RNA-templated DNA origami structures

Size: px
Start display at page:

Download "RNA-templated DNA origami structures"

Transcription

1 Electronic Supplementary Information RNA-templated DNA origami structures Masayuki Endo,* a,c Seigi Yamamoto, b Koichi Tatsumi, b Tomoko Emura, b Kumi Hidaka, b and Hiroshi Sugiyama* a,b,c a Institute for Integrated Cell-Material Sciences (WPI-iCeMS), Kyoto University, Yoshidaushinomiyacho, Sakyo-ku, Kyoto , Japan. b Department of Chemistry, Graduate School of Science, Kyoto University, Kitashirakawaoiwakecho, Sakyo-ku, Kyoto , Japan. c CREST, Japan Science and Technology Corporation (JST), Sanbancho, Chiyoda-ku, Tokyo , Japan. endo@kuchem.kyoto-u.ac.jp; hs@kuchem.kyoto-u.ac.jp. Materials. Reagents and solvents for the synthesis were purchased from standard suppliers and used without further purification. PCR amplification was carried out using GoTaq Green Master Mix (Promega). Single-stranded M13mp18 DNA and streptavidin magnetic beads were purchased from New England Biolabs (Ipswich, MA). The staple strands and primers were purchased from Operon Biotechnology (Tokyo, Japan). Modified oligonucleotides were purchased from Nippon Bio Service (Saitama, Japan). The gel-filtration column and the Sephacryl S-300 were purchased from Bio-rad Laboratories, Inc. (Hercules, CA) and GE Healthcare (Buckinghamshire, UK), respectively. 1. Preparation of template dsdna for RNA synthesis. The PCR amplification of the template dsdna was carried out from a plasmid-containing EGFP coding region using Go Taq (Promega) with two primers by following the manufacture s protocol, and the product was purified using a PCR purification kit (Qiagen). S1

2 2. Preparation of RNA template. A T7 promoter-containing template dsdna was used for the transcription to prepare RNA template. RNA synthesis was performed using 10 nm template dsdna, 40 mm Tris-HCl (ph 8.0), 5 mm DTT, 8 mm MgCl 2, 2 mm spermidine, 0.5 mm NTP, and 0.25μM T7 RNA polymerase (Takara) at 42 o C for 1.5 h. In the case of the preparation of modified RNA templates, UTP was replace to 5-aminoally UTP and 5-biotinylated UTP. The transcribed RNA was purified using RNeasy Mini kit (Qiagen). The product was confirmed by gel electrophoresis. 3. Preparation of RNA-templated DNA origami. The RNA-templated DNA origami was designed by a cadnano software 1 using the geometry of 11.00, 10.67, and bp/turn helical pitch. The sequences of the staple strands are listed in Table S1. For the tile formation, sample solution (40 L) containing 0.02 M RNA template, 1 M staple strands (20-50 eq), 20 mm Tris-HCl (ph 7.6), 1 mm EDTA, and 10 mm MgCl 2 was annealed from 65 C to 15 C at a rate of 1.0 C/min. For the tube formation, sample solution (40 L) containing 0.02 M RNA template, 0.4 M staple strands (20 eq), 20 mm Tris-HCl (ph 7.6), 1 mm EDTA, and 10 mm MgCl 2 was annealed from 65 C to 15 C at a rate of 0.1 C/min. These structures were purified using a gel filtration column (Sephacryl 300, GE Helthcare). 4. Purification by streptavidin magnetic beads. For the streptavidin-magnetic beads purification, the biotin-ss-dna was added by replacing the corresponding unmodified staple DNA, the mixtures were assembled using the same condition. A mixture of RNA-templated DNA origami (20 μl) was incubated with pre-washed streptavidin magnetic beads (New England Biolabs) at rt for 40 min. The sample in a microtube was placed in the magnetic separation stand and washed three times with the buffer. Then the target product attached on the streptavidin magnetic beads was recovered by cleavage of disulfide bond with 50 mm DTT, 20 mm Tris buffer (ph 7.6), and 100 mm MgCl 2 (32 μl) at rt for 1 h. The collected samples were analyzed by native PAGE. 5. Preparation of DNA-templated DNA origami. S2

3 For the preparation of the DNA-templated DNA origami, template single-stranded DNA was obtained using a reported method. 2 PCR amplified double-stranded DNA with biotin-attached reverse primer was denatured by NaOH, and then the bottom strand was removed by streptavidin magnetic beads (New England Biolabs). The solution was neutralized by ammonium acetate. Finally the sample was purified by PCR purification kit (Qiagen). 6. Preparation of RNA-templated DNA origami with modified UTP. For the preparation of modified RNA templates, in vitro transcription was performed with ATP, CTP, GTP, and 5-aminoallyl UTP or 5-biotinylated UTP. The purified modified RNA templates and staple strands were assembled as described above. 7. High-speed AFM imaging of the RNAP movement and transcription: AFM images were obtained using an AFM system (Nano Live Vision, RIBM, Tsukuba, Japan) with a silicon nitride cantilever (Olympus BL-AC10EGS). Samples (2 L) were adsorbed onto a aqueous 3-aminopropyltriethoxysilane (APTES, 0.1%) passivated mica plate for 5 min at room temperature and then washed three times using the same buffer solution. Scanning was performed in the same buffer solution using a tapping mode. Fig. S1. AFM images of RNA/DNA hybrid tiles after anealing. 7HB-tile with bp/turn pitch (left) and 7HB-tile with bp/turn pitch. S3

4 Fig. S2. Purification of RNA/DNA hybrid tiles using streptavidin-magnetic beads. Native polyacryl gel electrophoresis (4%) of RNA/DNA hybrid tiles with bp/turn and bp/turn. Fig. S3. Purification of RNA/DNA hybrid tube using streptavidin-magnetic beads. Native polyacryl gel electrophoresis (4%) of RNA/DNA hybrid tube. S4

5 Modified UTP ( M) UTP ( M) Lane Lane Lane Lane Lane Fig. S4. Preparation of modified RNA transcripts with 5-aminoallyl UTP (A) and 5-biotinylated UTP (B). Gel electrophoresis (1% agarose) analysis of modified RNA transcripts. The concentrations of modified UTP and UTP were changed as listed in the table. Fig. S5. AFM images of modified RNA/DNA hybrid tiles with bp/turn pitch. RNA templates were prepared with 5-aminoally UTP (left) or 5-biotinylated UTP (right). S5

6 Fig. S6. Sectional analysis of tubular structures. DNA/DNA tube (left), RNA/DNA hybrid tube (left middle), 5-aminoallyl-uridine-containing RNA/DNA hybrid tube (right middle), and 5- biotinylated-uridine-containing RNA/DNA hybrid tube (right). Fig. S7. Native PAGE (4%) analysis of 5-aminoally-uracil and 5-biotinylated uracil modified RNA/DNA hybrid tiles with bp/turn. S6

7 Fig. S8. AFM images of modified RNA/DNA hybrid tiles with bp/turn pitch. For imaging, mica was not passivated with APTES. In these cases, monomers may be washed out, and the stacked tiles were left on the mica surface. References 1. S. M. Douglas, A. H. Marblestone, S. Teerapittayanon, A. Vazquez, G. M. Church, W. M. Shih, Nucleic Acids Res. 2009, 37, E. Pound, J. R. Ashton, H. A. Becerril, A. T. Woolley, Nano Lett. 2009, 9, S7

8 DNA strands for RNA-templated DNA tile with a bp/turn pitch 1A 1B 1C 2A 2B 2C 2D 3A 3B 3C 4A 4B 4C 4D 5A 5B 5C 6A 6B 6C 6D AAGCACTGGTAGGTCAGGGTGGTCCCTCGCCCTTGCTCAC TGCCCCAGGCCGTCCTCCTTGAAGAGCGGCTG AGGGCGGAGCTCAGGTAGTGGTTGCCAGCTTG TGGGCACCACCCCGGTGAACAGCTACGAGGGT GGGCCAGGTTCATGTGGTCGGGGTTCGATGCC CTTCAGCTCTGTTGTAGTTGTACTTCGGGCAG CAGCACGGCGCTTCTCGTTGGGGTCTTTGCTC CGTGCTGCGCACGGGCAGCTTGCCGACCAGGA CGTTGTGGCGATGCGGTTCACCAGGAAGAAGT TGTGATCGGGCCGTCGCCGATGGGGATATAGA GCCGTTTACGTCGCCGTCCAGCTCGGTGGTGC AGATGAACCGGGCATGGCGGACTTGGTGTCGC CCTCGAACTCTGCTTGTCGGCCATGGTGTTCT GCTGGTAGCGGTCACGAACTCCAGCAGGACCA GTAGCCTTTTCAGGGTCAGCTTGCAACTTGTG GCCGTTCTTTCACCTCGGCGCGGGTCCTGGAC CCCGGCGGTGGTCGGCGAGCTGCAACCTTGAT CTCGCCGGACACGCTGCGTAGGTG GCATCGCCGAAGAAGATGGTGCGCTCTTGTAG TTGCCGTCGCGGATCTTGAAGTTCCGCTGCCG TCCTCGATCAGCTCGTCCATGCCGAGAGTGAT DNA strands for RNA-templated DNA tile with a bp/turn pitch 1A 1B 1C 2A 2B 2C 2D 3A 3B 3C 4A 4B 4C 4D 5A 5B 5C 6A 6B 6C 6D AGCACTGCCGTAGGTCAGGGTGGTCTCGCCCTTGCTCACC GCCCCAGGTGCCGTCCTCCTTGAAGCGGCTGA GGGCGGACTGCTCAGGTAGTGGTTCAGCTTGT TGGGCACCACCCCGGTGAACAGCTCCACGAGGG TGGGCCAGGTTCATGTGGTCGGGGTAGTCGATGC CCTTCAGCTCTGTTGTAGTTGTACTCGTCGGGCA GCAGCACGGCGCTTCTCGTTGGGGTCTTTGCTCA CGTGCTGCGCACGGGCAGCTTGCCGACCAGGA CGTTGTGGCGATGCGGTTCACCAGGAAGAAGT TGTGATCGGGCCGTCGCCGATGGGGATATAGA GGCCGTTTACGTCGCCGTCCAGCTCGGTGGTGC AGATGAACTTCGGGCATGGCGGACTTGGTGTCGC CCTCGAACTTTCTGCTTGTCGGCCATGGTGTTCT GCTGGTAGTGCGGTCACGAACTCCAGCAGGACCA CGTAGCCTTCAGGGTCAGCTTGCCGAACTTGT TGCCGTTCTCACCTCGGCGCGGGTCTCCTGGA TCCCGGCGGGTCGGCGAGCTGCACCACCTTGA CCCTCGCCGGACACGCTGTAGGTGG CATCGCCCTTTGAAGAAGATGGTGCGCTTGTAGT TGCCGTCGTTGGCGGATCTTGAAGTTGCTGCCGT CCTCGATGTTACAGCTCGTCCATGCCGAGAGTGA S8

9 DNA strands for RNA-templated DNA tube with a bp/turn pitch 1 TCATGTGGTCGGGGCCCTTGCTCGTCCA 2 GAAGTCGTGTCGGCCCTTGATGCCGTTC 3 TGAACAGCTCCTCGTAGCGGCACTTGAA 4 TGCCGAGAAGTTCACATGATATAGACGT 5 ATGGCGGTGAAGCACTGCACGACCCCGGCCGGCGGCGGTCAC 6 CGTAGCCTTCGGGCTGTGGCTTGTGGCGGATCTTGAGTGATC 7 TCGATGTGTTGTAGTTGTACTTCCTGGATCAGGGTGGTCACG 8 GCACGCTGCCGTCCGAACTCCCCAGGATGGGCACCCCGTAGG 9 AGCTCGAAGCAGGACCATGTGGCGAGCTGTGCCCCAGGATGT 10 TTACGTCGCCGTCCAGGGTGGAGAAGATGGTGCGCCCAGCTT 11 TCCTTGAGCCAGGGCACGGGCTGGCCGTTTCTCGTTGGGGTC 12 TGTAGTTGCCGTCGTGCCGTCGCTGGTAGTGGTCGATCGCGC 13 GTGTTCTCTCCTTGAAGTCGACGGGTCTCGGTGGTGCAGATG 14 CGTCGCCGATGGGGTTTGCTCACACGCTGAACTTGAGCTTGC 15 TCGCCGGAGGGCGGACTGGGTACGGGGCCAGCTCG 16 CTCGCCCAACTTCAACTTCACCTCGGCGTGCCCTT 17 ATGCGGTCCCTCGAGGGTCAGCTTGCCG 18 TGTCGGGCAGCAGCGCTCAGGCATCGCC Biotin-SS-attached DNA strands for streptavidin magnetic beads purification RNA-templated DNA tile (R32-6A-SS-biotin) 5 -Biotin-SS-TTTT-CTCGCCGGACACGCTGCGTAGGTG-3 RNA-templated DNA tile (R33-6A-SS-biotin) 5 -Biotin-SS-TTTT-CCCTCGCCGGACACGCTGTAGGTGG-3 RNA-templated DNA tube (tube-18-ss-biotin) 5 -Biotin-SS-TTTT-TGTCGGGCAGCAGCGCTCAGGCATCGCC-3 S9

10 S10

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

2008, Gregersen et al., 2014, and Heyn et al., 2014, with modifications, such as extension to

2008, Gregersen et al., 2014, and Heyn et al., 2014, with modifications, such as extension to DETAILED PROTOCOL s 4 U-RNA enrichment with MTS chemistry This protocol uses MTS chemistry and builds upon previous methods developed by Dölken et al. 2008, Gregersen et al., 2014, and Heyn et al., 2014,

More information

Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers

Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Section 2: Eukaryotic Sample and Array Processing Rev. 3

Section 2: Eukaryotic Sample and Array Processing Rev. 3 Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic

More information

Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents

Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents For use with: llumina TruSeq adapter ligated libraries xgen Universal Blockers TS Mix (Catalog # 1075474, 1075475, 1075476)

More information

DuraScribe T7 Transcription Kit

DuraScribe T7 Transcription Kit DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The

More information

TaKaRa PCR Amplification Kit

TaKaRa PCR Amplification Kit Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

DNA Hybridization and Detection

DNA Hybridization and Detection Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................

More information

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2.

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2. RNA ENZYMES & GENE ANALYSIS HiScribe T7 Quick High Yield RNA Synthesis Kit Instruction Manual NEB #E2050S 50 reactions Version 2.1 1/17 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11 Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

KAPA Library Preparation Kits

KAPA Library Preparation Kits Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Cloning Small RNAs for Sequencing with 454 Technology

Cloning Small RNAs for Sequencing with 454 Technology Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed

More information

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

MicroElute Cycle-Pure Kit

MicroElute Cycle-Pure Kit MicroElute Cycle-Pure Kit D6293-00 5 preps D6293-01 50 preps D6293-02 200 preps MicroElute Gel Extraction Kit D6294-00 5 preps D6294-01 50 preps D6294-02 200 preps MicroElute DNA Clean Up Kit D6296-00

More information

ChIP-chip protocol adapted for the mod-encode project

ChIP-chip protocol adapted for the mod-encode project ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

E.Z.N.A. Cycle Pure Kit

E.Z.N.A. Cycle Pure Kit E.Z.N.A. Cycle Pure Kit D6492-00 5 preps V-spin D6492-01 50 preps V-spin D6492-02 200 preps V-spin D6493-00 5 preps Q-spin D6493-01 50 preps Q-spin D6493-02 200 preps Q-spin March 2017 E.Z.N.A. Cycle Pure

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100

More information

TruSeq ChIP Sample Preparation

TruSeq ChIP Sample Preparation FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

Amino-allyl Dye Coupling Protocol

Amino-allyl Dye Coupling Protocol Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.

More information

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab) Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly Maia Godonoga 1,2, Ting-Yu Lin 1#, Azusa Oshima 3, Koji Sumitomo 3, Marco S. L. Tang 4, Yee-Wai Cheung

More information

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit

More information

Microarray protocol Emmanuela Marchi PhD Dept. Pharmacology UFIR - Comparative nutritional systems biology Focus Team Post-doc emanuela.marchi@unifi.it 16 April 2009 When citing this SOP you should acknowledge

More information

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4

More information

E.Z.N.A. Blood DNA Midi Kit. D preps D preps

E.Z.N.A. Blood DNA Midi Kit. D preps D preps E.Z.N.A. Blood DNA Midi Kit D3494-00 2 preps D3494-04 100 preps August 2013 E.Z.N.A. Blood DNA Midi Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

GeneChip Eukaryotic Small Sample Target Labeling Assay Version II *

GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * Introduction There is an overwhelming and continuing demand for a well characterized protocol

More information

HiScribe. T7 ARCA mrna Kit (with tailing) RNA ENZYMES & GENE ANALYSIS. Instruction Manual. NEB #E2060S 20 reactions Version /16 NEB #S1560S

HiScribe. T7 ARCA mrna Kit (with tailing) RNA ENZYMES & GENE ANALYSIS. Instruction Manual. NEB #E2060S 20 reactions Version /16 NEB #S1560S RNA ENZYMES & GENE ANALYSIS HiScribe T7 ARCA mrna Kit (with tailing) Instruction Manual NEB #E2060S 20 reactions Version 1.1 10/16 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

PROTOCOL. MessageAmp II-Bacteria Kit

PROTOCOL. MessageAmp II-Bacteria Kit PROTOCOL MessageAmp II-Bacteria Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Taura Syndrome Virus (TSV) RT-PCR Kit

Taura Syndrome Virus (TSV) RT-PCR Kit Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro

More information

Bacterial 16S rdna PCR Kit Fast (800)

Bacterial 16S rdna PCR Kit Fast (800) Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

PROTOCOL. Amino Allyl MessageAmp II arna Amplification Kit

PROTOCOL. Amino Allyl MessageAmp II arna Amplification Kit PROTOCOL Amino Allyl MessageAmp II arna Amplification Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without

More information

Pinpoint Slide DNA Isolation System Catalog No. D3001

Pinpoint Slide DNA Isolation System Catalog No. D3001 INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue

More information

E.Z.N.A. Size Select-IT Kit. D preps D preps D preps

E.Z.N.A. Size Select-IT Kit. D preps D preps D preps E.Z.N.A. Size Select-IT Kit D6488-00 10 preps D6488-01 50 preps D6488-02 200 preps September 2012 E.Z.N.A. Size Select-IT Table of Contents Introduction...2 Illustrated Protocol...3 Size Selection Guide...4

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

E.Z.N.A. Water DNA Kit. D preps D preps D preps

E.Z.N.A. Water DNA Kit. D preps D preps D preps E.Z.N.A. Water DNA Kit D5525-00 5 preps D5525-01 50 preps D5525-02 200 preps April 2017 E.Z.N.A. Water DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

GFX PCR DNA and Gel Band Purification Kit

GFX PCR DNA and Gel Band Purification Kit instructions product code: 27-9602-01 GFX PCR DNA and Gel Band Purification Kit Warning For research use only. Not recommended or intended for the diagnosis of disease in humans or animals. Do not use

More information

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit DNA MODIFYING ENZYMES Q5 Site-Directed Mutagenesis Kit Instruction Manual NEB #E0554S 10 reactions Version 1.0 1/13 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida. For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Takashi Kawakami, Hiroshi Murakami, and Hiroaki Suga. Preparation of Flexizyme, Microhelix RNA, Suppressor trna Asn-E2 and Initiator

Takashi Kawakami, Hiroshi Murakami, and Hiroaki Suga. Preparation of Flexizyme, Microhelix RNA, Suppressor trna Asn-E2 and Initiator Chemistry & Biology 15 Supplemental Data Messenger RNA-Programmed Incorporation of Multiple N-Methyl-Amino Acids into Linear and Cyclic Peptides Takashi Kawakami, Hiroshi Murakami, and Hiroaki Suga Supplemental

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Simultaneous Elimination of Carryover Contamination and Detection of DNA

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Fungal rdna (D1/D2) PCR Kit Fast

Fungal rdna (D1/D2) PCR Kit Fast Cat. # RR184A For Research Use Fungal rdna (D1/D2) PCR Kit Fast Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V.

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

Biotin 3' End DNA Labeling Kit

Biotin 3' End DNA Labeling Kit INSTRUCTIONS Biotin 3' End DNA Labeling Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 89818 1290.4 Number Description 89818 Biotin 3' End DNA Labeling Kit, sufficient reagents to perform 20

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

E.Z.N.A. Bacterial RNA Kit. R preps R preps

E.Z.N.A. Bacterial RNA Kit. R preps R preps E.Z.N.A. Bacterial RNA Kit R6950-00 5 preps R6950-01 50 preps July 2017 E.Z.N.A. Bacterial RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Before Beginning...4

More information

Cat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da

Cat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template

More information

E.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps

E.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3

More information

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen

More information

RT 2 Easy First Strand Handbook

RT 2 Easy First Strand Handbook March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,

More information

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,

More information

Basic Protocol (v. 2.0, May, 2003)

Basic Protocol (v. 2.0, May, 2003) Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.

More information

NEBNext Ultra Ligation Module

NEBNext Ultra Ligation Module LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Enzymatic Incorporation of Biotin-16

Enzymatic Incorporation of Biotin-16 Enzymatic Incorporation of Biotin-16 16-AA-dTs TriLink BioTechnologies, Inc. Research and Development Contributors: Joyclyn Yee, Stephanie erry, Michelle Mcamara, atasha aul verview Biotin is a naturally

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 3) Instruction Manual NEB #E7710S/L 24/96 reactions This product is intended for research purposes only. This product is not intended

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4) LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 4) Instruction Manual NEB #E7730S/L 24/96 reactions Version 2.0 12/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc. Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information