Understanding DNA Structure
|
|
|
- Gloria Hancock
- 6 years ago
- Views:
Transcription
1 Understanding DNA Structure I619 Structural Bioinformatics
2 Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of the compaction could be higher (if DNA was a ball of string) DNA of one chromosome is very long and narrow (expanded scale: length = 30km, diameter = 2mm. DNA carries genetic material
3 Molecular Biology Basics - Chromosomes human DNA is stored in 46 chromosomes 22 homologous pairs plus X and Y chromosomes that determine sex fruit fly has 8 chromosomes (3 homologous pairs + X and Y) Chromosomes just after duplication before cell division, no pictures of chromosomes exist in their extended form
4 Molecular Biology Basics - Chromosomes Drosophila chromosomes in its extended form. Drosophila chromosomes further magnified. A chromosome is split into bands and interbands
5 Molecular Biology Basics - Chromosomes Scale: each DNA-protein spool is about 100Ǻ = 10 8 m. Wrapping twice about each spool reduces DNA length by about 6 times.
6 Molecular Biology Basics - DNA DNA double helix. Diameter of the helix is about 20 Ǻ Two separated strands of DNA. Each nucleotide is about 6 Ǻ wide.
7 Nucleotides, very basic Each nucleotide (about 20 atoms) contains: (a) sugar, (ii) phosphate; and a (iii) base. The phosphate group.
8 Nucleotides to Amino Acids
9 Back to Molecular Biology
10 Why a Helix? Let s start from scratch! Phosphates are very soluble in water. Sugars are very soluble in water. Bases are insoluble (different bases dissolve at different ph, but not ph = 7).
11 A ladder formed by two strands of DNA. Ladder
12 Skewed Ladder A skewed ladder formed by two strands of DNA.
13 Different ways of stacking Stacking of base-pairs. Stacking of typs (b) is sterically preferred and ultimately will be leading to helical conformation.
14 Helical Conformation Base pairs wrap around an imaginary cylinder of radius 9Ǻ. This, using simple geometry we can calculate that θ = 32.3 since P 11 is directly above P 0. Typical θ in practice ranges from 20 to 50, with the mean of 34.
15 Helical Conformation B DNA: 10 phosphates per turn; A DNA: 11 phosphates per turn; ZDNA: 12 phosphates per turn
16 What allows this flexibility? Flexibility of the sugar-phosphate chains is considered to be the origin of flexibility.
17 Watson-Crick Base Pairing
18 Hoogsteen Base Pairing
19 Other Pairings?
20 Back to Bases (and Nucleotides)
21 Connecting Nucleotides
22 Basic DNA and RNA Structure Components Sugar Base Phosphate 5 to 3 direction RNA ribose - extra OH at 2 of ribose DNA deoxyribose Numbering Voet, Donald and Judith G. Biochemistry. John Wiley & Sons, 1990, p. 792.
23 The 5 Bases of DNA and RNA The Nucleotides Purines Pyrimadines and Purines T->U in RNA Names Numbering Bonding character Position of hydrogen Tautomers Pyrimadines Neidle, Stephen. Nucleic Acid Structure and Recognition. Oxford University Press, 2002, p. 18.
24 Kinds of Double Helix driving force for helix formation is the property of bases to exclude water Base pairs typically found in propeller twists 6 degrees of freedom to move one base pair with respect to the other not all degrees are sterically allowed
25 Kinds of Double Helix most movements are well described by a twist, a roll and a slide.
26 Kinds of Double Helix
27 History 1946 DNA is the main constituent of genes (Avery) 1950 First X-ray pictures of DNA (Franklin) 1953 DNA structure revealed (Watson and Crick) 1970 onwards - Multiple conformations and structures 1973 X-ray structure confirms double helix (Rich) 1974 t-rna structure (Kim) 1980 Structure of first complete turn of B DNA (Dickerson)
28 History
29 References Majority of figures from Understanding DNA by Calladine et al. Some figures from Fundamental concepts of Bioinformatics: by Krane and Raymer Some slides made by Phil Bourne, UCSD
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
ADENINE, THYMINE,CYTOSINE, GUANINE
MOLECULAR GENETICS Molecular Genetics - the branch of genetics concerned with the structure and activity of genetic material at the molecular level Genetic Material - chromatin (chromosomes) within the
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA STRUCTURE & REPLICATION
DNA STRUCTURE & REPLICATION A MODEL OF DNA In 1953, two scientists named Watson & Crick built a model of DNA that demonstrates its exact structure and function. They called this model a double helix, which
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
Nucleotides & Nucleic Acids. Central Dogma of Biology
Roles: Energy currency (ATP, GTP) Chemical links in response of cells to hormones (camp) Involved in cofactors (NAD, FAD, CoA) Metabolic intermediates (acetyl CoA) Constituents of nucleic acids, DNA and
Chapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
Macromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
Nucleic Acids. Biotechnology
Nucleic Acids Biotechnology DNA Deoxyribonucleic acid Forms the Genetic Code 1953 The work of four people identify the structure of DNA. This knowledge opens the floodgates of scientific discovery that
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Opening Activity. DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions.
Opening Activity DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions. 1. How is the structure of DNA similar to that of a ladder or spiral
IN: Discuss how the role of DNA has affected each fish. What is deoxyribonucleic acid and why is it important?
IN: Discuss how the role of DNA has affected each fish. What is deoxyribonucleic acid and why is it important? But first. Where are we on our biological scale? Organism Cell Nucleus Chromosome Gene DNA
The discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review nucleic acid New double helix nucleosome Discovery
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
DNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
Purines vs. Pyrimidines
Introduction to Genetics/DNA Replication The DNA molecule is found in the nucleus and is composed of nucleotides The DNA Molecule Composed of 2 polymers of nucleotides Polymers are oriented in antiparallel
Vocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
The discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Essential Questions Which experiments led to the discovery of DNA
Name: Date: Period:
Name: Date: Period: 1 2 3 4 5 The Structure of DNA Mind Map Using the words from our class brainstorm, categorize these ideas into clusters and create a mind map displaying what you already know about
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
Molecular Biology - The Structure of DNA *
OpenStax-CNX module: m49482 1 Molecular Biology - The Structure of DNA * Jerey Mahr Based on The Structure of DNA by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
THE STRUCTURE AND FUNCTION OF DNA
THE STRUCTURE AND FUNCTION OF DNA 1. DNA is our genetic code!!! It is passed from generation to generation. It carries information that controls the functions of our cells. DNA stands for deoxyribonucleic
Unit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
From Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
DNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
Reading for lecture 2
Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Griffith Avery Franklin Watson and Crick
to. Protein Griffith Avery Franklin Watson and Crick Although Mendel understood that we inherit information, he didn t know how In 1928 Frederick Griffith was studying two forms of bacteria species One
Chapter 8 DNA STRUCTURE AND CHROMOSOMAL ORGANIZATION
Chapter 8 DNA STRUCTURE AND CHROMOSOMAL ORGANIZATION Chapter Summary Even though DNA has been known as a biochemical compound for over 100 years, it was not implicated as the carrier of hereditary information
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
Nucleic acids. The building blocks. Phosphates
Nucleic acids Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are made up of nucleic acids found in the nuclei of living cells. They are the vehicles of genetic inheritance. Nucleic acids are condensation
IDENTIFYING THE GENETIC MATERIAL DR. A. TARAB DEPT. OF BIOCHEMISTRY HKMU
IDENTIFYING THE GENETIC MATERIAL DR. A. TARAB DEPT. OF BIOCHEMISTRY HKMU EARLY HYPOTHESES Most people look somewhat like a mixture of their parents In general, certain traits are passed on from one generation
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
BIO 2 GO! NUCLEIC ACIDS
BIO 2 GO! NUCLEIC ACIDS 3115 Nucleic Acids are organic molecules that carry the genetic information for every living organism. All living things contain nucleic acids. The DNA and RNA are responsible for
Lecture #17 10/12/01 Dr. Wormington
Lecture #17 10/12/01 Dr. Wormington DNA = Genetic Material & Mechanism of Replication Series of "Classical" Studies in Molecular Biology Avery, MacLeod & McCarty 1944 Griffith's "Transforming Principle"
DNA. Deoxyribose Nucleic Acid
DNA Deoxyribose Nucleic Acid Biomolecules Remember 1. Carbohydrates 2. Lipids 3. Nucleic acids hold genetic information; code for proteins 4. Proteins History of DNA Who Discovered DNA Rosalind Franklin
Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo
Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
Structure and Replication
Structure and Replication 6.A: Students will identify components of DNA, and describe how information for specifying traits of an organism is carried in the DNA 6.B: Students will recognize that components
Chapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
Discovering the Structure of DNA
Discovering the Structure of DNA What is DNA? DNA = deoxyribonucleic acid Holds all our cell s information Located in the cell s nucleus What we already know about DNA Codes for proteins essential to life
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
MOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
The Structure and Func.on of Macromolecules Nucleic Acids
The Structure and Func.on of Macromolecules Nucleic Acids The FOUR Classes of Large Biomolecules All living things are made up of four classes of large biological molecules: Carbohydrates Lipids Protein
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
DNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
3/10/16 DNA. Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole?
DNA Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole? 1 Benchmark SC.912.N.1.3, SC912.L16.9 Explain how & why the genetic code
Polymers. DNA is a polymer of nucleotides. What polymers (macromolecules) have we met so far? Proteins are polymers of amino acids
Subatomic particles (parts of an atom) 1. Protons (+) 2. Neutrons 3. Electrons (-) H-H -Smallest unit of an element. -Parts are held together via electrostatic forces BIO101: a roadmap to the course Atoms
Biology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
DNA: The Genetic Material. Chapter 14. Genetic Material
DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain
A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:
Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through
Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
Wilkins Franklin s photo below proved model on left to be correct for DNA
Watson Crick Franklin Wilkins Franklin s photo below proved model on left to be correct for DNA Pauling Most important scientific paper in Biology in last 100 years First time DNA double helix seen in
1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
Lesson Overview. The Structure of DNA
Lesson Overview The Structure of DNA Related Videos Stated Clearly: http://youtu.be/zwibgnge4ay Bozeman Nucleic acids: http://youtu.be/nnasrkiu5fw Bozeman People who discovered DNA: http://youtu.be/qoervswkmgk
By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
Appendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Directed Reading. Section: Identifying the Genetic Material. was DNA? Skills Worksheet
Skills Worksheet Directed Reading Section: Identifying the Genetic Material Read each question, and write your answer in the space provided. 1. What was Griffith trying to accomplish by injecting mice
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
DNA Structure. DNA: The Genetic Material. Chapter 14
DNA: The Genetic Material Chapter 14 DNA Structure DNA is a nucleic acid. The building blocks of DNA are nucleotides, each composed of: a 5-carbon sugar called deoxyribose a phosphate group (PO 4 ) a nitrogenous
Chapter 16. The Molecular Basis of Inheritance. Biology Kevin Dees
Chapter 16 The Molecular Basis of Inheritance DNA Life s instructions!!!! Deoxyribonucleic Acid Nucleic acid polymer from nucleotide monomers Unique in that it can: Self replicate Carry information History
Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.
Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
Name: Family: Date: Monday/Tuesday, March 9,
Name: Family: Date: Monday/Tuesday, March 9,10 2015 Select the best answer for each question: Part 1: Multiple Choice (2 points each) 1. Protein Synthesis involves which two processes? a. DNA Replication
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.
DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use
Ch Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
Essential Functions of Life
Essential Functions of Life You are probably well aware that your genetic material determines most of your physical traits. The DNA inherited from each of your two parents dictates your body structure,
Unit #5 - Instructions for Life: DNA. Background Image
Unit #5 - Instructions for Life: DNA Introduction On the following slides, the blue sections are the most important. Underline words = vocabulary! All cells carry instructions for life DNA. In this unit,
DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini
DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
DNA - The Double Helix
Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
Write: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
DNA, RNA & Proteins Chapter 13
DNA, RNA & Proteins Chapter 13 DNA stands for. What is DNA? - The genetic information that controls the activity of a cell. - Located in the of every one of your cells. What is the structure of DNA like?
Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
DNA Structure and Replication
DNA Structure and Replication DNA: The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
Biology. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall
Biology 1 of 37 2 of 37 Griffith and Transformation Griffith and Transformation In 1928, British scientist Fredrick Griffith was trying to learn how certain types of bacteria caused pneumonia. He isolated
Biology. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall
Biology 1 of 37 2 of 37 Essential Question What is the overall structure of DNA? 3 of 37 Griffith and Transformation Griffith and Transformation In 1928, British scientist Fredrick Griffith was trying