Disclaimer. The digital PCR principle. Digital PCR by publication numbers. A brief history or digital PCR

Transcription

1 Digital droplet PCR (ddpcr): Research and Clinical Applications 2th Annual Symposium on Molecular Pathology Royal Oak, MI September 21, 216 Sabine Hellwig, Ph.D. ARUP Laboratories, Salt Lake City, UT Disclaimer Manufacturers of commercially available digital PCR instrumentation and reagents will be mentioned as part of this presentation. Any references to technology and products should not be interpreted as personal endorsement by myself or by ARUP. I have no conflicts of interest to declare. Digital PCR by publication numbers Source: Google Scholar Non target Target The digital PCR principle Global PCR analysis Par oned analysis 1% target 1% target Absolute quan ta on by all or nothing digital read out Rela ve quan ta on and absolute quan ta on by standard curve All PCR based methods only quantify amplifiable and accessible targets! A brief history or digital PCR First use of PCR on single template molecules: A brief history or digital PCR Use of limiting dilution PCR for absolute quantitation: "Single-molecule PCR" "Limiting/limited dilution PCR" "Single-molecule PCR" "Limiting/limited dilution PCR" 1

2 Real time qpcr: The successful big brother Real time qpcr and dpcr compared "Single-molecule PCR" "Limiting/limited dilution PCR" "Real-time PCR" "Real-time quantitative PCR" Real time qpcr Digital PCR Similarities Compatibility with sample preps (gdna digestion or shearing for dpcr) Reaction components and chemistry (e.g. Hot start master mix; fluorescent probes; primers) Compatibility with hydrolysis (Taqman) or intercalating (SYBR, EvaGreen) chemistries Multiplexing capacity Similar initial reaction and sample volumes Wide dynamic range Quantification Relative; standard curve Absolute; no external calibrant needed Data Collection Real time (every cycle) End point Sensitivity.1 1% MAF.% Specificity Reproducibility Non specificity of primers and probes problematic Medium; StDev high at low concentrations Non specific cross reactivity reduced by partitioning High Low StDev dpcr technology catches up Bead/droplet partitioning (BEAMing) Microfluidics Commercially available dpcr platforms Chamber partitioning Centrifugation Partitioning Detection CCD Chamber partitioning Open Sealed Mixed Droplet partitioning Workflow 496 Flow cytometry Partition volume pl Partition number ~1,, 3nL Partitions Reaction volume Samples per chip Capacity per run BioMark HD QuantStudio 3D Constellation Clarity 76 ; 77 (9,18 ; 36,96 per chip) 2, 496 (47,616 per chip) 1, 8μL; 4μL 14.μL 1μL 1μL 12 ; ; samples (PCR) 1 sample (reader) 96 1 chip/tube; 8 tubes/strip 96 samples (PCR) 32 samples (reader) Detection EvaGreen, FAM/VIC SYBR, FAM/VIC FAM/VIC +custom FAM/VIC Commercially available dpcr platforms Droplet partitioning Droplet based digital PCR: Cost metrics* Partitions (volume) Reaction volume Samples per chip QX2 Droplet digital PCR 2, (.8nL) RainDrop,, 1,, (pl) Naica Crystal digital PCR 2, 3, (.43nL) 2μL 2 μl 2μL 1 8(DG8 cartridge) 96 (AutoDG ) 8 4 Capacity 96 well plate 8 12 Detection Flowcytometric based EvaGreen, FAM/VIC (2 channel) Flowcytometric based EvaGreen, FAM/VIC (2 channel) CCD camera FAM/VIC/Cy (3 channel) System cost Cost per well (all in) Cost per droplet QX2 Droplet digital PCR $92,18 (DG8) $138,3 (AutoDG) RainDrop Naica Crystal digital PCR $ 12, $ 9, $ 3. $ $ 7 8 $.2 $.2. $.2.3 * List prices reported by manufacturers. Please contact manufacturers for detailed quotes. 2

3 QX2 Droplet based dpcrworkflow 1 Reaction setup 2 Droplet generation 3 PCR amplification 4 Droplet detection, data analysis and visualization Channel 1 amplitude Data visualization 1 D plot (single channel) Frequency Amplitude RainDrop Channel 1 amplitude Rain Naica Event number Images adapted from: Koch, H., et al. (216). "Use of ddpcr in experimental evolution studies." Methods in Ecology and Evolution 7. Huggett, J. F., et al. (213). "The digital MIQE guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments." Clin Chem 9 Channel 1 (FAM ) amplitude Data visualization 2 D plot (two channels) FAM+/VIC FAM /VIC empty FAM+/VIC+ FAM /VIC+ Channel 2 (VIC ) amplitude Quantification using (droplet) dpcr 1 Absolute quantification (Molecular counting) Copies/μL input sample Copies per unit of analyte (e.g. copies per ml plasma in ctdna analyses) 2 Relative quantification MAF of mutant v. wildtype CNV Partitioning of DNA follows a Poisson distribution. T D P N V P copies per μlsample total dilution factor PCR positive partitions total partitions analyzed partition volume Image adapted from: Koch, H., et al. (216). "Use of ddpcr in experimental evolution studies." Methods in Ecology and Evolution 7. Possible pitfalls of molecular counting by dpcr All PCR based methods only quantify amplifiable and accessible targets! Fragment length Chemical modification (formalin x linking) Denaturation state (denatured dsdna leads to two positive counts) Assay inhibitors Concatameric sequences RT efficiency in cdna analysis Single assay dropout in multiplexed experiments Design and optimization and considerations Successful digital PCR requires amplification of a large number or reactions containing low target copy numbers. Well designed, well optimized and well controlled assays are essential. 3

4 1 Intercalation chemistry Common assay chemistries Assay design Thorough in silico analyses of primer and probe design including Primer BLAST Secondary structure and primer dimers Consideration of pseudogenes 2 Hydrolysis probe chemistry Hydrolysis probe binds to the target sequence during annealing phase BRAF * * * * * * * * * * * 1 atatatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagtgaaatctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatg 119 # ## # # ## # 1 atatagttcttcatgaagacctcacagtggaaataggtgattttggtctagccacagtgaaatcttgatggagtgggtcccatcagtttgaacagttgtctggatcttttttgtgtatg 119 * * * * * * * * * * * BRAFP1 Displacement of probe during elongation results in cleavage of probe and reporter release Biophysical properties of probes Optimize probe performance through inclusion of modifications (e.g. MGB, LNA) or additional quencher (e.g. ZEN) biophysics.idtdna.com Images adapted from: BioRad Bulletin 647 Verify correct amplicon Melting curve by qpcr Amplicon sequencing Internal probe Assay optimization Test primers & probes Optimize PCR conditions Annealing temp gradient [Primer/probes] # of amplification cycles Optimize multiplex environment Single vs. multiplex pilot assays with controls Confirm with reference material Linearity Sensitivity Efficiency Image adapted from: Koch, H., et al. (216). "Use of ddpcr in experimental evolution studies." Methods in Ecology and Evolution 7. Minimum Information for Publication of Quantitative Digital PCR Experiments The Shortlist Essential Desired Mean copies per partition Partition volume variance/sd Number of partitions Limit of detection of calibration control Template structure, type, source and Optimization data (thermal gradients; cycle processing number) Partition volume Limit of detection of calibration control Total volume of measured partitions Total PCR volume prepared (effective reaction size) Comprehensive details of data analyses and appropriate use of controls, including No template/wildtype controls for false positive assay background Example plots for how positive/negative threshold is set ( gating guide ) Examples of positive and negative data plots (supplemental) Experimental variance and CI All things considered Digital PCR uniquely measures extremely low target concentrations independent of external standard curves with high precision with high repeatability in a complex background Applications of dpcr Biomedical research and clinical diagnostics Rare allele detection in heterogeneous tumors or other genetic diseases Copy number variation (CNV) analysis Liquid biopsies Non invasive prenatal diagnostics Transplantation biomarker detection Pathogen/viral load determination Gene expression Research tool Assessing integrity of DNA specimen Library quantification for NGS Validation of low frequency mutations identified by sequencing Other Absolute quantification of standards Environmental monitoring GMO detection Detection of foreign DNA contamination in industrial processes Food quality control 4

5 Standards & Reference Material Environmental studies * * Essential for Development of analytical methods Calibration of measurement systems Determination of performance characteristics Quality assurance in manufacturing, laboratories & forensics 3 step CNV measurement 1. Quantitation of the target gene (HER2) 2. Quantitation of unamplified reference gene(s) CRM for HER2 copy number measurements Reference genes Image credit: Washington Post Water Research (214) qpcr dpcr * 3. Comparison to reference gene(s) (ratio) dpcr increases accuracy by eliminating external calibrant HER2 amplified cell lines He et al., Biomol Detect Quantif (216) dpcr enables detection of bacterial contaminants in the presence of PCR inhibitors Environmental PCR inhibitors ddpcr for NGS library quantification Assessment of DNA integrity by ddpcr Exact molar quantification of sequencing libraries is essential for Optimizing DNA flowcell input Pooling of indexed libraries Challenges: Presence of primer dimers and adapter dimers Size variations in library content requires normalization Different concentrations of probe High quality FFPE Medium quality FFPE Low quality FFPE ddpcr allows for absolute and reliable library quantification Equal in quality to other methods (Qubit, qpcr) Superior in quality in low abundance libraries and libraries with primer dimer content Robin, J. D., et al. (216). "Comparison of DNA Quantification Methods for Next Generation Sequencing." Sci Rep 6: 2467 Didelot, A., et al. (213). "Multiplex picoliter droplet digital PCR for quantitative assessment of DNA integrity in clinical samples." Clin Chem 9(): Viral load detection Viral load tracking during clinical treatment of avian influenza H7N9(A) infected patient by RT ddpcr (1 data points) Comparison to real time RT PCR Sample Neg Pos Molecular margins, treatment response, & early recurrence monitoring by ctdna Biopsy or Surgery Targeted and/or Chemotherapy Recurrence Monitoring RT ddpcr more sensitive and accurate in detecting avian influenza H7N9(A) viral loads Positive calls by qpcr Positive calls by ddpcr Clinical significance: Two consecutive negative results required for transfer out of isolation Yan, Y., et al. (216). "Dynamic quantification of avian influenza H7N9(A) virus in a human infection during clinical treatment using droplet digital PCR." J Virol Methods 234: Pre OP FFPE Solid Tumor NGS Post OP Intervals During Therapy Pre Therapy Post Therapy Intervals at time of imaging Digital PCR allows for low cost, high sensitivity serial monitoring of single or few mutations!

6 Our foray into ddpcr at ARUP: Validated digital PCR assays for mutation detection in cfdna Determining a false positive threshold with healthy donor cfdna EGFR T79M Resistance mutation causing loss of sensitivity to EGFR targeted primary TKI therapy (erlotinib, gefitinib) in nonsmall cell lung cancer (NSCLC) Average progression on TKI after 11 months (1% progression rate) T79M accounts for 2/3 of cases with acquired resistance Next generation TKI with (prospective) FDA approval: Osimeritinib (Tagrisso, Astra Zeneca) accelerated approval Nov 21 Rocelitinib (Clovis) delayed approval BRAF V6E Activating point mutation in the BRAF kinase domain % of melanoma, 2 4% of thyroid cancers, 8 1% of colorectal, 1 4% of NSCLC Valine to glutamate accounts for ~9% of mutations at V6 Associated with increased sensitivity to Dabrafenib (BRAF inhibitor) Vermurafenib (BRAF inhibitor) Trametinib, cobimetinib (MEK inhibitors) Wildtye probe intensity (TET) Wildtye probe intensity (TET) BRAF wildtype cluster BRAFnegative cluster POS BRAF V6E cluster V6E probe intensity (FAM) Healthy cfdna V6E probe intensity (FAM) Proportion of healthy controls Proportion of healthy controls LoB LoD False True positive positive counts counts < False positive T79M droplets False True positive positive counts counts < False positive V6E droplets EGFR T79M (n = 4) LoB LoD BRAF V6E (n = 36) False positive (α) error: <.1 False positive threshold and LoD Mutant allele Frequency Mutant allele Frequency False positive threshold and LoD varies with input DNA Mutant copies per mililiter plasma LoD (in %) Input of amplifyable DNA Validated input range (equal false positive background) LoD at minimum specimen requirement (12 counts):.% Total EGFR droplets LoD at maximum input (1ng DNA; ~27 counts):.2% ng cfdna per ml plasma Healthy Lung Melanoma CRC LoD (in %) Input of amplifyable DNA LoD at minimum specimen requirement (12 counts):.% Total EGFR droplets LoD at maximum input (1ng DNA; ~27 counts):.2% mL plasma extracted 3mL plasma equivalent assay input 6 true positive droplets = 2 mutant copies/ml is constant because it is independent of healthy cfdna The clinical significance of absolute quantification (V6E+ melanoma) Dynamic monitoring of treatment outcome by T79M dpcr (NSCLC) ng cfdna per ml plasma MAF VE copies / ml plasma hosp. ipi + HF1 high ipi disc. (T14 trial) LFT HF1 contd Days monitored Days monitored Progr healthy 7 percentile healthy mean healthy 2 percentile Inflation in cfdna content skews MAF! Day Day : : % 3.6% 14 VE copies/ 787/mL ml plasma Day 42 Day : : % 28.% 798/mL 1446/mL T79M copies T79M Allele RECIST Score per ml plasma Frequency (plasma) Rociletinib Rociletinib Erlotinib (37mg) (2mg) Osimeritinib % 1 1.3% 1.11%.9%.1.4% % -21.1% % -36.8% % -31.6% -31.6% Progession (non-recist lesions) Days on TKI therapy LC7P1 223: % 727/mL T79M probe intensity LC7P 1: % 4/mL T79M probe intensity LC7P3 1:99 <LoD T79M probe intensity LC7P9 11: % 3/mL T79M probe intensity Days monitored 6

7 The future of dpcr technology (My Wishlist) Thank you! AMP & the 216 Beaumont Symposium Expanded multiplexing capabilities Expanded set of detection channels Expanded probe catalog (e.g. molecular beacons) In droplet correlation of single cell protein marker analysis and digital PCR Droplet sorting and recoverycapabilities 7