetics IV: Biochemical Genetics Genetics IV: Biochemical Genetics 1. Population Genetics This field was advanced by laws proposed by two people Hardy and Weinberg (1908) Suppose in a population there are 2 alleles for a given gene, A

More information

Advantages of genetic analysis in bacteria/phage. Selections vs Screens. Mutations. Mutations lecture: March 4, 2009

Advantages of genetic analysis in bacteria/phage. Selections vs Screens. Mutations. Mutations lecture: March 4, 2009 Mutations lecture: March 4, 2009 1. Genetic analysis of bacteria: the whys, hows, and whats 2. Luria-Delbrück and beyond: we still care! 3. Analysis of essential genes! RNA pol, merodiploids and amber

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

Chapter 17. Gene Mutations and DNA Repair (Part 1) What does this tell us?

Chapter 17. Gene Mutations and DNA Repair (Part 1) What does this tell us? Chapter 17 Gene Mutations and DNA Repair (Part 1) What does this tell us? 1 What does this tell us? Mutations will confer upon us a wide variety of super powers What does this tell us? Mutations will confer

More information