Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD
|
|
- Leona Burns
- 6 years ago
- Views:
Transcription
1 Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD
2 Variant Type Alkan et al, Nature Reviews Genetics 2011 doi: /nrg2958
3 Variant Type
4 Venn diagrams showing the number of identified variants for tested germline (A), somatic (B), CNV (C) and exome CNV (D) tools. Pabinger S et al. Brief Bioinform 2013;bib.bbs086 The Author Published by Oxford University Press.
5 Variant discovery large scale variants breakdancer Predicts five types of structural variants: insertions, deletions, inversions, inter- and intra-chromosomal translocations. delly Predicts deletions, tandem duplications, inversions and translocations.
6 Variant discovery SNPs/InDels SAMtools FreeBayes SNPs and short INDELs A Bayesian genetic variant detector designed to find SNPs, indels, MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment. GATK A suite of tools including local realigner, quality score recalibrator, and SNP/INDEL caller.
7 Variant calling with SAMtools Statistics is carried out to calculate the likelihood score for each mis-match from the reference genome present in mapped reads. Number of reads that share a mis-match The sequence quality Expected sequencing error rates Limitation Limited by the mapping quality of the reads Assuming sample is diploid Example Samtools mpileup -ud -r 2L:100, ,000 -f reference.fasta input1.bam input2.bam Bcftools view -bvcg - > raw.bcf Bcftools view raw.bcf vcfutils.pl varfilter -D100 > variants.vcf Heng Li, Bioinformatics, Vol. 27, no. 21, 2011, p2987
8 Variant calling with Freebayes FreeBayes Call variants based upon haplotypes up to the length of sequencing reads Nearby variants are identified on the same haplotype, so they are in phase Able to handle polyploidy Limitation All types of variants are called simultaneously Limited by the mapping quality of reads Example Freebayes -f reference.fasta region 20: input1.bam input2.bam > raw.vcf Erik Garrison, Gabor Marth. arxiv: v2 [q-bio.gn]
9 GATK variant calling workflow
10 Mark Duplicates Why duplicates are bad
11 Indel Realignment Several Consecutive SNPs only found on reads ending on the right of the homopolymer Several consecutive SNPs only found on reads ending on the left of the homopolymer
12 Indel Realignment
13 Indel Realignment Information used to carry out indel realignment Known sites (dbsnp, 1000 Genomes) Indels present in original alignments (in CIGARs) Sites where evidence suggests a hidden indel
14 Indel Realignment + Known sites Input BAM file not necessary if processing only at known indels Known indels speed up processing and improve accuracy, but is not required At indels seen in the original BAM is the recommended mode Only at known indels speed up processing, accurate for ~90-95% of indels Using full Smith-Waterman realignment is the most accurate, but has heavy computational cost and not really necessary with the new techs
15 Indel Realignment DePristo M., Banks E., Poplin R. et. al., A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Gen.
16 Base Quality Score Recalibration Quality scores are critical for all downstream analysis The quality scores issued by sequencers are inaccurate and biased Recalibration information is obtained by analyzing covariation among several features of a base, e.g.: Reported quality score Position within the read (machine cycle) Preceding and current nucleotide (sequencing chemistry effect) Known variants are used to discount most of the real genetic variation present in the sample All other differences from the reference are assumed to be sequencing errors Indel Realignments first reduces noise from misalignments
17 Base Quality Score Recalibration
18 Read Compression Keeps only essential information for variant calling Variable vs consensus regions
19 Initial Variant Calling Distinguish genetic variant and random machine noise Large scale Bayesian modeling problem Assembly of large genomes using second-generation sequencing. Schatz. Genome Research. 2010
20 Variant Quality Score Recalibration or Hard Filtering Initial variant calling has very large set that is full of false positives Hand-tuned filtering requires time and expertise Statistical model could be used to recalibrate variants Each variant has a set of statistics associated with them that are called variant annotations Real variants tend to cluster together via these statistics The cluster tend to be Gaussianly distributed, which makes possible to use a Gaussian mixture model to fit the data and new potential variants can be evaluated against this model
21 Variant Quality Score Recalibration Training resources: SNP (HapMap, Omni, 1000G, dbsnp) INDEL (Mills)
22 Variant Quality Score Recalibration
23 Variant Filtering Small data sets in terms of both number of samples or size of targeted regions No available high confidence known variants database For SNPs: QD < 2.0 MQ < 40.0 FS > 60.0 MQRankSum < ReadPosRankSum < -8.0 For indels: QD < 2.0 ReadPosRankSum < InbreedingCoeff < -0.8 FS > See more at:
24 GATK variant calling workflow
25 Thank you!
SNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationVariant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012
+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools
More informationData processing and analysis of genetic variation using next-generation DNA sequencing!
Data processing and analysis of genetic variation using next-generation DNA sequencing! Mark DePristo, Ph.D.! Genome Sequencing and Analysis Group! Medical and Population Genetics Program! Broad Institute
More informationVariation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI
Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality
More informationGermline variant calling and joint genotyping
talks Germline variant calling and joint genotyping Applying the joint discovery workflow with HaplotypeCaller + GenotypeGVCFs You are here in the GATK Best PracDces workflow for germline variant discovery
More informationNext Generation Sequencing: Data analysis for genetic profiling
Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationIntegrating human sequence data sets provides a resource of benchmark SNP and indel genotype calls
Integrating human sequence data sets provides a resource of benchmark SNP and indel genotype calls The Harvard community has made this article openly available. Please share how this access benefits you.
More informationPersonal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
More informationCalling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona
Calling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona Variant Effect Predictor Training Course Heraklion, 31st October 2016 Calling DNA Variants - Overview 2 1. 2.
More informationChang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationMoGUL: Detecting Common Insertions and Deletions in a Population
MoGUL: Detecting Common Insertions and Deletions in a Population Seunghak Lee 1,2, Eric Xing 2, and Michael Brudno 1,3, 1 Department of Computer Science, University of Toronto, Canada 2 School of Computer
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationThe Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples
The Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples Andreas Scherer, Ph.D. President and CEO Dr. Donald Freed, Bioinformatics Scientist, Sentieon
More informationSupplementary Material for Extremely low-coverage whole genome sequencing in South Asians captures population genomics information
Supplementary Material for Extremely low-coverage whole genome sequencing in South Asians captures population genomics information Navin Rustagi, Anbo Zhou, W. Scott Watkins, Erika Gedvilaite, Shuoguo
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationThe Sentieon Genomics Tools A fast and accurate solution to variant calling from next-generation sequence data
The Sentieon Genomics Tools A fast and accurate solution to variant calling from next-generation sequence data Donald Freed 1*, Rafael Aldana 1, Jessica A. Weber 2, Jeremy S. Edwards 3,4,5 1 Sentieon Inc,
More informationCNV and variant detection for human genome resequencing data - for biomedical researchers (II)
CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common
More informationTargeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition
RESEARCH ARTICLE Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition Moses M. Muraya 1,2, Thomas Schmutzer 1 *, Chris Ulpinnis
More informationHaplotype-based variant detection from short-read sequencing
Haplotype-based variant detection from short-read sequencing Erik Garrison and Gabor Marth November 4, 2016 Abstract With genomic variant detection methods, we can determine point-wise differences against
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationIntroduc)on to NGS Variant Calling
Introduc)on to NGS Variant Calling Bioinforma)cs analysis and annota)on of variants in NGS data workshop Cape Town, 4 th to 6 th April 2016 Sumir Panji, Amel Ghouila, Gerrit Botha Types of variants Learning
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationA Pipeline for Markers Selection Using Restriction Site Associated DNA Sequencing (RADSeq)
European Journal of Biophysics 2018; 6(1): 7-16 http://www.sciencepublishinggroup.com/j/ejb doi: 10.11648/j.ejb.20180601.12 ISSN: 2329-1745 (Print); ISSN: 2329-1737 (Online) A Pipeline for Markers Selection
More informationComprehensive Analysis to Improve the Validation Rate for Single Nucleotide Variants Detected by Next- Generation Sequencing
Comprehensive Analysis to Improve the Validation Rate for Single Nucleotide Variants Detected by Next- Generation Sequencing Mi-Hyun Park 1., Hwanseok Rhee 2., Jung Hoon Park 2, Hae-Mi Woo 1, Byung-Ok
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationLUMPY: A probabilistic framework for structural variant discovery
LUMPY: A probabilistic framework for structural variant discovery Ryan M Layer 1, Aaron R Quinlan* 1,2,3,4 and Ira M Hall* 2,4 1 Department of Computer Science 2 Department of Biochemistry and Molecular
More informationLinking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationWhy can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationAlignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics
Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationSV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches
International Journal of Pharma Medicine and Biological Sciences Vol. 5, No. 4, October 2016 SV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches
More informationSequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:
Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation
More informationOHSU Digital Commons. Oregon Health & Science University. Benjamin Cordier. Scholar Archive
Oregon Health & Science University OHSU Digital Commons Scholar Archive 5-19-2017 Evaluation Of Background Prediction For Variant Detection In A Clinical Context: Towards Improved Ngs Monitoring Of Minimal
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationH3A - Genome-Wide Association testing SOP
H3A - Genome-Wide Association testing SOP Introduction File format Strand errors Sample quality control Marker quality control Batch effects Population stratification Association testing Replication Meta
More informationVariant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017
Variant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017 Up-front acknowledgments Many figures/slides come from: GATK Workshop slides: http://www.broadinstitute.org/gatk/guide/events?id=2038
More informationGoat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects
Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects Gwenola Tosser-Klopp on behalf of IGGC Outline IGGC presentation
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationAmapofhumangenomevariationfrom population-scale sequencing
doi:.38/nature9534 Amapofhumangenomevariationfrom population-scale sequencing The Genomes Project Consortium* The Genomes Project aims to provide a deep characterization of human genome sequence variation
More informationBest practices for Variant Calling with Pacific Biosciences data
Best practices for Variant Calling with Pacific Biosciences data Mauricio Carneiro, Ph.D. Mark DePristo, Ph.D. Genome Sequence and Analysis Medical and Population Genetics carneiro@broadinstitute.org 1
More informationComplementary Technologies for Precision Genetic Analysis
Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIntroduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron
Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Genotype calling Genotyping methods for Affymetrix arrays Genotyping
More informationVariant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationLees J.A., Vehkala M. et al., 2016 In Review
Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationA light weight SNP detection algorithm for the breast cancer targeted sequencing data.
Biomedical Research 2017; 28 (8): 3574-3579 ISSN 0970-938X www.biomedres.info A light weight SNP detection algorithm for the breast cancer targeted sequencing data. Guobin Chen, Xianzhong Xie * Institute
More informationSeqStudio Genetic Analyzer
SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationCreate a Planned Run. Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin USER BULLETIN. Publication Number MAN Revision A.
USER BULLETIN Create a Planned Run Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin Publication Number MAN0013730 Revision A.0 For Research Use Only. Not for use in diagnostic procedures.
More informationUC Davis UC Davis Previously Published Works
UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome
More informationTraining materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationReference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
More informationVariant Analysis. CB2-201 Computational Biology and Bioinformatics! February 27, Emidio Capriotti!
Variant Analysis CB2-201 Computational Biology and Bioinformatics February 27, 2015 Emidio Capriotti http://biofold.org/emidio Division of Informatics Department of Pathology Variant Call Format The final
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationSequencing, Assembling, and Correcting Draft Genomes Using Recombinant Populations
INVESTIGATION Sequencing, Assembling, and Correcting Draft Genomes Using Recombinant Populations Matthew W. Hahn,*,,1 Simo V. Zhang, and Leonie C. Moyle* *Department of Biology and School of Informatics
More informationDATA FORMATS AND QUALITY CONTROL
HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationDeveloping Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationRead Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical
More informationOral Cleft Targeted Sequencing Project
Oral Cleft Targeted Sequencing Project Oral Cleft Group January, 2013 Contents I Quality Control 3 1 Summary of Multi-Family vcf File, Jan. 11, 2013 3 2 Analysis Group Quality Control (Proposed Protocol)
More informationIntroduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron
Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron Many sources of technical bias in a genotyping experiment DNA sample quality and handling
More informationA pathogenic mutation was identified in the LDLR gene.
Hereditary High Cholesterol Test ORDERING PHYSICIAN Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA SPECIMEN Type: Saliva Barcode: 333 234234 2343 Collected: Jul 15, 2017 Received: Jul 17,
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationMachine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University
Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationWhole genome sequencing in drug discovery research: a one fits all solution?
Whole genome sequencing in drug discovery research: a one fits all solution? Marc Sultan, September 24th, 2015 Biomarker Development, Translational Medicine, Novartis On behalf of the BMD WGS pilot team:
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationRADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé
RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationStructural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Structural variation Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Genetic variation How much genetic variation is there between individuals? What type of variants
More informationGenome Sequencing and Structural Variation
Genome Sequencing and Structural Variation Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #10 Today Structural Variation Deletions Duplications
More informationBull Selection Strategies Using Genomic Estimated Breeding Values
R R Bull Selection Strategies Using Genomic Estimated Breeding Values Larry Schaeffer CGIL, University of Guelph ICAR-Interbull Meeting Niagara Falls, NY June 8, 2008 Understanding Cancer and Related Topics
More information2. Materials and Methods
Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all
More information