CRISPR-based gene disruption in murine HSPCs. Ayumi Kitano and Daisuke Nakada

Transcription

1 CRISPR-based gene disruption in murine HSPCs Ayumi Kitano and Daisuke Nakada Nakada Lab Protocol INTRODUCTION We recently described fast, efficient, and cost-effective methods to directly modify the genomes of mouse and human HSPCs using the CRISPR/Cas9 system (Gundry et al. Cell Reports : ). We here provide a detailed protocol to perform gene disruption in mouse HSPCs. Two types of sgrna can be generated; one with the conventional scaffold (e.g. those encoded by plasmid px series), and the other with the improved scaffold (Chen et al. Cell 155, ). Template DNA fragments for these two different sgrnas are produced with PCR using different forward primers and template plasmids, which are detailed below. Although we did not see substantial improvement of gene disruption efficiency with the improved scaffold, a trend towards increased efficiency can be observed in some cases. It is important to design several sgrnas per gene of interest, as not all sgrna (even with high scores) work. It is also important to have a positive control for the whole procedure, such as sgrna against GFP (if the cells express GFP) or CD45, as we demonstrated in our paper. Deletion efficiency for these fluorescent markers or cell surface markers can be easily tested by FACS. MATERIALS For conventional scaffold sgrna Forward primer-c (see MATERIAL SETUP) Reverse universal primer (see MATERIAL SETUP) px series (any of px300, px335, px458, px459) available from Addgene. For improved scaffold sgrna Forward primer-i (see MATERIAL SETUP) Reverse universal primer (see MATERIAL SETUP) pklv-u6grna-ef(bbsi)-pgkpuro2abfp (abbreviated pklvi in this protocol) (Addgene 62348). KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) Zymo DNA clean and concentrator-5 Kit (or equivalent) Qiagen RNeasy MiniElute (or equivalent) Cas9 Protein (PNA Bio, see MATERIAL SETUP) Neon Transfection System (ThermoFisher Scientific) RNAZap (ThermoFisher Scientific) or equivalent Mice (see MATERIAL SETUP) Staining medium (see MATERIAL SETUP) PBS Ca/Mg free (ThermoFisher Scientific) Heat-inactivated bovine serum (ThermoFisher Scientific) Biotinylated c-kit antibody (clone 2B8, ebioscience, Biolegend, or BD) anti-biotin microbeads (Miltenyi) Magnetic separation device, such as AutoMACS or MACS (Miltenyi) X-vivo 15 (Lonza) (see MATERIAL SETUP, Culture media ) Heat-inactivated fetal bovine serum (ThermoFisher Scientific) Mouse stem cell factor (SCF) (Peprotech) (see MATERIAL SETUP)

2 Mouse thrombopoietin (TPO) (Peprotech) Mouse interleukin 3 (IL-3) (Peprotech) Mouse interleukin 6 (IL-6) (Peprotech) MATERIAL SETUP sgrna Forward primer: The forward primer sequence is unique for each sgrna. Design this oligo on We modify the 3 part of the oligo to improve amplification for the conventional scaffold, and a distinct modification is needed to incorporate the improved scaffold (see sgrna design). Dissolved in TE at 50 µm. Reverse universal primer: 5 - AGCACCGACTCGGTGCCACT -3. This is the universal oligo that anneals to the scaffold sequence within both px plasmids (conventional scaffold) and pklvi plasmid (improved scaffold). See sgrna synthesis. Dissolved in TE at 50 µm. px series (any of px300, px335, px458, px459) available from Addgene: This plasmid contains the conventional scaffold. Dilute to 1-2 ng/µl. pklv-u6grna-ef(bbsi)-pgkpuro2abfp (Addgene 62348): This plasmid contains the improved scaffold described in Chen et al. Cell. 155, Although the improved scaffold may not considerably increase editing efficiency, we have not see any detrimental effects and we routinely use the improved scaffold. Dilute to 1-2 ng/µl. Cas9 protein: Reconstitute the lyophilized protein with PBS or buffer T (in the Neon electroporation kit) to 1 µg/µl. Mice: We have only used mice in the C57BL/6 background, but others should work as well. Cytokines: Lyophilized cytokines are reconstituted with 1 mg/ml BSA in PBS to final concentration of 10 µg/ml. Staining medium: PBS Ca/Mg free with 2% bovine serum. This medium is used for all antibody staining and washing of HSPCs. Culture media: We routinely use X-Vivo 15 media supplemented with 2% FBS, 50 ng/ml SCF, 50 ng/ml TPO, 10 ng/ml IL-3, and 10 ng/ml IL-6. Other media that supports murine HSPCs should also work (e.g. StemSpan, SF-O3). PROCEDURE A. sgrna design 1. Use to design your sgrna. The CRISPRscan algorithm provides a list of potential target sequences. For each target sequence, CRISPRscan provides an integrated forward primer sequence that includes the T7 promoter, the target sequence, and the scaffold sequence that anneals to the template plasmid (see below).! To use the conventional scaffold in the px plasmids, add atagc to the 3 end of the oligo.! In order to add the improved scaffold, change the sequence after 18Ns to gtttaagagctatgctggaaacagc

3 T7 promoter GG+18N Modify Change to this sequence: gtttaagagctatgctggaaacagc For example, the primer to be ordered in the case above will be: taatacgactcactata GGCTGGGTGGAGAGGGCCAT gttttagagctagaaatagc for the conventional scaffold. Or, taatacgactcactata GGCTGGGTGGAGAGGGCCAT gtttaagagctatgctggaaacagc for the improved scaffold. (Nucleotide changes indicated in bold) B. sgrna DNA template synthesis (TIMING: 1 hour) 1. Set up a PCR reaction Component Amount (µl) Final 2X Kapa HiFi X sgrna Forward primer uM Reverse universal primer uM px or pklvi ng H2O To Run the following thermal cycle Cycle number Denature Anneal Extension Pre-PCR 95 C, 2 min C, 5 sec 60 C, 5 sec 72 C, 10 sec Post-PCR 72 C, 1 min Hold 4 C 3. Run 1 µl on a 2% agarose gel to confirm a single band of ~130bp and the absence of spurious fragments. 4. Purify the PCR product with the Zymo DNA clean and concentrator-5 Kit. Follow the kit protocol, and elute with 12 µl of elution buffer. 5. Measure the concentration of the PCR products on a spectrophotometer. Typical DNA concentrations obtained are in the ng/µl range.

4 C. In Vitro Transcription of sgrna (TIMING: 16 hours+) 1. Take precautions to prevent RNase contamination (change gloves frequently, RNaseZAP etc). 2. Set up an IVT reaction in PCR tubes as below. Component Amount (µl) Final 10X Reaction Buffer 1 1X dntps (100mM stock) 4 10mM each Template DNA ng T7 RNA pol 1 H2O To Incubate at 37 C overnight. 4. Bring each RNA sample up to a total volume of 50 µl with nuclease-free water. Run 1 µl on a 2% agarose gel to assess RNA yield. D. Purification of sgrna (TIMING: 2 hours) 1. Take precautions to prevent RNase contamination (change gloves frequently, RNaseZAP etc). 2. Follow the protocol in the QIAGEN RNeasy MiniElute kit. 3. Elute sgrna with 30 µl of nuclease-free water. The expected yield after purification is µg. 4. To confirm the quality of the purified sgrna, mix 1 µl of 6x loading dye with 1 µl of the eluted sgrna and 4µl of nuclease-free water. Incubate the samples at 70 C for 5 min, and run them on a 2% agarose gel 5. Measure the concentration of 1:2 diluted sgrna using a spectrophotometer. 6. Aliquot sgrna in 1.5 ml tubes and store in -80 C. E. Isolation of mouse HSPCs (TIMING: hours) 1. Euthanize mice, dissect out femora and tibiae, and cut the both ends of each bone with a fine scissor. Place the bones in a 60 mm petri dish. 2. If possible, perform the following steps in a tissue culture hood except step 14. Using a 3 ml syringe containing ice-cold staining media (2% heat-inactivated calf serum in HBSS or PBS) and 25G needle, separate the contents of the marrow from the bone by flushing the marrow cavity with staining medium. This may be repeated several times for each bone to ensure all marrow has been removed. 3. After flushing all the marrow from the bones, dissociate the marrow by gently pipetting up and down. 4. Filter marrow through 70 µm nylon mesh into a 50 ml Falcon tube 5. Rinse the petri dish with 1 ml staining media and pass through the same filter to recover trapped cells (total will be 4 ml of cell suspension). 6. Transfer the sample into a 5 ml FACS tube 7. Centrifuge cell suspension for 5 min at 2000 rpm. While samples are being centrifuged, begin to prepare the antibody solutions for subsequent staining steps as below. 8. Aspirate supernatant and resuspend the cell pellet in 200 µl of staining media containing 1 µl of biotinylated c-kit antibody.! Alternatively, lineage negative cells can be isolated and used. Use a cocktail of biotinylated antibodies against lineage markers and perform a negative selection. 9. Incubate cells in antibody solution for 20 min on ice, resuspending the suspension every 5-10 min.

5 10. After 20 min, dilute cell suspension by filling up the tube with staining medium, and spin down the cells for 5 min at 2000 rpm. 11. Aspirate supernatant and resuspend the cell pellet in 180 µl of staining media and 20 µl of antibiotin microbeads. 12. Incubate cells for 20 min on ice, resuspending the suspension every 5-10 min. 13. After 20 min, dilute cell suspension by filling up the tube with staining medium, and spin down the cells for 5 min at 2000 rpm. 14. Resuspend cells in 1 ml of staining buffer. 15. Positively select for c-kit + cell using AutoMACS or MACS. Make sure the buffer used at this step is sterile. 16. (optional) Count cells 17. Spin down the cells for 5 min at 2000 rpm. 18. Aspirate supernatant and resuspend the cell pellet in 2 ml of culture medium 19. Incubate the cells in a 6 well culture plate at 37 C, 5% CO 2 for 2-3 hours. 20. Start preparing for electroporation at the last 30 min-1 hour of the incubation. F. Electroporation of sgrna-cas9 RNP complexes (TIMING: 1 hour) 1. Prepare culture plates (i.e.: 250 µl of culture medium in 48 well culture plates) and place them in a tissue culture incubator until you perform electroporation. 2. Add 1 µl of Cas9 protein in a 1.5 ml tube for each reaction. 3. Count cells and calculate the volume needed for the experiment. 1x10 5 cells are used per replicate (add at least one additional reaction worth of cells to for pipetting error). 4. Transfer the amount of cells needed into a 1.5 ml tube and bring up to 0.5 ml with 1 x PBS. 5. Spin down the cells for 5 min at 2000 rpm. 6. Aspirate supernatant and resuspend the cell pellet in 10 µl of T buffer per 1x10 5 cells. 7. Aliquot the required amount of sgrna into a 1.5ml tube and heat sgrna at 95 C for 2 min, then immediately place sgrna on ice for 1-2 min.! We use 200 ng to 1 µg of sgrna per 1 µg of Cas9 protein. 200 ng seems to be sufficient for most applications. 8. Spin down sgrna for 1 min at 13,300 rpm. 9. Mix 1 µl of the pre-heated sgrna with Cas9 protein, pipetting up and down a few times thoroughly (3 µl of pre-heated sgrna with 3 µl of Cas9 protein for triplicates). 10. Incubate the Cas9/sgRNA protein mixture for 5 10 min at room temperature. 11. Set up Neon Transfection system by adding 3ml of electrolytic buffer into a new plastic cuvette, and slide the cuvette into the device. 12. Once Cas9/sgRNA complex has been incubated for 5-10 min, add 10 µl of cell suspension (1x10 5 cells) to 2 µl of Cas9/sgRNA RNP complex for one reaction. 13. Pipet the sample up and down twice thoroughly with the Neon electroporation tip, and draw 10 µl.! Make sure there are no bubbles inside the tip. 14. Place the tip into the cuvette. 15. Select a program on the device: 1700V, 20ms, 1pluse.! During electroporation, you will hear two beeps. The 2 nd beep tells that the electroporation is done. Or you can see the complete message on the screen. 16. After electroporation is completed, immediately remove the tip from the cuvette and dispense the sample into a well with culture medium. Pipet up and down 2-3 times. You can use the same tip for your replicates unless the tip traps many bubbles. 17. Repeat for all samples. Change tips between different samples (cell types or sgrna).

6 18. Test KO efficiency using PCR followed by NGS, T7E1 assays or by flow cytometry 2-3 days after electroporation.