Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application

Size: px
Start display at page:

Download "Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application"

Transcription

1 Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_ CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1 NM_ GTTCTCATTGCCAACAATGGCA CAGCCAGCCCAAACTGCTTGCAC RT-qPCR FAS AF GCATCGCTGGCTACTCCTAC GTGTAGGCCATCACGAAGGT RT-qPCR LPL NM_ GGGTTTTGAGCAAGGGTACA GCCACAATGACCTTTCCAGT RT-qPCR CD36 X91503 GTACAGATGCAGCCTCATTTCC TGGACCTGCAAATATCAGAGGA RT-qPCR FABP1 FJ GTTCATCATCACCGCTGGCT CCACTGCCTTGATCTTCTCCC RT-qPCR DGAT1 NM_ CCACTGGGACCTGAGGTGTC GCATCACCACACACCAATTCA RT-qPCR DGAT2 NM_ CATGTACACATTCTGCACCGATT TGACCTCCTGCCACCTTTCT RT-qPCR PLIN2 NM_ TTTATGGCCTCATGCTTTTGC CTCAGAGCAGACCCCAATTCA RT-qPCR FGF21 XM_ AATATCACGGGTCAGGCGTC GGACTCACAGCTGACTGGAC RT-qPCR CPT1a NM_ TCGCGATGGACTTGCTGTATA CGGTCCAGTTTGCGTCTGTA RT-qPCR CPT2 NM_ TTTGGCATTGGGTACTCCGT TATGCTGGTGAAACAGAGGCT RT-qPCR ACOX1 NM_ ACCCAGACTTCCAGCATGAGA TTCCTCATCTTCTGCACCATGA RT-qPCR HMGCS2 NM_ GACATCGCAGTCTACCCCAG CATCGAGAGTGAAAGGCCGA RT-qPCR TLR2 NM_ GGCTGTGGAAGGCGCTGCAA GCCATCGCAGACACCAGTTG RT-qPCR TLR4 NM_ GGACCCTTGCGTACAGGTTG GGAAGCTGGAGAAGTTATGGC RT-qPCR TNF-a NM_ CTTCTGCCTGCTGCACTTCG GAGTTGATGTCGGCTACAACG RT-qPCR

2 IL-1a NM_ GGCCAAAGTCCCTGACCTCT CTGCCACCATCACCACATTC RT-qPCR IL-6 NM_ GGAGGAAAAGGACGGATGCT GGTCAGTGTTTGTGGCTGGA RT-qPCR SREBP1c NM_ CACTCGTCTTCCTCTGTCTC GAGTGACTGGTTCTCCATAG RT-qPCR SREBP2 NM_ AGAGCAAACTCCTGAAGGGC GGAGGCGACATCAGAAGGAC RT-qPCR SCAP NM_ CATCAAGCTCTACTCCATCC CAATGGCAGCGTTGTCCAGCA RT-qPCR INSIG1 NM_ ACTAAAGCCTGACTGCCAGC GATTGTCTGCGTAGCACCCT RT-qPCR PPARa FJ CATAACGCGATTCGTTTTGGA CGCGGTTTCGGAATCTTCT RT-qPCR LXRa NM_ CCCCATGACCGACTGATGTT TGTCCTTCATCTGGCTCCACC RT-qPCR NF- B (p65) NM_ TTTTTCACAAGCTGACGTGCAC GCTCTTGAAGGTCTCGTACGT RT-qPCR NF- B (p50) NM_ GTCAAACTCCAGAATGGCAGA GAAATCCTCTCTGTTTAGGTTGCTC RT-qPCR SFRS4 NM_ ATGGCAGTTACGGTTCTGGAC CCTGCCTGACGCATATAATCC RT-qPCR PA CTCCCACGGTGAACCAACTCT GCATCTGGGCTCTCAGACACT CHART and Methylation for area A PB GTGCCCATCCATTTGCGAATTG GGCTCGGCGCAATCTGCTGT CHART and Methylation for area B PS GTGCCCATCCATTTGCGAATTG GGTGCCACCTCGTCCTGCCGT ChIP The source files used to derive the primers are indicated (accession#).

3 Supplemental Table S2. Primer efficiency and qpcr performance for each gene. Gene Median Median relative mrna (Holstein) Ct 1 Ct 2 Slope 3 (R 2 ) 4 Efficiency 5 abundance 6 1/E Ct 7 % SCD FASN ACACA LPL CD FABP DGAT DGAT PLIN FGF CPT1A CPTII ACOX HMGCS

4 TLR TLR TNF IL1A IIL SREBP SREBP SCAP INSIG PPARA NR1H RELA NFKB SFRS SUM The median is calculated considering all cows. 2 The median of Ct is calculated as [Ct gene Ct internal control] for each cow. 3 Slope of the standard curve.

5 4 R 2 stands for the coefficient of determination of the standard curve. 5 Efficiency is calculated as [10 (-1 / Slope) -1]. 6 relative mrna abundance = 1/ Efficiency Median Ct 7 1/E Ct = relative mrna abundance/ relative mrna abundance

6 RNA extraction, PCR, and primer design and evaluation. Biopsy samples were powdered in a mortar under liquid nitrogen and was weighted (~50 mg) and immediately subjected to RNA extraction using ice-cold Trizol (Invitrogen Corp.). Genomic DNA was removed from RNA with DNase using RNeasy Mini Kit columns (Qiagen, Germany). RNA concentration was measured using a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies). The purity of RNA (A260/A280) for all samples was above 1.9 as required. RNA quality was assessed by gel electrophoresis (shown in below). For cdna generation, 1.5 μg of total RNA were transcribed in reverse using SuperScript II (Invitrogen) and the general conditions as previously described (Goldammer et al., 2004). The cdna was purified with the High Pure Purification kit (Invitrogen) and subsequently diluted to a final effluent volume of 100 μl (15 μg/ul). For each measuring point, aliquots of 5 μl were supplemented with amplification primers (20 pm) and the components of the SYBR Premix Ex Taq TM kit (Takara Co., Otsu, Japan) for PCR reaction. Amplification cycles consisted of an initial denaturation (95 C, 10 min) followed by 40 cycles of annealing (60 C, 30 s), elongation (72 C, 1 min), fluorescence acquisition (83 C, 5 s) and melting (95 C, 30 s) on an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) according to the recommendations in the instruction manual. Finally, the melting curves of the products were recorded. Quality of all PCR products was also visualized and validated in agarose gel electrophoresis. And qpcr performance for each gene were reflected by the series diluted standard curve and actual Ct value from each sample (shown in Suppl. Table 2). Design and evaluation of primers. Primer features for genes are shown in Suppl. Table 1. Primers were designed using Premier 6.0 software (Premier Biosoft International, USA). When possible, primers were designed to fall across exon exon junctions. Primers were aligned against publicly available databases using BLASTN at NCBI and bos taurus nucleotides were selected as database for potential unintended products. Prior to qpcr primers were tested in a 20 μl PCR reaction using the same protocol described for qpcr except for the final dissociation protocol. For primer testing we used mixed liver cdna (mixture from all 12 different bovine liver) to ensure

7 identification of desired genes. Only those primers that did not present primer-dimer, a single band at the expected size in the gel, and had the right amplification product (verified by sequencing) were used for qpcr. The accuracy of a primer pairs also was evaluated by the presence of a unique peak during the dissociation step at the end of qpcr. Reference Goldammer, T., H. Zerbe, A. Molenaar, H. J. Schuberth, R. M. Brunner, S. R. Kata, and H. M. Seyfert Mastitis increases mammary mrna abundance of betadefensin 5, toll-like-receptor 2 (TLR2), and TLR4 but not TLR9 in cattle. Clinical and diagnostic laboratory immunology 11(1):

8 Supplemental Figure S1. Gel electrophoresis for RNA quality validation.

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

Stratagene QPCR Human Reference Total RNA

Stratagene QPCR Human Reference Total RNA Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Brilliant II SYBR Green QPCR Master Mix

Brilliant II SYBR Green QPCR Master Mix Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

Supplementary Data: Fig. 1S Detailed description of In vivo experimental design

Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 1 2 Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 3 4 5 6 7 8 9 Relative Expression Studies 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 The

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

RT 2 Easy First Strand Handbook

RT 2 Easy First Strand Handbook March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus)

SYBR Premix Ex Taq II (Tli RNaseH Plus) Cat. # RR820Q For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Materials Required but not Provided...

More information

All-in-One TM mirna qrt-pcr Detection Kit

All-in-One TM mirna qrt-pcr Detection Kit mirna qrt-pcr Detection Kit For quantitative detection of mature mirna Cat. No. QP015 (20 RT and 200 qpcr reactions) Cat. No. QP016 (60 RT and 600 qpcr reactions) Used in combination with the All-in-One

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Quant-X One-Step qrt-pcr TB Green Kit User Manual

Quant-X One-Step qrt-pcr TB Green Kit User Manual Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

A systematic guideline for developing the best real-time PCR primers

A systematic guideline for developing the best real-time PCR primers Scientific article Lessons learned from designing assays for more than 14, genes George Quellhorst and Sam Rulli QIAGEN, 6951 Executive Way, Frederick, Maryland 213, USA Abstract: Primer design is the

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

D E. QPCR Optimization & Troubleshooting Guide

D E. QPCR Optimization & Troubleshooting Guide D C C QPCR Optimization & roubleshooting Guide Introduction Whether you are beginning to develop a QPCR assay, have a QPCR assay you want to optimize, or are getting questionable results and don t know

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

QuantiTect Primer Assay Handbook

QuantiTect Primer Assay Handbook July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)

More information

Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR

Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR Amplification: Consumables Reagent Comparison Guide for Real-Time PCR Introduction With the introduction of the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Brilliant SYBR Green QPCR Master Mix

Brilliant SYBR Green QPCR Master Mix Brilliant SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600548 (single kit) #929548 (10-pack kit) Revision B.01 For In Vitro Use Only 600548-12 LIMITED PRODUCT WARRANTY This warranty limits our

More information

mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis

mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis A Maxwell RSC mirna Tissue Kit Application Note Materials Required: Maxwell RSC mirna Tissue Kit (Cat.# AS1480) QuantiFluor RNA System

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

DyNAmo HS SYBR Green qpcr Kit

DyNAmo HS SYBR Green qpcr Kit DyNAmo HS SYBR Green qpcr Kit Instruction manual F-410S Sufficient for 40 reactions (50 µl each) F-410L Sufficient for 200 reactions (50 µl each) Description... 2 Applications... 2 Kit Components... 2

More information

MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides)

MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) Vassilis Mersinias, Giselda Bucca and Graham Hotchkiss Quick Protocol (see notes at end for detailed instructions)

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Retro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613)

Retro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613) User Manual Retro-X qrt-pcr Titration Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

DyNAmo Flash SYBR Green qpcr Kit

DyNAmo Flash SYBR Green qpcr Kit DyNAmo Flash SYBR Green qpcr Kit Instruction manual F-415S F-415L 40 reactions (50 µl each) or 100 reactions (20 µl each) 200 reactions (50 µl each) or 500 reactions (20 µl each) Description... 2 Kit Components...

More information

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult

More information

SYBR Green PCR and RT-PCR Reagents Protocol

SYBR Green PCR and RT-PCR Reagents Protocol SYBR Green PCR and RT-PCR Reagents Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, Applied Biosystems For Research Use Only. Not for use in diagnostic procedures.

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

QIAGEN LongRange 2Step RT-PCR Handbook

QIAGEN LongRange 2Step RT-PCR Handbook Second Edition December October 2010 2005 QIAGEN LongRange 2Step RT-PCR Handbook For reliable and accurate long-range two-step RT-PCR up to 12.5 kb Sample & Assay Technologies QIAGEN Sample and Assay Technologies

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes

More information

I.QC (quality control of your qpcr)

I.QC (quality control of your qpcr) qpcr data analysis I.QC (quality control of your qpcr)! 1. Check the melt curve if reactions with the same primer pair give only one peak -> proceed with the analysis if you see more than one peak, consider

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

Section 2: Eukaryotic Sample and Array Processing Rev. 3

Section 2: Eukaryotic Sample and Array Processing Rev. 3 Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic

More information

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change

More information

RT 2 Profiler PCR Array System

RT 2 Profiler PCR Array System User Manual RT 2 Profiler PCR Array System Pathway-Focused Gene Expression Profiling Using Real-Time PCR See Purchaser Notification for limited use license and warranty information (page 3). Part #1022A

More information

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign

More information

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation

More information

Low cost and non-toxic genomic DNA extraction for use in molecular marker studies.

Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000

Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000 Product

More information

Protocol for DNA extraction from FFPE Samples

Protocol for DNA extraction from FFPE Samples 25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100

Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA) The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification

More information

Real-Time PCR Validations

Real-Time PCR Validations Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed

More information

Thermo Scientific DyNAmo SYBR Green qpcr Kits Technical Manual

Thermo Scientific DyNAmo SYBR Green qpcr Kits Technical Manual Thermo Scientific DyNAmo SYBR Green qpcr Kits Technical Manual F- 400S 100 reactions (20 µl each) or 40 reactions (50 µl each) F- 400L 500 reactions (20 µl each) or 200 reactions (50 µl each) F- 400RS

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- Neo 1109 F1066K KOD -Plus- Neo Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction

More information

E.Z.N.A. Total RNA Kit II. R preps R preps R preps

E.Z.N.A. Total RNA Kit II. R preps R preps R preps E.Z.N.A. Total RNA Kit II R6934-00 5 preps R6934-01 50 preps R6934-02 200 preps September 2015 E.Z.N.A. Total RNA Kit II Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents/Storage

More information

Application Note Detecting low copy numbers. Introduction. Methods A08-005B

Application Note Detecting low copy numbers. Introduction. Methods A08-005B Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template

More information

NanoString Sample Submission Guidelines

NanoString Sample Submission Guidelines High quality ncounter data is achieved with high quality starting material. The guidelines set forth in this document will assist you in preparing your samples for your NanoString run. Please adhere to

More information