CompoZr Transporter Knockout Cell Lines

Transcription

1 biotransport CompoZr Transporter Knockout Cell Lines Assessment of Substrates with Functionally Knocked Out Transporters MDR1, BCRP and MRP2

2 biotransport CompoZr Transporter Knockout Cell Lines The Increasing Importance of Drug Transporters in Discovery Drug-drug interactions are an important area of research as a drug can alter the pharmacokinetics of other drugs or metabolites. Guidance documents from the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) state the necessity to elucidate the permeability of a drug to determine what transporter(s) are responsible for active efflux. Relevant points include: Eukaryotic systems are preferred, Caco-2 cells are ideal for intestinal absorption studies The Guidance for Industry on Drug Interaction Studies from the FDA specifically highlights MDR1 and BCRP for in vitro analyses If active transport is identified, compound permeability can be determined in the presence/absence of a transporter in Caco-2 cells Also, the International Transporter Consortium continues to adapt its recommendation on relevant transporters; MRP2 was recently identified as an intestinal transporter of interest. CompoZr Transporter Knockout Cells To aid in the investigation of specific drug transporters Sigma has generated single and double transporter knockout () cell lines using CompoZr Zinc Finger Nuclease (ZFN) technology in C2BBe1 cells which are derived from Caco-2 cells. These cells are ideal in that they express multiple transporters, are human derived and grow in a homogenous monolayer that forms tight junctions. Knocked out transporters include: MDR1, BCRP and MRP2. Benefits of CompoZr Transporter Knockout Cells Permanent knockout of drug transporter(s) eliminates the need for potentially nonspecific chemical inhibitors in drug-transporter studies Explicitly identify the transporter(s) responsible for active efflux of substrates Caco-2 derived cell line (C2BBe1) Insert directly into your standard drug transporter testing funnel Human assay with no interference from animal transporters Overcomes the limitations of RNAi and knockdown cell lines that arise from remaining transporter functionality Product Availability Assay Ready Plates 24 or 96-well Transwell Assay Plates that contain a monolayer of CompoZr Transporter Knockout Cells ready for efflux ratio analysis upon receipt Licensing For profit institutions may license any of the Transporter Knockout Cell Lines Service Sigma has licensed the CompoZr Transporter Knockout Cells with select CROs to enable efflux ratio analysis to be conducted by a third party To learn more about CompoZr Transporter Knockout Cell Lines, visit sigma.com/transporterko MDR1 BCRP MRP2 Wild Type Parental (Wild type) C2BBe1 (Caco-2 cells) MDR1 BCRP MRP2 Single cell lines MDR1/BCRP MDR1/MRP2 BCRP/MDR2 Double cell lines Figure 1. Graphic representation of the transporter knockout(s) in each CompoZr Transporter Knockout Cell Line. The total loss of MDR1, BCRP and/or MRP2 function in each respective cell line enables explicit identification of transporter/substrate interactions without the use of chemical inhibitors.

3 Order Technical Service Transporter Assay Transwell Assay with CompoZr Transporter Knockout Cell Lines Whether Assay Ready Plates are purchased or knockout cells are licensed from Sigma Life Science, CompoZr Transporter Knockout Cell Lines may be utilized in a standard transwell assay format. Through comparison of WT cells with CompoZr Transporter Knockout Cells, interactions between transporters and drug compounds can be explicitly identified without the use of chemical inhibitors. Figure 2. Bidirectional transport assay The transporters of interest are expressed or knocked out on the apical membrane of the C2BBe1 cells. The apical membrane expression of MDR1, BCRP and MRP2 results in preferential transport of substrates in the apical chamber of the transwell plate. Experimental Strategy Transporter Analyses with CompoZr Transporter Knockout Cells A-B, B-A drug transporter assay in parental C2BBe1 cell line Net efflux ratio 2 Net efflux ratio 2 Non-MDR1, BCRP, and MRP2 Substrate Potential MDR1, BCRP, or MRP2 Substrate A-B, B-A drug transporter assay in transporter C2BBe1 cell lines MDR1 net efflux ratio 2 MDR1 net efflux ratio 2 BCRP net efflux ratio 2 BCRP net efflux ratio 2 MRP2 net efflux ratio 2 MRP2 net efflux ratio 2 MDR1 Substrate Non-MDR1 Substrate BCRP Substrate Non-BCRP Substrate MRP2 Substrate Non-MRP2 Substrate Figure 3. This graphic outlines the experimental strategy that may be used to determine if a compound is a MDR1, BCRP or MRP2 substrate. Unlike the decision trees that are provided in guidance documents chemical inhibitors for MDR1, BCRP or MRP2 are not required. An efflux ratio < 2 in wild type C2BBe1 cells indicates the test compound is not actively effluxed. If the C2BBe1 wild type efflux ratio is > 2 the experimental strategy found at the right can be utilized to determine if the test compound is a substrate for MDR1, BCRP and/or MRP2.

4 biotransport CompoZr Transporter Knockout Cell Lines Efflux Ratios with Transporter Knockouts MDR1, BCRP and MRP2 Transporter Knockout Cell Lines MDR1 Transporter Knockout Cell Lines MDR1 Single and Double Knockout Cell Lines can be used, in conjunction with wild type C2BBe1 cells, to identify interactions between the MDR1 efflux transporter and test substrates. Digoxin and Erythromycin are examples of MDR1 substrates with efflux ratios 2 when tested in a transwell assay with MDR1 Single and Double Knockout Cell Lines, no chemical inhibitors were utilized to generate these data Wild Type MDR1 MDR1/BCRP MDR1/MRP2 Digoxin Erythromycin Figure 4. MDR1 Single and Double Knockout Cells Values are the mean +/- standard deviation, n 3 assays of triplicates. BCRP Transporter Knockout Cell Lines BCRP Single and Double Knockout Cell Lines can be used, in conjunction with wild type C2BBe1 cells, to identify interactions between the BCRP efflux transporter and test substrates. Estrone Sulfate and Nitrofurantoin are examples of BCRP substrates with efflux ratios 2 when tested in a transwell assay with BCRP Single and Double Knockout Cell Lines, no chemical inhibitors were utilized to generate these data Wild Type BCRP BCRP/MDR1 BCRP/MRP2 Estrone sulfate Nitrofurantoin Figure 5. BCRP Single and Double Knockout Cells Values are the mean +/- standard deviation, n 3 assays of triplicates. MRP2 Transporter Knockout Cell Lines The non-fluorescent 5(6)-carboxy-2,7 -dichlorofluorescein-diacetate (CDCFDA) is absorbed by passive diffusion into C2BBe1 cells. It undergoes hydrolysis to form the fluorescent product CDCF; CDCF is then effluxed by active transport in wild type C2BBe1 cells. When tested in MRP2 Single and Double Transporter Knockout Cell Lines the efflux ratio for CDCF is < 2. This indicates CDCF no longer undergoes active transport, no chemical inhibitors were utilized to generate these data Wild Type MRP2 MRP2/MDR1 MRP2/BCRP CDCF Figure 6. MRP2 Single and Double Knockout Cells Values are the mean +/- standard deviation, n 3 assays of triplicates.

5 Order Technical Service Case Studies with Transporter Knockouts Analysis of Cimetidine with the MDR1/BCRP Double Knockout Cell Line Cimetidine is an example of a crossover substrate that has an efflux ratio > 2 in each of the Single Transporter Knockout Cell Lines. When analyzed with the Double Transporter Knockout Cell Lines the efflux ratio for the MDR1/BCRP double knockout cell line is < 2. This total loss of active transport indicates cimetidine is a substrate for both MDR1 and BCRP. The data indicates further research with both transporters would be necessary for cimetidine Wild Type MDR1 BCRP MRP2 MDR1/BCRP MDR1/MRP2 MRP2/BCRP Figure 7. Transport of Cimetidine Values are the mean +/- standard deviation, n 3 assays of triplicates. Efflux of Vinblastine with MDR1 and MRP2 Vinblastine is a prescription drug that s used to treat multiple types of cancer which include Hodgkin s disease, Kaposi s sarcoma, non-hodgkin s lymphoma, breast cancer, and testicular cancer. Previous data indicates that Vinblastine is a substrate of both MDR1 and MRP2. A recent publication, Mease K, et al. J Pharm Sci., 212 May; 11(5): , conducted a series of experiments to further elucidate Vinblastine as a substrate for MDR1 and MRP2 in Caco-2 cells. In this study the chemical inhibitors zosuquidar (LY335979) and MK571 where used to inhibit MDR1 and MRP2 respectively. Data demonstrated MK571 is non-specific, inhibiting multiple transporters including MDR1, BCRP and MRP2 which are all expressed in Caco-2 cells. Specifically with Vinblastine, the reduction of efflux with MDR1 is primarily due to the inhibition of MDR1 by MK571. The promiscuity of MK571 leads to the inability to conclusively determine if Vinblastine is a substrate for MDR1, MRP2 or is a crossover substrate for both transporters Vinblastine Wild Type MRP2 Knockout MDR1 Knockout MDR1/MRP2 Double Knockout Figure 8. Efflux of Vinblastine in MDR1 and MRP2 Transporter Knockout Cells To conclusively determine if Vinblastine is a substrate for MDR1 or MRP2 the drug was tested in both the MDR1 and MRP2 Transporter Knockout Cell Lines. Wild type Caco-2 cells demonstrated active efflux of Vinblastine, ER 2. In the MRP2 Knockout Cell Line, where MRP2 is completely absent and MDR1 is present, active efflux of Vinblastine also occurs. In the MDR1 Knockout Cell Line, where MDR1 is completely absent and MRP2 is present, active efflux of Vinblastine is eliminated. Since efflux was eliminated in the MDR1 knockout cell line but not the MRP2 knockout cell line this data indicates that Vinblastine is an MDR1 substrate and not an MRP2 substrate. This result was confirmed in the MDR1/MRP2 Double Knockout Cell Line. The data represents an average and standard deviation of 12 replicates for each cell line. No chemical inhibitors were used to generate these data.

6 biotransport CompoZr Transporter Knockout Cell Lines Characterization of Cell Lines Stable and Well Characterized Transporter Knockout Cell Lines CompoZr Transporter Knockout Cell Lines contain a genetically heritable, functional knockout of the appropriate transporter(s). All Caco-2 Transporter Knockout Cell Lines have been tested for functional knockout stability demonstrating complete loss of transporter function in bidirectional transport assays out to at least 4 passages post-zfn genomic modification. Passive permeability data demonstrate that when tested with an appropriate monolayer, as measured by the Trans Epithelial Electrical Resistance (TEER) assay, CompoZr Cell Lines form tight junctions that prevent or enable active efflux where appropriate (See Figures 1 and 11) Passage 1 Passage 2 Passage 3 Passage 4 Wild Type BCRP Figure 9. Stability of BCRP Cell Line Efflux of Estrone Sulfate in wild type and BCRP Knockout C2BBe1 cells for up to 4 passages after creation of master cell bank. Papp (x1-6 cm/sec) Wild Type MDR1 BCRP MRP2 MDR1/BCRP A-B B-A MDR1/MRP2 MRP2/BCRP Papp (x 1-6 cm/sec) A-B B-A ER (B-A/A-B) Atenolol Mean SD Mean SD Mean SD C2BBe1 (WT) MDR BCRP MRP MDR1/BCRP MDR1/MRP MRP2/BCRP Figure 1. Atenolol (low permeability) Efflux of atenolol in all of the available CompoZr Knockout Transporter Cell Lines, data demonstrate no active efflux. Papp (x1-6 cm/sec) Papp (x 1-6 cm/sec) A-B B-A ER (B-A/A-B) Metoprolol Mean SD Mean SD Mean SD C2BBe1 (WT) MDR BCRP MRP MDR1/BCRP MDR1/MRP MRP2/BCRP Wild Type MDR1 BCRP MRP2 MDR1/BCRP A-B B-A MDR1/MRP2 MRP2/BCRP Figure 11. Metoprolol (high permeability) Efflux of metoprolol in all of the available CompoZr Knockout Transporter Cell Lines, data demonstrate active efflux in all cell lines.

7 Order Technical Service Cell Line Genotypic Data Functional Gene Knockouts with CompoZr ZFN Technology Zinc Finger Nuclease Technology Zinc finger nucleases are engineered proteins comprised of a zinc finger DNA-binding domain fused to the cleavage domain of the FokI restriction endonuclease. When bound as a heterodimer, ZFNs create a double-stranded break at a user-specified DNA sequence. This results in the stimulation of one of two cellular repair mechanisms, non-homologous end joining or homologous recombination. 5 3 N C C N 3 5 Generation of Transporter Knockout Cell Lines To create each knockout cell line CompoZr ZFNs were manufactured that specifically target within the coding region of the desired transporter gene. Repair of the ZFN induced double-stranded break followed the NHEJ pathway. Single cell clones of the ZFN treated C2BBe1 cells were then isolated to identify cells that contained nucleotide insertions or deletions (indels) at the ZFN target site. The presence of indels in a cell line creates a heritable, gene knockout that eliminates the expression of functional protein - all cell lines are homozygous knockouts. Genotype of Single Transporter Knockout Cell Lines The data below show the indel(s) that are present in each single knockout cell line. The ZFN target site is in capital letters, nucleotide deletions appear as a dash and nucleotide insertions appear in red font. All indels resulted in a functional knockout for the targeted transporter gene. Figure 12. ZFNs are comprised of two functional domains: 1) the FokI cleavage domain 2) the user-specified DNA binding domain Gene Knockout ZFNs specifically target the first available site in the open reading frame (ORF) for cleavage. During the repair process, nucleotides may be added or deleted at the cleavage site due to the imperfect nature of NHEJ. This either prevents transcription or causes nonsense-mediated decay of truncated protein leading to the loss of functional protein. MDR1 - Knockout Genomic Data Wild Type: 5 GTCCTGTTCTTGGACtgtcaGCTGCTGTCTGGGCAAAG 3 Allele 1: 5 GTCCTGTTCTTGG tgtcagctgctgtctgggcaaag 3 (-2bp) Allele 2: 5 GTCCTGTTCTTGGACt------GCTGCTGTCTGGGCAAAG 3 (-4bp) Allele 3: 5 GTCCTGTTCTTGGAC GCTGCTGTCTGGGCAAAG 3 (-5bp) Allele 4: 5 GTCCTG tgtcAaGCTGCTGTCTGGGCAAAG 3 (-9bp, +1bp) BCRP Knockout Genomic Data Wild Type: 5 TACACCACCTCCTTCTGTcatcaACTCAGATGGGT 3 Allele 1: 5 TACACCACCTCCTTCTGT----- aactcagatgggt 3 (-4bp) Allele 2: 5 TACACCACCTCCTTCTGT------aACTCAGATGGGT 3 (-4bp) Allele 3: 5 TACACCACCTCCTTCTGTcGTCATatcaACTCAGATGGGT 3 (+5bp) Allele 4: 5 TACACCACCTCCTTCTGTcGTCATatcaACTCAGATGGGT 3 (+5bp) MRP2 Knockout Genomic Data Wild Type: 5 GTCTCCCTAGTCCATGATggcagtGAAGAAGAAGACGATGAC 3 Allele 1: 5 GTCTCCCTA ggcagtGAAGAAGAAGACGATGAC 3 (-9bp) Allele 2: 5 GTCTCCCTA ggcagtGAAGAAGAAGACGATGAC 3 (-9bp) Allele 3: 5 GTC GAC 3 (-36bp) Allele 4: 5 GTC GAC 3 (-36bp) Figure 13. Targeted Mutagenesis A ZFN induced double-strand break is repaired by NHEJ or HR. NHEJ is used for gene knockouts, HR is used for gene integration.

8 World Headquarters 35 Spruce St. St. Louis, MO 6313 (314) sigma-aldrich.com Order/Customer Service (8) Fax (8) Technical Service (8) sigma-aldrich.com/techservice Development/Custom Manufacturing Inquiries (8) Safety-related Information sigma-aldrich.com/safetycenter Global Locations For a list of our global locations and contact details, visit sigma-aldrich.com/international 213 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA and SIGMA-ALDRICH are trademarks of Sigma-Aldrich Co. LLC, registered in the US and other countries. CompoZr is a registered trademark of Sigma-Aldrich Co. LLC. Where bio begins is a trademark of Sigma-Aldrich Co. LLC. Sigma brand products are sold through Sigma-Aldrich, Inc. Purchaser must determine the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see product information on the Sigma-Aldrich website at com and/or on the reverse side of the invoice or packing slip. PEX