Material and methods. Samples
|
|
- Camron Chambers
- 6 years ago
- Views:
Transcription
1
2
3
4 290 Material and methods Samples Six strains, derived from single females collected in the wild, from different D. gouveai population were analyzed: J79L67 (Ibotirama/BA); J18E2 (Pireno polis/go); H27S1 (Peixoto/MG); H74M2 (Altino polis/sp); J82F3 and J83F3 (Analândia/ SP). Their geographical localization is presented in Figure 2. The Ibotirama locality belongs to Caatinga Domain, where there are many cactaceae species. The other localities studied are sandstone table hills, such as Analaˆ ndia/sp (Figure 1), with Pilosocereus vilaboensis (Pireno polis/go) or Pilosocereus machrisii (all another localities) growing in the rock fields of hilltops. Isolation of pbum-2 satellite DNA and sequence analysis The genomic DNA of the Drosophila specimens was extracted according to Preiss, Hartley and Artavanis-Tsakonas (1988). To isolate the copies of the pbum-2 family, reactions of PCR were carried out using the specific primers P1 (5 -CGG AGT ATT TTT CAT TCG AC-3 ) and P2 (5 - GGT ATG CCA TAA AGA AGT CG-3 ). The resultant bands of approximately 400 bp were eluted from the gel by overnight incubation in an elution solution (500 mm NaAc; 1 mm EDTA). The recovered fragments were cloned using the pmosblue blunt ended cloning kit RPN 5110 (Amersham Pharmacia Biotech). The recombinant clones were identified by the blue-white system of the gene from b-glycosidase (Sambrook, Fritsch & Maniatis, 1999). The DNA template reaction for sequencing was prepared according to the BigDye Terminator Cycle Sequencing Ready Reaction Kit manual (Perkin-Elmer). Automatic DNA sequencing was performed on an ABI Prism TM 377 sequencer (Perkin-Elmer). The alignment of the sequences was carried out in the CLUSTAL W (version 1.8, Thompson, Higgins & Gibson, 1994). The genetic distances were calculated according to the Kimura 2 parameters model (Kimura, 1980) using the MEGA 3.0 program (Kumar, Tamura & Nei 2004). The distance matrix was used to make a dendrogram using the Neighbor-Joining method (Saitou & Nei, 1987). Analysis of molecular variance (AMOVA) of the pbum-2 satellite DNA family from D. gouveai was performed using the ARLEQUIN software (Schneider et al., 2000), according to the method described in Excoffier, Smouse and Quattro (1992). To compare the values found for D. gouveai, a AMOVA with the pbum-1 sequences from D. buzzatii (Kuhn et al., 2003) and the pbum-2 sequences from D. seriema (Kuhn & Sene, 2004) was performed. Results and discussion Figure 2. Drosophila gouveai collection sites in Brazil. (1) Ibotirama/BA (12 16 S; W) (J79L67 strain). (2) Pireno polis/ GO (15 48 S; W J18E2 strain). (3) Peixoto/MG (20 23 S; W H27S1 strain). (4) Furnas/MG (20 37 S; W H24S1 strain). (5) Altinópolis/SP (21 48 S; W H74E2 strain). (6) Analândia/SP (22 08 S; W J82F3 and J83F2 strains). BA, Bahia state. GO, Goiás state. MG, Minas Gerais state. SP, São Paulo state. Twenty eight pbum-2 satellite DNA monomers were obtained: seven from locality (1) (GenBank accession nos. AY AY953030), four from locality (2) (GenBank accession nos. AY AY953034), two from locality (3) (GenBank accession nos. AY AY953051), four from locality (4) (GenBank accession nos. AY AY953049) and 11 from locality (6) (GenBank accession nos. AY AY953045). These sequences were analyzed together with eight previously described pbum-2 sequences from locality (4) (Kuhn & Sene, 2005) (GenBank accession nos. AY AY656608). The high nucleotide similarity among the sequences obtained in this
5
6 ), no repetition unit of the pbum-2 satellite DNA characteristic of D. antonietae was observed in the population of Analaˆ ndia/sp locality. This could be related to the observations that mitochondrial genes tend to introgress more easily than the nuclear genes (Dorado, Rieseberg & Arias, 1992; Arnold, 1993). The most cited explanations for this observation are related to cytonuclear disequilibria processes (Arnold, 1993) and sterility of hybrid males (Aubert & Solignac, 1990). The values of genetic distance, based on the Kimura 2 parameter model (Kimura, 1980), among all the pbum-2 sequences analyzed from the six D. gouveai populations showed high level of similarity (with values ranging from 0 to 0.045, with an average of Table 1). Moreover, the average genetic distance in each population reached as maximum value, showing that the intrapopulational variation is similar to the interpopulational variation (Table 1). Furthermore, there was no occurrence of an assembly of all sequences from the same population in the same branch in a NJ dendrogram (Figure 4), indicating that the pbum-2 is highly conserved among the D. gouveai populations. The AMOVA of pbum satellite DNA sequences was performed considering each population as a group, showing that 100% of the total genetic diversity could be ascribed to intrapopulational variability in D. gouveai, with no interpopulational differentiation. The Fct (fixation index among groups) calculated was low (0.006) and without statistical support (Table 2). Previous studies revealed a high degree of similarity of pbum-1 satellite sequences among 13 D. buzzatii populations in South America (Kuhn et al., 2003) and pbum-2 satellite sequences Table 1. Intrapopulational and total genetic distance calculated for pbum-2 satellite DNA in D. gouveai, according Kimura 2 parameters model (Kimura, 1980) Population Ibotirama/BA (J79L67) Pireno polis/go (J18E2) Analândia/SP (J82F3 and J83F2) Altinópolis/SP (H74M2) Peixoto/MG (H27S1) Furnas/MG (H24S3) Total average Average genetic distance Figure 4. Neighbor-joining dendrogram showing the relationships of genetic distance in the repetition units of the pbum-2 satellite DNA analyzed in this work. Only the values of bootstraps above 50% are shown (based on 1000 replicates). The scale bar represents genetic distances calculated according to Kimura 2 parameter method. J79L67 (Ibotirama/BA, locality 1), J18E2 (Pireno polis/go, locality 2), J82F3 and J83F2 (Analândia/SP, locality 6), H74E2 (Altinópolis/SP, locality 5), H24S1 (Furnas/MG, locality 4), H27S1 (Peixoto/MG, locality 3). among five D. seriema populations in Brazil (Kuhn & Sene, 2004). In both cases, no single population, or groups of geographically close populations, could be distinguished by pbum sequences. Such a lack of interpopulational differentiation was discussed in terms of past gene flow events among populations, which is compatible with the results obtained from other genetic markers analyzed in the same populations. Interpopulational analysis of satellite DNA in other insect species also showed high levels of homogenization of the sequences (Bachmann, Venanzetti & Sbordoni, 1994; Bachmann et al., 1998; Lorite et al., 2002). For comparative proposes, the pbum satellite DNA sequences from D. buzzatii (Kuhn et al., 2003) and D. seriema (Kuhn & Sene, 2004) were also analyzed by AMOVA. The results were similar to that found in D. gouveai, i.e., small and insignificant Fct values (Table 2), showing that satellite pbum sequences are extremely conserved on intraspecific level.
7
8
9
Genetic variation of captive green peafowl Pavo muticus in Thailand based on D-loop sequences
Short Communication Genetic variation of captive green peafowl Pavo muticus in Thailand based on D-loop sequences AMPORN WIWEGWEAW* AND WINA MECKVICHAI Department of Biology, Faculty of Science, Chulalongkorn
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More information1. Template : PCR or plasmid :
1. Template : PCR or plasmid : + Plasmid : 200 ng in sequencing reaction needed + PCR product : depend on the size : 100-200bp : 1-3 ng 200-500bp : 3-10 ng 500-1000bp : 5-20 ng 1000-2000bp : 10-40 ng >
More informationCharacterization of microsatellites in the fungal plant pathogen, Sclerotinia sclerotiorum
1 2 3 4 Characterization of microsatellites in the fungal plant pathogen, Sclerotinia sclerotiorum 5 6 7 8 9 Caroline Sirjusingh and Linda M. Kohn, Department of Botany, University of Toronto at Mississauga,
More informationGenetic population structure of shortfin mako (Isurus oxyrinchus) inferred from mitochondrial DNA on interoceanic
ISC/11/SHARKWG-1/02 Genetic population structure of shortfin mako (Isurus oxyrinchus) inferred from mitochondrial DNA on interoceanic scale 1 Mioko Taguchi National Research Institute of Far Seas Fisheries,
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationSupplemental Data. Osakabe et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Phylogenetic analysis of KUP in various species. The amino acid sequences of KUPs from green algae and land plants were identified with a BLAST search and aligned using ClustalW
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationOn the pbum189 satellite DNA variability among South American populations of Drosophila buzzatii
Hereditas 139: 161 166 (2003) On the pbum189 satellite DNA variability among South American populations of Drosophila buzzatii GUSTAVO C. S. KUHN, FERNANDO F. FRANCO, WILSON A. SILVA JR, NILCE M. MARTINEZ-ROSSI
More informationFigure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationI. Things to keep in mind before you start this protocol
Inverse PCR and Sequencing Protocol on 5 Fly Preps For recovery of sequences flanking piggybac elements This protocol is an adaptation of "Inverse PCR and Cycle Sequencing Protocols" by E. Jay Rehm Berkeley
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More information13-2 Manipulating DNA Slide 1 of 32
1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationamplification of the 5 flanking region of CAT1 with a tail for the geneticin resistance gene cassette fusion CAT1-3F
Supplementary materials Table S1. Primer list. Primer Sequence a (5-3 ) Description CAT1-5F CAT1-5R ATACGGATAAGGAAGCGATAGCAGCA gcacaggtacacttgtttagagagcgatccggattttaagtgaacg amplification of the 5 flanking
More informationGenetic diversity and phylogenetic relationships of Romanian cattle breeds inferred from cytochrome b gene partial sequences
Romanian Biotechnological Letters Vol. 15, No.2, 2010 Copyright 2010 University of Bucharest Printed in Romania. All rights reserved ORIGINAL PAPER Genetic diversity and phylogenetic relationships of Romanian
More informationStudies on the Genetic Diversity of Wild Populations of Masu Salmon, Oncorhynchus mason mason, by Microsatellite DNA Markers
Studies on the Genetic Diversity of Wild Populations of Masu Salmon, Oncorhynchus mason mason, by Microsatellite DNA Markers Daiki NOGUCHI1,2 and Nobuhiko TANIGUCHI1,2 Abstract: A large number of hatchery
More informationHetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
More informationTRANSPOSON INSERTION SITE VERIFICATION
TRANSPOSON INSERTION SITE VERIFICATION Transposon and T-DNA insertion in Arabidopsis genes can be identified using the Arabidopsis thaliana Insertion Database (ATIdb) (http://atidb.org/cgi-perl/gbrowse/atibrowse).
More informationAPPENDIX S1. The SSR-patchwork protocol for SSR libraries.
Di Maio and De Castro Applications in Plant Sciences 2013 1(1): 1200158. Appendix S1 Page 1 APPENDIX S1. The SSR-patchwork protocol for SSR libraries. LEGEND * HINT ATTENTION REST I. DNA extraction and
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationMOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV)
Trans. Natl. Acad.Sci. Tech. Philippines 21: 287-291 (1999). ISSN 0 J J 5-8848 MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV) VERMANDO M. AQUINO I, HUI WANG2, EVELYN MAE
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More information1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:
1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by
More informationMitochondrial DNA variation in the Japanese harbour porpoise (Phocoena phocoena)
Mitochondrial DNA variation in the Japanese harbour porpoise (Phocoena phocoena) Mioko Taguchi, S. Abe and T. Matsuishi Graduate School of Fisheries Sciences, Hokkaido University, 3-1-1 Minato-cho, Hakodate,
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More informationAnalysis in Forensic Science
Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science
More informationA Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al.
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al. Supplementary Notes Origin of NMR19 elements Because there are two copies
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationCalifornia Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More information4/26/2015. Cut DNA either: Cut DNA either:
Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationIDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
More informationNextera DNA Sample Prep Kit (Roche FLX-compatible)
Cat. Nos. FL09115, FL091120, and FLBC0950 The is designed to prepare genomic DNA libraries compatible with the Roche 454 Genome Sequencer FLX System, with standard FLX chemistry. Nextera technology* employs
More informationMolecular Identification and Phylogenetic Analysis of Pseudoperonospora cubensis Isolates in Peninsula Malaysia
Pertanika J. Trop. Agric. Sci. 35 (S): 79-84 (2012) TROPICAL AGRICULTURAL SCIENCE Journal homepage: http://www.pertanika.upm.edu.my/ Molecular Identification and Phylogenetic Analysis of Pseudoperonospora
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationSanger Sequencing Portfolio
Molecular Cloning Laboratories Sanger Sequencing Portfolio Significant Cost Savings vs ABI Uncompromised Performance Longer Read Length Longer Shelf Life No Recalibrations Necessary PAGE 1 BrightDye Terminator
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationNZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationHigh Pure Technology and Silica Adsorption High Pure PCR Product Purification Kit
for purification of DNA from PCR reactions Cat. No. 1 73 668 (50 purifications) Cat. No. 1 73 676 (50 purifications) Principle In the presence of chaotropic salt, product DNA binds selectively to glass
More informationNextera DNA Sample Prep Kit
Nextera DNA Sample Prep Kit (Roche FLX-compatible) Cat. Nos. FL09115, FL091120, and FLBC0950 * Covered by patents issued and pending. Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationPCR KIT/REAGENTS/BUFFERS/PRIMERS
PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationPREDICT Host DNA Barcoding Guide
PREDICT Host DNA Barcoding Guide Contents: 1. Rationale for Barcoding.. Page 2 2. Implementation... Page 2 3. PCR Protocols.... Page 3 4. Data Interpretation... Page 5 5. Data Entry into EIDITH.... Page
More informationOligonucleotides used to amplify VvLOXA and VvLOXO for cloning into pentr TEV/D-TOPO vectors
10.1071/FP09271_AC CSIRO 2010 Accessory Publication: Functional Plant Biology, 2010, 37(8), 767 784. Table S1. Oligonucleotide primers used to obtain full length coding sequence of berry expressed LOXs
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More informationSpeedSTAR HS DNA Polymerase
Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...
More informationMolecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationNRAS Mutation Analysis Reagents (Codons 12 and 13)
NRAS Mutation Analysis Reagents (Codons 12 and 13) User Manual V1.1 Cat No. GP18 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment
More informationMycobacterium tuberculosis End-Point PCR Kit Product# EP42100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100
More informationAmplification Products for PCR and RT-PCR
Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More information15-20 September, Apimondia 2009, Montpellier, France. Mohamed Alburaki
Centre National de la Recherche Scientifique Université Paris VI (Pierre et Marie Curie) 15-20 September, Apimondia 2009, Montpellier, France Mohamed Alburaki Ph.D student, Laboratory LEGS/CNRS, Genetic,
More informationUnderstanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationEngineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010
Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information
More informationI. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationml recombinant E. coli cultures (at a density of A 600 units per ml)
for purification of plasmid DNA, from bacterial cultures Cat. No. 1 754 777 (50 purifications) Cat. No. 1 754 785 (50 purifications) Principle Alkaline lysis releases plasmid DNA from bacteria and RNase
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationSER Final Report
File #: SER019-17 Date: 28 March 2017 Report of Expert Expert's Name: Title: Stephen Fratpietro, M.Sc., B.Ed. Technical Manager, Paleo-DNA Laboratory I, the undersigned, as requested by Chase Kloetzke,
More informationSome of the fastest evolving proteins in insect genomes
PRIMER Population Genetics and a Study of Speciation Using Next-Generation Sequencing: An Educational Primer for Use with Patterns of Transcriptome Divergence in the Male Accessory Gland of Two Closely
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationRESEARCH NOTE MOLECULAR PHYLOGENETIC RELATIONSHIP OF PARAGONIMUS PSEUDOHETEROTREMUS
RESEARCH NOTE MOLECULAR PHYLOGENETIC RELATIONSHIP OF PARAGONIMUS PSEUDOHETEROTREMUS Urusa Thaenkham and Jitra Waikagul Department of Helminthology, Faculty of Tropical Medicine, Mahidol University, Bangkok,
More informationName Class Date. a. identify similarities and
Chapter 13 enetic Engineering Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Selective breeding produces a. more offspring.
More informationNEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase
More informationA. Incorrect! This statement is true. Transposable elements can cause chromosome rearrangements.
Genetics - Problem Drill 17: Transposable Genetic Elements No. 1 of 10 1. Which of the following statements is NOT true? (A) Transposable elements can cause chromosome rearrangements. (B) Transposons can
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationSupplementary Material
Supplementary Material The Cerato-Platanin protein Epl-1 from Trichoderma harzianum is involved in mycoparasitism, plant resistance induction and self cell wall protection Eriston Vieira Gomes 1, Mariana
More information3I03 - Eukaryotic Genetics Repetitive DNA
Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationEnhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
More informationA Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationProject Report. Genetic Assessment of the Sunda Pangolin (Manis javanica) Using Degraded and Fresh Samples
Genetic Assessment of the Sunda Pangolin (Manis javanica) Using Degraded and Fresh Samples Project Report Đỗ Văn Thao 1, Nguyễn Văn Thành 1, Dương Thúy Hà 1, và Lê Đức Minh 1,2 1 Hanoi University of Science
More informationEvent-specific Method for the Quantification of Oilseed Rape RF1 using Real-time PCR. Protocol
Event-specific Method for the Quantification of Oilseed Rape RF1 using Real-time PCR Protocol 7 July 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationCat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED
Nextera DNA Sample Prep Kit (Roche Titanium-compatible) Cat. Nos. NT09115, NT091120, NT0911-50, NT0911-96, and NTBC0950 DISCONTINUED The Nextera DNA Sample Prep Kit is designed to prepare genomic DNA libraries
More information