Mechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element

Transcription

1 Molecular Cell Supplemental Information Mechanism of ranscription ermination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Aneeshkumar G. Arimbasseri and Richard J. Maraia

2 Full length Figure S1, related to Figure 1 A Primer - terminator distance ime (s) 6 nt 12 nt 18 nt 24 nt RNAPIII-holo B erminator GAGCGGAA R B R B C im e (s) terminator D im e (s) terminator U { { 6U

3 Figure S2, related to Figure 1 A B ime (S) 0 < min 1 min 30 sec 10 sec 5 sec 3 sec 2 sec C D 5' 3' CGGACGACGAAACAGACGACAG GCCGCGCGCGCGCAAAAAAAAA 3' 5' 5' 3' CGGACGACGAAAGGCGCAAGAC GCCGCGCCCGCGCGAAAAAAAAA 3' 5' Primer binding erminator region

4 Figure S3, related to Figure 3 A B 0 3U min 3U 5s 30s 10 min Nucleotide position 9 D E RNAPIII-core+C11 2 3U H RNAPIII-core+ C53/C37+C11M ime (s) RNAPIII-core+ C53nt +C37/C11 ime (s) 0.5 ime (s) U 1 F RNAPIII-core+C53/C37 ime (s) G 30s 10 2 ime (S) s RNAP III-core 1 RNAP III-core RBR BRB R B RNAP III-holo ime (S) C 8U 6U 2U 7U 5U 3U RNAP III-core I RNAPIII-core+ C53/C37_ C seconds ime (s) core core+c11 core+c53/c37 core+c53/c37/c11 core+c53/ C37_ /C11 core+c53/ C37_ /C11 core+c53/c37/c11m core+c53nt /C37/C holo

5 Figure S4, related to Figure 4 A ermination efficiency on 7 terminator 80 SM R B B RNAP III-holo E(%) C 0 None 5 4 erminator substitution with A erminator

6 Figure S1, related to Figure 1: erminator pausing is independent of template design. A) ime course analysis of templates with varying distances between 3 end of the primer and terminator as indicated above the lanes. Red asterisks to the left of the lanes indicate U4 pausing for each template. Blue lines to the left of the lanes indicate read through transcripts for each template. B) ranscript release assay for templates with and without the homopolymeric 9 terminator at the position indicated to the left. Lanes 1 & 2 show standard template while lanes 3 & 4 show a template in which the terminator was replaced with a random heteropolymeric sequence (designated AGO184/185; sequence provided in Extended data able 1, lanes 1-2 show template sequence AGO7/16). C&D) ime-course analyses of (C) 7 terminator and (D) 6 terminator. Pause at 1-4 is most obvious at 5 and 10 seconds. indicates terminated RNAs and indicates read through transcripts. Red brackets to the left of lanes 4 of C & D highlights the pause at position 1-4 at early time points. Lanes 2 time point is approximate. Figure S2, related to Figure 1: PC formation is independent of DNA sequence upstream to the terminator. A) Gel image showing time course analysis of a template DNA whose sequence between the terminator and primer binding site differs from that in figures 1-4 (AGO176/177; sequence provided in Extended data able 1). Positions of 1 st, 4 th and 9 th U residues of released RNA are shown. B) Lane tracings of band intensities over the terminator for the corresponding time points are compared to show that the pause extends to 5 on this template; sequence context can affect termination (see text). Red asterisk below indicates 4 position and numbers on the top indicate all

7 terminator positions. C) DNA sequence used in this figure. D) DNA sequence used in most other figures. Green font indicates primer binding site and black indicates terminator; differences are in red. Figure S3, related to Figure 3: C53/C37/C11 are required for PC formation. A) ime course analysis of total transcripts for RNAP III-core., 3U, & represent transcripts with corresponding rus at their 3 ends. shows size of terminated transcripts and shows read through. B) comparison of profiles of band intensities over the terminator for RNAP III-holo and RNAP III-core at the time points shown to the right. RNAP III-holo profiles are from Fig 1 and RNAP III-core profiles are from the image on the left. Red asterisk below RNAP III-core indicates the transcription arrest at 3 and a blue asterisk indicates pause at 4 for RNAP III-holo. C) ime course of transcript release by RNAP III-core. R & B show released and bound transcripts respectively. D-H) ime course analysis of transcription by RNAP III-core with recombinant subunits D) C11-wt, E) C53/C37 dimer, F) C53nt /C37/C11, G) C53/C37/C11_D91AE92A (C11M) and H) C53/C37_ Δ/C11. Labeling conventions are same as for previous figures. I) Comparison of lane trace profiles of 5 second time points of RNAP III-holo (from Fig. 1) and RNAPIII-core with variations of C53/C37 and C11 to highlight pause at 1-4. Figure S4, related to Figure 4: he first four nucleotides of the terminator element for RNAP III carry the most information. A) Graph showing termination efficiencies of templates with an uninterrupted 7 terminator (none) and ones that bear a single A substitution at the indicated positions of the non-template strand. E was calculated as

8 described in Experimental Procedures (main text). Values and error bars are average and standard deviation of three experiments. B) PCs formed on template with 5->A substitution at N strand were isolated and incubated with buffer lacking NPs and MgCl2 for 1 minute. he starting material (SM), as well as the total (), released (R) and bound (B) samples are shown (see the main figure 2 and associated results text). indicates read through. C) Genome-wide analyses of RNAP III termination signals. Sequence logo of RNAP III terminators from the indicated species, derived from data compiled for figure 5C in (Iben & Maraia, RNA 18: ), courtesy of James Iben. Sequences from the 2 nucleotides upstream of the beginning of the first stretch following the trna sequences are shown. (Japonicus = schizosachharyomyces japonicus, cerevisiae=saccharomyces cerevisiae, pombe=schizosaccharomyces cerevisiae). Supplemental able (separate excel file) able S1, related to experimental procedures: List of oligos used in this study. All DNA and RNA oligonucleotides used are listed. N and in the column strand indicate non-template and template strands respectively. Figure column indicate the figures in which each oligo is used and remarks column lists specific features of each oligo.

9 SUPPLEMENAL EXPERIMENAL PROCEDURES EC assembly and transcriptions: For each reaction, RNAP III (-holo or -core) was immobilized on 50 µl of Ni-NA resin washed with 1X EC buffer (40 mm HEPES ph 7.8, 3 mm 2-mercaptoethanol, 5% glycerol and 100 µg/ml BSA) to which an annealing solution containing 100 mm NaCl and 10 picomole of template strand DNA and 20 picomole of radiolabeled RNA primer was added. After a 10 minute incubation, 20 picomole of N strand DNA was added and incubated for another 10 minutes. he ECs were washed thrice with 1X EC buffer containing 100 mm NaCl, once with 1X EC buffer with 1M NaCl, and followed by a wash with 1X EC buffer with 100 mm NaCl. For reconstitution using RNAP III-core and C53/C37/C11, the recombinant subunit proteins were incubated with RNAP III-core before immobilization (incubation after EC assembly gives identical results). When C53/C37 or C11 was used alone, the proteins were added after EC assembly to prevent dissociation during subsequent washes. ranscription reactions were started by adding 6X NP mix having 3 mm of each NPs and 42 mm MgCl2. Reactions were stopped at the specified points by adding 200 µl transcription stop buffer (10 mm ris Cl ph 8, 10 mm EDA, 1% SDS and 200 ng/µl proteinase K (Qiagen)) and incubated at 50ºC for 10 minutes before phenol-chloroform extraction and precipitation of nucleic acids. Precipitated nucleic acids were resuspended in formamide loading dye and resolved on a 15% denaturing gel. ranscripts were visualized using a phosphorimager. Quantitation of bands and lane tracings were done using MultiGauge software (FUJI). ime points indicated as 0.5 seconds is approximate but was clearly prior to 1 second.

10 Isolation of PCs and chase experiments: For these experiments, reactions were done in filter cups (Costar Spin-X tubes) as described: After adding the NP mix, the tube is mixed by taping thrice and immediately placing the open tubes in a benchtop micro centrifuge (Eppendorf centrifuge 5424). After 9 seconds of reaction, the short spin option was used for 6 seconds to collect the released fraction in the lower collection vessel while the beads remain in the filter cup upper compartment of the Costar Spin-X tube. his centrifuge model automatically opens the lid immediately after the spin enabling rapid addition of buffer to the open tubes. By this approach collection of the released fraction is complete within 15 seconds and the lag time between separation and addition of buffer is the ~10 seconds that the centrifuge takes to stop, open the lid and to add buffer. After the buffer is added, reactions are continued for 1 minute before adding stop buffer (otal fraction) or separation of supernatants and beads (released and bound fractions). he stopped samples were then incubated with proteinase K (20 µg/sample) at 55ºC for 10 minutes followed by phenol chloroform extraction and precipitation.