Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Size: px
Start display at page:

Download "Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami"

Transcription

1 Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

2 Overview Several techniques are available to detect and analyse RNA. Examples of these techniques are: Northern blots, Western blots, and RNase protection assay (RPA). Theses techniques are labour-intensive and requires large amount of fully intact RNA.

3 Overview In contrast, newer method based on PCR is less time-consuming, more sensitive and is able to tolerate partially degraded RNA samples. This method is called:

4 Reverse Trasncription PCR (RT-PCR)

5 Invention of RT-PCR The idea of RT-PCR is based upon retroviruses. Retroviruses have an RNA rather than DNA genome. So they must use reverse transcriptase (RT) to covert their RNA genomes into DNA. Human Immunodeficiency Virus (HIV) is an example of a retrovirus.

6 Application of Rt-PCR RT-PCR is used to test RNA extracts from different tissues for the presence of a particular transcript in order to determine the expression pattern of a gene.

7 Principle of Rt-PCR RT-PCR enables RNA to be used as a template for PCR. RT-PCR comprises two steps: 1. The first step is reverse transcription (also called cdna synthesis). 2. The second step is the utilisation of cdna as a template in PCR.

8 Steps of Rt-PCR 1. cdna synthesis: This is the process of converting RNA to DNA using an enzyme called reverse transcriptase. The resulting DNA is complementary to the RNA template, so it is called complementary DNA (cdna).

9 Steps of Rt-PCR 2. The use of cdna as a template in PCR:

10 Steps of Rt-PCR 2. The use of cdna as a template in PCR: Once the cdna is synthesised from step-1, the PCR primers and Taq polymerase are added and the experiment proceeds exactly as in the standard PCR technique. The amount of PCR product is indicative of the starting amount of input cdna (and by interference, RNA that it was generated from).

11 Steps of Rt-PCR RT-PCR can be performed in two steps, with an RT reaction occurring first, then using that product as a template in a PCR reaction. Alternatively, RT-PCR can be carried out in one step with both reaction occurring in one tube.

12 Ingredients of Rt-PCR The reaction tube of RT-PCR contains the following: Reverse transcriptase: the enzyme catalyses the reverse transcription reaction. There are several commercially available enzymes usually isolated from retroviruses. Buffer. dntps (like those used in PCR), and they will be incorporated into the newly synthesised cdna strand. Primers: which are required to synthesis cdna. RTPCR requires only one primer because only one strand of cdna is made.

13 Primers categories Primers fall into three categories: Oligo-dT, randomers (hexamers) and gene specific. 1. Oligo-dT primers: will specifically anneal to polya tails found on most eukaryotic mrnas. This type of primers cannot be used with prokaryotic RNA. 2. Gene Specific primers: cannot be used if we want to prime cdna synthesis from all the RNAs in the cell. 3. Random hexamers primers: have the ability to anneal to all types of RNA without knowledge of sequence. They are a pool of primers designed to represent all possible combinations of sixbase pair stretches. This design allows for the primers to bind to all RNA sequences.

14 Crucial Aspect Controls RT-PCR experiment DNA contamination must be avoid in RT-PCR experiment. If DNA still present in the RNA sample, it can be amplified by the gene specific primers that amplify the cdna leading to inaccurate quantification of mrna levels.

15 Crucial Aspect Controls RT-PCR experiment To avoid DNA contamination, two approaches can be used: 1. Treat the sample with DNase. 2. Use in the reaction a negative control which dose not contain reverse transcriptase enzyme (-RT). If the DNA is effectively eliminated from the starting material (RNA sample), amplification using -RT cdna template should show no product. The corresponding +RT cdna template should result in a product.

16 THANK YOU REFERENCE: MOLECULAR BIOLOGY TECHNIQUES: A CLASSROOM LABORATORY MAUAL

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Reverse Transcription & RT-PCR

Reverse Transcription & RT-PCR Creating Gene Expression Solutions Reverse Transcription & RT-PCR Reverse transcription, a process that involves a reverse transcriptase (RTase) which uses RNA as the template to make complementary DNA

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

RNA-related Products

RNA-related Products RNA-related Products TRANSCRIPTME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 PAGE: 1 of 13 SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 AUTHOR: Nicholas Marko PRIMARY REVIEWERS: Renee Rubio, Bryan Frank 1. PURPOSE This protocol describes the procedure for amplifying RNA

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Critical Factors For Successful Real-Time RT-PCR

Critical Factors For Successful Real-Time RT-PCR Critical Factors For Successful Real-Time RT-PCR Andreas Missel, PhD Senior Scientist R&D Dept. Modification/Amplification QIAGEN Annealing Specific product High yield High sensitivity Nonspecific product

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting

Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting Dr Steffen Muller Field Applications Scientist Stratagene Europe Overview The Importance of Controls Validation and Optimization

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

PCR KIT/REAGENTS/BUFFERS/PRIMERS

PCR KIT/REAGENTS/BUFFERS/PRIMERS PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

Procomcure Biotech. PCR Reagents

Procomcure Biotech. PCR Reagents Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Real Time PCR (qpcr) Dott. Finetti Luca

Real Time PCR (qpcr) Dott. Finetti Luca Real Time PCR (qpcr) Dott. Finetti Luca fntlcu1@unife.it PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Theoretically: 2 n PCR (Polymerase Chain Reaction) It often used as a qualitative

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

NxGen M-MuLV Reverse Transcriptase

NxGen M-MuLV Reverse Transcriptase NxGen M-MuLV Reverse Transcriptase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

MonsterScript Reverse Transcriptase

MonsterScript Reverse Transcriptase MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

SunScript TM One Step RT-qPCR Kit

SunScript TM One Step RT-qPCR Kit INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

SunScript One Step RT-PCR Kit

SunScript One Step RT-PCR Kit SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...

More information

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003)

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003) EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP-10002 & EP-10003) INSTRUCTION MANUAL *These products are designed and sold for use in the Polymerase Chain Reaction (PCR)

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)

More information

AMV LongAmp Taq RT-PCR Kit

AMV LongAmp Taq RT-PCR Kit DNA AMPLIFICATION & PCR AMV LongAmp Taq RT-PCR Kit Instruction Manual NEB #E5300S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

Quantscript RT Kit. For first-strand cdna synthesis and two step RT-PCR.

Quantscript RT Kit. For first-strand cdna synthesis and two step RT-PCR. 1. Quantscript RT Kit For first-strand cdna synthesis and two step RT-PCR www.tiangen.com ER121221 Quantscript RT Kit Cat. no. KR103 Kit Contents Contents KR103-03 25 rxn KR103-04 100 rxn Quant Reverse

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

PCR settings, pitfalls and artefacts

PCR settings, pitfalls and artefacts De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en

More information

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire 2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic

More information

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host). STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat

More information

QIAGEN Supplementary Protocol

QIAGEN Supplementary Protocol QIAGEN Supplementary Protocol QIAGEN OneStep RT-PCR Kit Research Protocol for swine-origin influenza A virus (S-OIV) using end-point PCR This protocol is for use in swine-origin influenza A (H1N1) virus

More information

RT007 AMV Reverse Transcriptase

RT007 AMV Reverse Transcriptase Kit Components RT007 AMV Reverse Transcriptase Cat# BSA01S2 BSA01M2 Components 200 Units 1000 Units RT Buffer(5X/10X) 1.0ml 1.0 ml 4 AMV Reverse Transcriptase (10U/ l) 20 l 100 l Description RT007 AMV

More information

Techniques and strategies in molecular medicine

Techniques and strategies in molecular medicine Techniques and strategies in molecular medicine RNA detection and quantitation Dr Shane Duggan Institute of Molecular Medicine St James Hospital TCD Central Dogma Receptor Cytokine Why and how RNA mrna

More information

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,

More information

TB Green Premix Ex Taq (Tli RNaseH Plus)

TB Green Premix Ex Taq (Tli RNaseH Plus) Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.

More information

PCR Amplifies Targeted Sequence

PCR Amplifies Targeted Sequence PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for

More information

Methods that do not require growth in laboratory PCR

Methods that do not require growth in laboratory PCR Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences

More information

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription... Table of Contents I. Kit Components...2 II. III. Storage...2 Principle...2 IV. Precautions for operation...3 V. Protocol : reverse transcription...3 VI. Protocol : Real-time PCR...5 VII. Appendix...7 VIII.

More information

PrimeScript II 1st strand cdna Synthesis Kit

PrimeScript II 1st strand cdna Synthesis Kit Cat. # 6210A/B For Research Use PrimeScript II 1st strand cdna Synthesis Kit Product Manual Table of Content I. Description... 3 II. Components... 3 III. Storage... 4 IV. 1st Strand cdna Synthesis Reaction...

More information

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...

More information

Table of Contents. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...6. PCR Condition...8. VIII. Application...

Table of Contents. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...6. PCR Condition...8. VIII. Application... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. VII. Protocol...6 PCR Condition...8 VIII. Application...8 IX. Preparation of RNA Sample... 10

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

ncounter Low RNA Input Amplification Kit

ncounter Low RNA Input Amplification Kit ncounter Low RNA Input Amplification Kit The ncounter Low RNA Input Amplification Kit is designed to produce sufficient target for detection in an ncounter hybridization assay. This multiplexed target

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Taura Syndrome Virus (TSV) RT-PCR Kit

Taura Syndrome Virus (TSV) RT-PCR Kit Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro

More information

Principles of Real Time PCR Ameer Effat M. Elfarash

Principles of Real Time PCR Ameer Effat M. Elfarash Principles of Real Time PCR Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg Types of PCR Standard PCR (conventional ) RT-PCR (Reverse Transcriptase PCR)

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

PCR & qpcr. Complete PCR Solutions. enzolifesciences.com

PCR & qpcr. Complete PCR Solutions. enzolifesciences.com PCR & qpcr Complete PCR Solutions INTEGRATED PCR-BASED TECHNOLOGIES Polymerase chain reaction (PCR) is an essential DNA/RNA amplification and detection technique widely used in research today. Whereas

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님

Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Title : Study that the Drug A inhibits the accumulation of fat. Schedules 1. Mouse necropsy : take up the blood and major tissues(organs) ex) heart, liver, fat,

More information

Computational Biology 2. Pawan Dhar BII

Computational Biology 2. Pawan Dhar BII Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Hairpin-it TM mirnas qpcr Quantitation Kit

Hairpin-it TM mirnas qpcr Quantitation Kit Hairpin-it TM mirnas qpcr Quantitation Kit For the detection and quantification of micrornas using real-time PCR detection instruments. Catalog No. QPM-010/ QPM-011/ QPM-012/ QPM-013 User Manual Table

More information

PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time)

PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time) For Research Use PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided...

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical

More information

Other Polymerase Chain Reac3on (PCR) Methods

Other Polymerase Chain Reac3on (PCR) Methods Other Polymerase Chain Reac3on (PCR) Methods What is PCR? The Reaction Components 1) Target DNA - contains the sequence to be amplified. 2) Pair of Primers - oligonucleotides that define the sequence to

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

Table of Contents. I. Description...2. Kit Components...2. Materials Required but not Provided...3. Storage...3. V. References...3. Principles...

Table of Contents. I. Description...2. Kit Components...2. Materials Required but not Provided...3. Storage...3. V. References...3. Principles... Table of Contents I. Description...2 II. III. IV. Kit Components...2 Materials Required but not Provided...3 Storage...3 V. References...3 VI. VII. Principles...4 Features...5 VIII. Preparation of RNA

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

primer sense. - 3 primer antisense 5 - TAC AAG TAC TCA GAT CTC GAG CTC AAG CTT CGA ATT CNN NNN NNN NNN ATG NNN

primer sense. - 3 primer antisense 5 - TAC AAG TAC TCA GAT CTC GAG CTC AAG CTT CGA ATT CNN NNN NNN NNN ATG NNN Activity that you must complete by Sunday November 11 th at 12 EGFP TAC AAG TAC TCA GAT CTC GAG CTC AAG CTT CGA ATT CTG CAG TCG 5-5 - restriction enzyme S restriction enzyme A restriction enzyme S restriction

More information

User Manual. Version 5. Published February Catalog No. K1021 ~

User Manual. Version 5. Published February Catalog No. K1021 ~ GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------

More information