Trevigen s CometChip Platform (High Through-Put DNA Damage Analysis)
|
|
- Avis Griffin
- 6 years ago
- Views:
Transcription
1 Trevigen s CometChip Platform (High Through-Put DNA Damage Analysis) info@trevigen.com 8405 Helgerman Court, Gaithersburg MD 20817
2 Objectives Review Standard Comet Assay. Explain CometChip Platform. Demonstrate advantages of Trevigen Comet Analysis Software. Show validation of 4X image analysis.
3 The Comet Assay The Single Cell Gel Electrophoresis assay (SCGE, also known as comet assay) is a sensitive technique for the detection of DNA damage at the level of the individual eukaryotic cell. It was first developed by Östling & Johansson in 1984 and later modified by Singh et al. in It a standard technique for evaluation of DNA damage/repair, biomonitoring and genotoxicity testing. The term "comet" refers to the pattern of DNA migration through the electrophoresis gel, which often resembles a comet.
4 Principles of the Comet Assay Cells placed in LM Agarose Treat with Lysis solution Alkaline Electrophoresis and stain Large Fragments Small Fragments Immobilize cells on CometSlide Alkali Treatment
5 Typical Comet Data
6 The CometChip Platform The CometChip Platform consists of: CometChip Well Former Comet Electrophoresis System Comet Analysis Software CometChips Reagents CometChip
7 Trevigen s CometChip Platform: Reagents, Apparatus and Software CometChip Well Former CometChip Electrophoresis Unit with Power Supply CometChip Reagents Comet Analysis Software
8 CometChip provides high density data with minimal overlaps compared to older comet formats Older Comet Format CometChip
9 Trevigen Comet Analysis System (Analyze >500,000 comets per week) SCAN ANALYZE EDIT Wizard Driven Software
10 Free Demonstration at Booth 1728 Directions from Wizard Automatic Comet finding and Scoring Drag and Drop Images Study Name Review from Image Edit based on profile
11 Trevigen Comet Analysis System For the analysis of traditional comet data or CometChip Uses 4X images - requires fewer images Automatic Comet finding and scoring. No need to manually identify each comet. Easy to use and intuitive software. Easy data exports. Advantages w/ 96 well-cometchip (maximum 400 comets/well) ~150 comets per 4X image (camera/scope specific). Scan and analyze ~14,400 comets in < minutes. Minimal editing due to no over lapping comets.
12 Validation of 4X Imaging To date Comet analysis is based on the use of 10X images and frequently requires a software compatible camera. Trevigen platform uses a 4X image and is not camera specific. It was important to demonstrate that data generated from 4X images correlates with 10X images.
13 Software Validation Using Simulated Comets Simulated Comets The simulated comet images were designed to represent a range of damage levels and were constructed by using solid circular and elliptical shapes of selected intensity (grey scale) values to mimic the basic shapes and intensities of typical comets. These comet images were then convolved with a 15 X 15 smoothing filter to make the appearance of the simulated comets more realistic. These simulated comets were then arrayed in a single image in an arrangement that would make their order of processing by the program predictable (for comparison purposes.)
14 Excellent Correlation Between Expected and Program Generated Analysis of Simulated Comets PROGRAM Moment R² = PROGRAM % DNA in Tail R² = EXPECTED PROGRAM R² = Tail Length EXPECTED EXPECTED
15 Trevigen Analysis System Provide Comparable Results for 4X and 10X Images in Standard Neutral Comet Assays Jurkat Cells treated with increasing concentrations of Bleocin Each treatment was analyzed and averaged over 2 wells. Images were acquired with 4X and 10X objectives. 10X images were analyzed using Loats Automatic Comet Work Station. 4X images were analyzed using Trevigen Comet Analysis Software.
16 Trevigen Analysis System Provide Comparable Results for 4X and 10X Images in Standard Neutral Comet Assays 20 Moment 60 % DNA in Tail 4X Image R² = X Image 150 4X Image Tail Length R² = X Image 100 4X Image 50 0 R² = X Image
17 Trevigen Analysis System Provide Comparable Results for 4X and 10X Images in the Standard Alkaline Comet Assay Trevigen Alkaline Control Cells were run on a 20 well slide. Each treatment was analyzed and averaged over 5 wells. Images were acquired with 4X and 10X objectives. 10X images were analyzed using Loats Automatic Comet Work Station and Trevigen Software. 4X images were analyzed using Trevigen Comet Analysis Software.
18 Trevigen Analysis System Provide Comparable Results for 4X and 10X Images in the Standard Alkaline Comet Assay % DNA in Tail Comparisons Trevigen software (4X tiff) R² = Trevigen software (10X tiff) R² = Loats automated system (10X) Loats automated system (10X) 4X vs 10X tiff images: 1:1 correlation between Trevigen software and Loats automated system
19 Test Inter and Intra run variability with CometChip Platform Design Electrophoresis and Analysis 30 Load 30 Treatment 0, 1.25, 2.5 and 5 µm Etoposide Duplicates rows (24 wells/treatment) Inter run variability Single CometChip experiments on 3 different days Intra run variability Three Comet Chip experiment on same day
20 <20% Variability between treated wells Single CometChip experiments % DNA in Tail, n=24 well medians % DNA in Tail, n=24 well medians % DNA in Tail, n=24 well medians um Etoposide avg sd cv um Etoposide avg sd cv um Etoposide avg sd cv ~123 cells counted/well ~135 cells counted/well ~139 cells counted/well Three Comet Chip experiment on same day % DNA in Tail, n=24 well medians % DNA in Tail, n=24 well medians % DNA in Tail, n=24 well medians um Etoposide avg sd cv um Etoposide avg sd cv um Etoposide avg sd cv ~146 cells counted/well ~148 cells counted/well ~119 cells counted/well
21 <10% Variability between CometChips with treated samples inter run variability (n= 3 CometChips ) um Etoposide avg sd cv intra run variability (n=3 CometChips ) um Etoposide avg sd cv Low well to well and slide to slide CVs. Consistent with United States Pharmacopeia (USP) guidelines for 96 well assays (ELISA) Meets ASCLS specifications No overlapping comets. Minimal or no editing required results in Unbiased data analysis
22 CometChip Platform Provides Reproducible Data with Minimal Well to Well Variation % DNA in Tail (n=3) HepaRG: 4 hr MMS treatment µg/ml MMS Trt A Trt B HepaRG cells treated with increasing concentration of MMS. Two separate experiments performed by different operators on the same day. Each concentration performed in triplicate.
23 Cost Assumptions Traditional Comet Assay $50/hour fully burdened labor Full electrophoresis run (10 slides 20 wells) 200 comets per well Analyze 150 or more comets Five pictures/ well 12 hours per 20 wells (4000 comets) $698/run $ per well 17 cents per comet CometChip $50/hour fully burdened labor Full electrophoresis run 3 chips (288 wells) 400 comets per well Analyze 150 or more comets 1 picture / well 10.5 hours per 288 wells (115,200 comets) $1500/run $5.2 per well cents per comet
24 Traditional Comet: Cost per Run/Well Dollars spent on Traditional Comet Assays $12,000 $10,000 $8,000 $6,000 $4,000 $2,000 $0 Runs Wells Reagents & labor costs same as 3 CometChips $5,584 $4,886 $4,188 $3,490 $2,792 $2,094 $1,396 $698 $10,470 $9,772 $9,074 $8,376 $7,678 $6,980 $6,282 Buy the System Complete CometChip Run $1500 (288 wells) 9 Traditional Comet Assays $6282 (180 wells) Item Dollars Software 2995 CometChip System 3570 Subtotal % Discount CometChip Kits 650 Total 6555
25 CometChip Platform Developed and Manufactured under ISO 9001/2008 guidelines Only Integrated and Standardized System. CometChip Well Former and Electrophoresis Systems CometChip and Reagents Comet Analysis Software resulting in run to run consistency Low well to well and slide to slide CVs. Consistent with United States Pharmacopeia (USP) guidelines for 96 well assays (ELISA) No overlapping comets. Minimal or no editing required results in Unbiased data analysis
26 > 5000% increase throughput. CometChip Platform Develop and analyze over five hundred thousand comets per week Software can analyze 4X images requiring fewer fields or pictures to be examined Use existing microscope cameras or automated high through put cell analysis systems. (i.e Biotek or Celligo instrument s). Software validated using computer generated comet images with known comet tail parameters. Final software. Compatible JPEG or Tiff images Alkaline and neutral comet Compatible with CometChip and Standard Comet
27 CometChip for Human Skin Genotoxicity Testing Goal: To treat a 3D skin culture using a genotoxic agent and quantify DNA damage in basal keratinocytes. Issue: Can we preferentially select basal keratinocytes? Human epidermis during differentiation lose their nuclei creating a heterogeneous background of DNA damage in the comet assay Method: Can we use extracellular matrix proteins? Basal cells in skin stained with Anti-Integrin Beta 1 (green) Integrin Beta 1 binds to Collagen 1 in Extracellular Matrix
28 Collaborator: Dean Rosenthal, Georgetown University Supported by NIEHS R41ES Patent Pending DermaChip Identifies and Analyzes DNA Damage in Integrin Beta 1 Basal Cells of Skin EpiDerm TM Skin Model DermaChip (contains Collagen 1) Control (No treatment) Dissociate skin into single cells Stain cells with Anti-Integrin Beta 1 Load DermaChip Alkaline Comet Assay 100 nm H 2 O 2 Integrin Beta 1 mediates binding of Basal Cells to Collagen 1 in micropores Basal Cells co-stained with Anti-Integrin Beta 1 (orange) and Syber Gold (green)
29 Load Load Wash Washing removes cells not binding to Collagen 1 Jurkat Collagen 1 Chip Treated HaCat Collagen 1 Chip HaCat Collagen 1 Chip Jurkats suspension line lacking Beta 1 Integrin HaCat adherent line with Beta 1 Integrin Treated HaCat over trypsinized to remove surface receptors HaCat Chip only
30 Poster Sessions 1335: The Development and Validation of EpiComet-Chip, a Modified High- Throughput Comet. T. A. Townsend 1, M. C. Parrish 2, S. D. Shelton 1, B. P. Engelward 2, M. G. Manjanatha 1. 1 US FDA/NCTR, Jefferson, AR, United States. 2 Massachusetts Institute of Technology, Cambridge, MA, 2267: In Vitro Micronucleus and CometChip with Metabolically Competent HepaRG Cells. C. Swartz 1, J. Winters 1, K. Owens 1, C. Yauk 2, J. Buick 2, B. Engelward 3, L. Ngo 3, L. Recio 1. 1 Integrated Laboratory Systems, Research Triangle Park, NC, United States. 2 Health Canada, Ottawa, ON, Canada. 3 Massachusetts Institute of Technology, Cambridge, MA, United States.
Automated Imaging and Analysis of a Novel Comet Assay to Enable High Throughput Genotoxicity Testing
A p p l i c a t i o n N o t e Automated Imaging and Analysis of a Novel Comet Assay to Enable High Throughput Genotoxicity Testing Brad Larson, BioTek Instruments, Inc., Winooski, VT Clare Whittaker and
More informationInstructions. CometChip Electrophoresis Starter Kit. Catalog# ESK. High-throughput platform to treat and measure DNA damage on a single slide
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometChip Electrophoresis Starter Kit Catalog# 4260-096-ESK High-throughput platform to treat and measure DNA damage on a single
More informationThe Need for a PARP Pharmacodynamic Assay
The Need for a PARP Pharmacodynamic Assay Version 05/07/09 amsbiotechnology(europe)ltd info@amsbio.com www.amsbio.com (UK)+44(0)1235828200 (CH)+41(0)916045522 (DE)+49(0)69779099 DNA Repair Pathways Base
More informationab Comet Assay Kit (3- well slides)
Version 1 Last updated 2 November 2018 ab238544 Comet Assay Kit (3- well slides) For the measurement of cellular DNA damage. This product is for research use only and is not intended for diagnostic use.
More informationInstructions. Starter Kit. CometChip Electrophoresis Starter Kit. Table of Contents. Cat# ESK. Catalog# ESK
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometChip Electrophoresis Starter Kit CometChip Electrophoresis Starter Kit Cat# 4260-096-ESK Catalog# 4260-096-ESK Table of Contents
More informationStandard Operating Procedure
Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) HTS Comet Assay with and without FPG - 20 wells Comet assay with and without FPG using Trevigen 20-well slides
More informationSingle Cell Microarray for High Throughput Detection of DNA Damage
Single Cell Microarray for High Throughput Detection of DNA Damage Example data Jing Ge, Jessica Fessler, Danielle Chow, and Bevin Engelward MIT Biological Engineering, Cambridge, MA Measuring DNA Damage
More informationCOMICS: developing high throughput comet assays for DNA damage and DNA repair
COMICS: developing high throughput comet assays for DNA damage and DNA repair Amaya Azqueta, on behalf of COMICS partners Department of Nutrition University of Oslo is an EC strategic targeted project
More informationTecniche di biodosimetria: COMET ASSAY. Giorgia Aversa Mail: om
Tecniche di biodosimetria: COMET ASSAY Giorgia Aversa Mail: giorgiaversa@gmail.c om The Comet Assay, also known as the Single Cell Gel Electrophoresis Assay, is a rapid, sensitive and relatively simple
More informationNeutral CometAssay Control Cells
Instructions For Research Use Only. Not For Use In Diagnostic Procedures Neutral CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4257-010-NC Sufficient materials for 10 assays.
More informationTraining session: comet assay on plants
Training session: comet assay on plants Dr Bertrand Pourrut, PhD Contact: bertrand.pourrut@isa-lille.fr Groupe ISA, Equipe Sols et Environnement, LGCgE Lille Nord de France, 59046 Lille Cedex ICAW 2015
More informationRaftNote. Imaging and Sorting Living Cells Stained with Vital Dyes on Cell Microsystems CytoSort Array and Automated CellRaft AIR System
RaftNote Applications and protocols for use with CellRaft Technology Imaging and Sorting Living Cells Stained with Vital Dyes on Cell Microsystems CytoSort Array and Automated CellRaft AIR System Jacquelyn
More informationCometAssay Control Cells
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4256-010-CC Sufficient materials for 10 assays. i i
More informationCometAssay Control Cells
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay Control Cells CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4256-010-CC For Single Cell
More informationCalcein AM Cell Viability Kit
Instructions For Research Use Only. Not For Use In Diagnostic Procedures Calcein AM Cell Viability Kit Catalog# 4892-010-K 1000 Tests* * Calculated based on using 1 μm final concentration of Calcein AM;
More informationNormalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5
Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent
More informationOxiSelect 96- Well Comet Assay Kit
Product Manual OxiSelect 96- Well Comet Assay Kit Catalog Number STA- 355 STA- 355-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction DNA damage, due to environmental
More informationThe Comet Assay How to recognise Good Data
The Comet Assay How to recognise Good Data William Barfield 4 th September 2015 ICAW Content Regulatory Genetic Toxicology JaCVAM trial overview and results Protocols Historical control data Statistics
More informationLabChip 90 System with DataViewer Software
Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic
More informationApplication Note 493
Corning PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty, Susan
More informationApplication Note. BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes
Page 1 BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty,
More informationInstructions For Research Use Only. Not For Use In Diagnostic Procedures
Instructions For Research Use Only. Not For Use In Diagnostic Procedures TACS TM MTT Cell Proliferation Assays TACS TM MTT Cell Proliferation Assays Cat# 4890-025-K, 2500 Tests Cat# 4890-050-K, 5000 Tests
More informationNEUTRAL COMET PROFILES: RELIABLE SYSTEM FOR ANALYSES OF DNA STRAND BREAKS DISTRIBUTION
Genetics and Plant Physiology 2015, Volume 5(1), pp. 10 14 Special Issue Project BG051PO001-3.3.06-0025 Support for training and development of young competitive experts in the field of physiology, phytochemistry,
More informationInstructions For Research Use Only. Not For Use In Diagnostic Procedures
Instructions For Research Use Only. Not For Use In Diagnostic Procedures TACS MTT Cell Proliferation Assays Cat# 4890-25-K, 2500 Tests Cat# 4890-50-K, 5000 Tests i E8/9/07v1 TACS MTT Cell Proliferation
More informationInstructions For Research Use Only. Not For Use In Diagnostic Procedures
Instructions For Research Use Only. Not For Use In Diagnostic Procedures 3D Culture Cell Harvesting Kit For harvesting and lysate preparation from 3D Culture for Western analysis Sufficient reagents for
More informationHow to Biotinylate with Quantifiable Results
How to Biotinylate with Quantifiable Results Introduction The Biotin-Streptavidin system continues to be used in many protein-based biological research applications including; ELISAs, immunoprecipitation,
More informationInnovations To Meet Your Needs
Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software
More informationab CFSE Fluorescent Cell Labeling Kit
ab113853 CFSE Fluorescent Cell Labeling Kit Instructions for Use For the durable fluorescent labeling of live cells for fluorescent microscopy and flow cytometry, population growth studies and within sample
More informationLive and Dead Cell Assay
ab115347 Live and Dead Cell Assay Instructions for Use Differential fluorescent labeling of live and dead cells This product is for research use only and is not intended for diagnostic use. Last Updated
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationELECTRONIC SUPPLEMENTARY INFORMATION (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) Naringin ameliorates radiation-induced hepatic damage
More informationZhor Senhaji Mouhri PhD Student Cancer Drug Discovery Lab, RI MUHC
The Comet Assay: DNA damage and beyond Molecular and Clinical Radiobiology Workshop McGill University Health Centre, June 17-19, 2015 Zhor Senhaji Mouhri PhD Student Cancer Drug Discovery Lab, RI MUHC
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationTREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures.
TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures. TACS TM XTT Cell Proliferation Assay Catalog # 4891-025-K, 2500 Tests The product accompanying this document is intended
More informationNeutral CometAssay Control Cells
Instructions For Research Use Only. Not For Use In Diagnostic Procedures Neutral CometAssay Control Cells Neutral CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4257-010-NC
More informationKnock! Knock! Who s there? Maurice Who? SungAe Suhr Park, Mee Ko, Eleanor Le, Janice Chen Amgen Inc.
Knock! Knock! Who s there? Maurice Who? SungAe Suhr Park, Mee Ko, Eleanor Le, Janice Chen Amgen Inc. Abstract SungAe Suhr Park, Mee Ko, Eleanor Le and Janice Chen Amgen Inc. Applications of Capillary Electrophoresis
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationAccelerating the Pace of Understanding
Vectra 3 P R O D U C T N O T E Quantitative Pathology Imaging and Analysis Key Benefits Part of PerkinElmer's Phenoptics workflow solution for Cancer Immunology Research Detect and measure multiple expressed
More informationab CFSE Fluorescent Cell Labeling Kit
ab113853 CFSE Fluorescent Cell Labeling Kit Instructions for Use For the durable fluorescent labeling of live cells for fluorescent microscopy and flow cytometry, population growth studies and within sample
More informationCELL HEALTH. reliable cell viability data. instant time savings. PrestoBlue Cell Viability Reagent
CELL HEALTH reliable cell viability data instant time savings PrestoBlue Cell Viability Reagent PrestoBlue Cell Viability Reagent Why should I use the PrestoBlue Cell Viability Reagent? PrestoBlue reagent
More informationAnalysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded. Dione K. Bailey Anniek De Witte October 9, 2007
Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded (FFPE) tumor samples by oligo array CGH Dione K. Bailey Anniek De Witte October 9, 2007 Agenda Oligo acgh Review Problems
More informationThe BioFlux 200 System Using Well Plate Microfluidics for Live Cell Assays Product Overview and Tutorial
The BioFlux 200 System Using Well Plate Microfluidics for Live Cell Assays Product Overview and Tutorial Introduction to the BioFlux System Enables live-cell assays with precisely-controlled shear flow
More informationLabChip GXII: Antibody Analysis
WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology
More informationImmunogenicity Assay Considerations
Immunogenicity Assay Considerations Jochem Gokemeijer Jochem.gokemeijer@bms.com Bioassays and Bioanalytics Method Development, Berkley CA October 8 th 2013 Multi Tiered Immunogenicity Assay Approach Screening
More informationSupplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence
- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT
More informationLSBio TM Mouse/Human/Rat Phospho-CASP3 / Caspase 3 Cell-Based Phosphorylation ELISA Kit. Catalog No. LS-F1328. User Manual
LSBio TM Mouse/Human/Rat Phospho-CASP3 / Caspase 3 Cell-Based Phosphorylation ELISA Kit Catalog No. LS-F1328 User Manual Please Read the Manual Carefully Before Starting your Experiment For research use
More informationNucView TM 488 Caspase-3 Assay Kit for Live Cells
NucView TM 488 Caspase-3 Assay Kit for Live Cells Catalog Number: 30029 (100-500 assays) Contact Information Address: Biotium, Inc. 3423 Investment Blvd. Suite 8 Hayward, CA 94545 USA Telephone: (510)
More informationGP 4 G SP biofunctional Helps energize and protect skin from environmental stresses, to enhance maintenance and repair. Ashland Specialty Ingredients
Helps energize and protect skin from environmental stresses, to enhance maintenance and repair 1 1 Helps energize and protect skin from environmental stresses, to enhance maintenance and repair. A Description
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationOdyssey Fc Imaging System Infrared fluorescent and chemiluminescent imaging in one system!
Odyssey Infrared Imaging System A fundamental change in western blot analysis Odyssey Fc Imaging System Infrared fluorescent and chemiluminescent imaging in one system! Accurate Quantification Wide linear
More informationBiomek Automated Genomic Sample Prep Accelerates Research
APPLICATION OVERVIEW Biomek Automated Genomic Sample Prep Accelerates Research Biomek Automation of the Beckman Coulter Agencourt Genfind v2 Blood & Serum DNA Isolation Kit Introduction The Agencourt Genfind
More information-ECVAM Skin Irritation Validation Study-
Version : 1.2 Page 1 of 16 September 2005 EPIDERMIS MODEL EPISKIN -ECVAM Skin Irritation Validation Study- VALIDATION OF THE EPISKIN SKIN IRRITATION TEST - 42 HOURS ASSAY FOR THE PREDICTION OF ACUTE SKIN
More informationTechnical Note. Housekeeping Protein Validation Protocol
Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationSupplementary Figure 1: (a) 3D illustration of the mobile phone microscopy attachment, containing a 3D movable sample holder (red piece for z
Supplementary Figure 1: (a) 3D illustration of the mobile phone microscopy attachment, containing a 3D movable sample holder (red piece for z movement and blue piece for x-y movement). Illumination sources
More informationCytoSelect 48-Well Cell Adhesion Assay (Laminin-Coated, Colorimetric Format)
Product Manual CytoSelect 48-Well Cell Adhesion Assay (Laminin-Coated, Colorimetric Format) Catalog Number CBA-056 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell
More informationRayBio Apoptotic DNA Ladder Extraction Kit
RayBio Apoptotic DNA Ladder Extraction Kit User Manual Version 1.1 March 1, 2016 RayBio Apoptotic DNA Ladder Extraction (Cat#: 68SO-DNAL-S50) RayBiotech, Inc. We Provide You With Excellent Support And
More informationINVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES
INVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES By Mehrnaz Keyhanfar, Pharm.D. A thesis submitted to the University of Adelaide, South Australia in fulfilment of the requirements
More informationCytoSelect 48- Well Cell Adhesion Assay (Laminin- Coated, Colorimetric Format)
Product Manual CytoSelect 48- Well Cell Adhesion Assay (Laminin- Coated, Colorimetric Format) Catalog Number CBA- 056 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell
More informationMultiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
More informationAbout us. Cyanagen s.r.l. has a certified Quality System ISO QUALITY CERTIFIED. Green Stain DNA Loading Dye Rev00
About us Cyanagen is a biotech company located in Bologna, dedicated to research, development and production of reagents for molecular diagnostic since 2003 and one of the leading companies in the field
More informationGREEN STAIN DNA LOADING DYE DNA LOADING DYE CONTAINING FLUORESCENT STAIN FOR NUCLEIC ACID DETECTION IN GELS
GREEN STAIN DNA LOADING DYE DNA LOADING DYE CONTAINING FLUORESCENT STAIN FOR NUCLEIC ACID DETECTION IN GELS About us Cyanagen is a biotech company located in Bologna, dedicated to research, development
More informationAndrogen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research
More informationCoMat: An Integrated Tool for Comet Assay Image Analysis
CoMat: An Integrated Tool for Comet Assay Image Analysis Udayakumar Mani A *, Pavithrakumari Manickam B A Assistant Professor, Department of Bioinformatics, SASTRA University, Thanjavur 613 401, Tamil
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0516 TITLE: Cadherin-11 Regulation of Fibrosis through Modulation of Epithelial-to- Mesenchymal Transition: Implications for Pulmonary Fibrosis in Scleroderma PRINCIPAL INVESTIGATOR:
More informationGenetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers
Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures
More informationWST-8 Cell Proliferation Assay Kit
WST-8 Cell Proliferation Assay Kit Item No. 10010199 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com Materials Supplied Kit will arrive packaged as a -20 C kit. For best
More informationInterlab G26. Fully Automated Agarose Gel Electrophoresis with Positive Sample Identification from Primary Tube
Interlab G26 Fully Automated Agarose Gel Electrophoresis with Positive Sample Identification from Primary Tube INTERLAB G26 Compact, Benchtop, Fully-Automated Agarose Gel Electrophoresis Analyzer with
More informationUsing a BioCel System and AssayMap Technology in Phage Display and Antibody Screening. Jason Graves September 20, 2011 AAS User Group Meeting
Using a BioCel System and AssayMap Technology in Phage Display and Antibody Screening Jason Graves September 20, 2011 AAS User Group Meeting My Background 15 Years of Automation and Related Experience
More informationUtilization of the ATPlite 1step Detection System for Homogeneous Automated Cytotoxicity Assays on the JANUS Cellular Workstation
Utilization of the ATPlite 1step Detection System for Homogeneous Automated Cytotoxicity Assays on the JANUS Cellular Workstation Introduction A number of strategies are currently being implemented in
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationA Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples
application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,
More informationYeast Nuclei Isolation Kit
Yeast Nuclei Isolation Kit Catalog Number KA3951 50 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationFlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK.
Drug Discovery Research Clinical Screening High Throughput Screening FlashPlate File #15 Use of Novel FlashPlate Technology to Measure camp Accumulation in Chinese Hamster Ovary Cells Expressing Human
More informationmirrorball accelerating antibody discovery
mirrorball accelerating antibody discovery meet mirrorball efficient antibody discovery is within your reach TTP Labtech s mirrorball fluorescence cytometer revolutionises the productivity of antibody
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationCharacterization of Aptamer Binding using SensíQ SPR Platforms
Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional
More informationMicroSEQ TM ID Rapid Microbial Identification System:
MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationProximity Ligation Assay
Proximity Ligation Assay ELISA Guidelines Related to Performing PLA in Cells The proximity ligation assay is a robust assay, and most users will have no difficulty obtaining appropriate results in various
More informationComparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques
Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application
More informationExoGlow -NTA Fluorescent Labeling Kit
ExoGlow -NTA Fluorescent Labeling Kit Cat # EXONTA100A-1 User Manual Store kit at +4 0 C Version 1 5/16/2017 A limited-use label license covers this product. By use of this product, you accept the terms
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationSupporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo
Supporting information Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Greg Thurber 1, Katy Yang 1, Thomas Reiner 1, Rainer Kohler 1, Peter Sorger 2, Tim Mitchison
More informationRapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationCat. # MK600. For Research Use. ApopLadder Ex. Product Manual. v201608da
Cat. # MK600 For Research Use ApopLadder Ex Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Features... 3 IV. Components... 3 V. Storage... 3 VI. Materials Required but not
More informationS ingle cell gel electrophoresis, or the comet assay, continues to attract growing interest as a tool to study the
OPEN SUBJECT AREAS: CELL CULTURE BIOMARKER RESEARCH Received 11 September 2014 Accepted 5 November 2014 Published 26 November 2014 Correspondence and requests for materials should be addressed to M.S.C.
More informationAssays for gene expression and protein production
Assays for gene expression and protein production Module 3, Lecture 5! 20.109 Spring 2011! Topics for Lecture 5 Measuring protein levels! Measuring transcript levels! Imaging assays! 2 Module overview:
More informationRayBio Human IL-1 alpha ELISA Kit (For Lysates)
RayBio Human IL-1 alpha ELISA Kit (For Lysates) Catalog #: ELH-IL1a-CL User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane,
More informationRadius 24-Well Cell Migration Assay (Fibronectin Coated)
Product Manual Radius 24-Well Cell Migration Assay (Fibronectin Coated) Catalog Number CBA-125-FN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly
More informationRadius 24-Well Cell Migration Assay (Laminin Coated)
Product Manual Radius 24-Well Cell Migration Assay (Laminin Coated) Catalog Number CBA-125-LN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly
More informationDetection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application
Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer Application Gerd Luedke and Tobias Preckel Abstract This Application Note describes how the
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationCometAssay Silver Kit
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay Silver Kit Reagents for Comet Assay and Staining with Silver Catalog # 4251-050-K E01/17/17 CometAssay Silver Kit Reagents
More informationCometAssay HT. Instructions For Research Use Only. Not For Use In Diagnostic Procedures. Catalog # K
Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay HT Reagent Kit for Higher Throughput Single Cell Gel Electrophoresis Assay Catalog # 4252-040-K CometAssay HT Reagent
More informationManual / epics -M H u m a n E p i d e r m i s E q u i v a l e n t w i t h M e l a n o c y t e s
/ H u m a n E p i d e r m i s E q u i v a l e n t w i t h M e l a n o c y t e s CellSysteMS your partner for over 20 years. We focus on primary and stem cells, organotypical 3D tissue models as well as
More information