Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD

Size: px
Start display at page:

Download "Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD"

Transcription

1 Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD

2 Variant Type Alkan et al, Nature Reviews Genetics 2011 doi: /nrg2958

3 Variant Type

4 Venn diagrams showing the number of identified variants for tested germline (A), somatic (B), CNV (C) and exome CNV (D) tools. Pabinger S et al. Brief Bioinform 2013;bib.bbs086 The Author Published by Oxford University Press.

5 Variant discovery large scale variants breakdancer Predicts five types of structural variants: insertions, deletions, inversions, inter- and intra-chromosomal translocations. delly Predicts deletions, tandem duplications, inversions and translocations.

6 Variant discovery SNPs/InDels SAMtools FreeBayes SNPs and short INDELs A Bayesian genetic variant detector designed to find SNPs, indels, MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment. GATK A suite of tools including local realigner, quality score recalibrator, and SNP/INDEL caller.

7 Variant calling with SAMtools Statistics is carried out to calculate the likelihood score for each mis-match from the reference genome present in mapped reads. Number of reads that share a mis-match The sequence quality Expected sequencing error rates Limitation Limited by the mapping quality of the reads Assuming sample is diploid Example Samtools mpileup -ud -r 2L:100, ,000 -f reference.fasta input1.bam input2.bam Bcftools view -bvcg - > raw.bcf Bcftools view raw.bcf vcfutils.pl varfilter -D100 > variants.vcf Heng Li, Bioinformatics, Vol. 27, no. 21, 2011, p2987

8 Variant calling with Freebayes FreeBayes Call variants based upon haplotypes up to the length of sequencing reads Nearby variants are identified on the same haplotype, so they are in phase Able to handle polyploidy Limitation All types of variants are called simultaneously Limited by the mapping quality of reads Example Freebayes -f reference.fasta region 20: input1.bam input2.bam > raw.vcf Erik Garrison, Gabor Marth. arxiv: v2 [q-bio.gn]

9 GATK variant calling workflow

10 Mark Duplicates Why duplicates are bad

11 Indel Realignment Several Consecutive SNPs only found on reads ending on the right of the homopolymer Several consecutive SNPs only found on reads ending on the left of the homopolymer

12 Indel Realignment

13 Indel Realignment Information used to carry out indel realignment Known sites (dbsnp, 1000 Genomes) Indels present in original alignments (in CIGARs) Sites where evidence suggests a hidden indel

14 Indel Realignment + Known sites Input BAM file not necessary if processing only at known indels Known indels speed up processing and improve accuracy, but is not required At indels seen in the original BAM is the recommended mode Only at known indels speed up processing, accurate for ~90-95% of indels Using full Smith-Waterman realignment is the most accurate, but has heavy computational cost and not really necessary with the new techs

15 Indel Realignment DePristo M., Banks E., Poplin R. et. al., A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Gen.

16 Base Quality Score Recalibration Quality scores are critical for all downstream analysis The quality scores issued by sequencers are inaccurate and biased Recalibration information is obtained by analyzing covariation among several features of a base, e.g.: Reported quality score Position within the read (machine cycle) Preceding and current nucleotide (sequencing chemistry effect) Known variants are used to discount most of the real genetic variation present in the sample All other differences from the reference are assumed to be sequencing errors Indel Realignments first reduces noise from misalignments

17 Base Quality Score Recalibration

18 Read Compression Keeps only essential information for variant calling Variable vs consensus regions

19 Initial Variant Calling Distinguish genetic variant and random machine noise Large scale Bayesian modeling problem Assembly of large genomes using second-generation sequencing. Schatz. Genome Research. 2010

20 Variant Quality Score Recalibration or Hard Filtering Initial variant calling has very large set that is full of false positives Hand-tuned filtering requires time and expertise Statistical model could be used to recalibrate variants Each variant has a set of statistics associated with them that are called variant annotations Real variants tend to cluster together via these statistics The cluster tend to be Gaussianly distributed, which makes possible to use a Gaussian mixture model to fit the data and new potential variants can be evaluated against this model

21 Variant Quality Score Recalibration Training resources: SNP (HapMap, Omni, 1000G, dbsnp) INDEL (Mills)

22 Variant Quality Score Recalibration

23 Variant Filtering Small data sets in terms of both number of samples or size of targeted regions No available high confidence known variants database For SNPs: QD < 2.0 MQ < 40.0 FS > 60.0 MQRankSum < ReadPosRankSum < -8.0 For indels: QD < 2.0 ReadPosRankSum < InbreedingCoeff < -0.8 FS > See more at:

24 GATK variant calling workflow

25 Thank you!

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Variant calling in NGS experiments

Variant calling in NGS experiments Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling

More information

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012 + Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools

More information

Data processing and analysis of genetic variation using next-generation DNA sequencing!

Data processing and analysis of genetic variation using next-generation DNA sequencing! Data processing and analysis of genetic variation using next-generation DNA sequencing! Mark DePristo, Ph.D.! Genome Sequencing and Analysis Group! Medical and Population Genetics Program! Broad Institute

More information

Variation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI

Variation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality

More information

Germline variant calling and joint genotyping

Germline variant calling and joint genotyping talks Germline variant calling and joint genotyping Applying the joint discovery workflow with HaplotypeCaller + GenotypeGVCFs You are here in the GATK Best PracDces workflow for germline variant discovery

More information

Next Generation Sequencing: Data analysis for genetic profiling

Next Generation Sequencing: Data analysis for genetic profiling Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines

More information

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling. Johannes Starlinger Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

More information

Axiom mydesign Custom Array design guide for human genotyping applications

Axiom mydesign Custom Array design guide for human genotyping applications TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required

More information

Integrating human sequence data sets provides a resource of benchmark SNP and indel genotype calls

Integrating human sequence data sets provides a resource of benchmark SNP and indel genotype calls Integrating human sequence data sets provides a resource of benchmark SNP and indel genotype calls The Harvard community has made this article openly available. Please share how this access benefits you.

More information

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,

More information

Calling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona

Calling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona Calling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona Variant Effect Predictor Training Course Heraklion, 31st October 2016 Calling DNA Variants - Overview 2 1. 2.

More information

Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang

Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John

More information

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS. Strand Genomics, Inc All rights reserved. About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

More information

MoGUL: Detecting Common Insertions and Deletions in a Population

MoGUL: Detecting Common Insertions and Deletions in a Population MoGUL: Detecting Common Insertions and Deletions in a Population Seunghak Lee 1,2, Eric Xing 2, and Michael Brudno 1,3, 1 Department of Computer Science, University of Toronto, Canada 2 School of Computer

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

The Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples

The Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples The Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples Andreas Scherer, Ph.D. President and CEO Dr. Donald Freed, Bioinformatics Scientist, Sentieon

More information

Supplementary Material for Extremely low-coverage whole genome sequencing in South Asians captures population genomics information

Supplementary Material for Extremely low-coverage whole genome sequencing in South Asians captures population genomics information Supplementary Material for Extremely low-coverage whole genome sequencing in South Asians captures population genomics information Navin Rustagi, Anbo Zhou, W. Scott Watkins, Erika Gedvilaite, Shuoguo

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%

More information

The Sentieon Genomics Tools A fast and accurate solution to variant calling from next-generation sequence data

The Sentieon Genomics Tools A fast and accurate solution to variant calling from next-generation sequence data The Sentieon Genomics Tools A fast and accurate solution to variant calling from next-generation sequence data Donald Freed 1*, Rafael Aldana 1, Jessica A. Weber 2, Jeremy S. Edwards 3,4,5 1 Sentieon Inc,

More information

CNV and variant detection for human genome resequencing data - for biomedical researchers (II)

CNV and variant detection for human genome resequencing data - for biomedical researchers (II) CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common

More information

Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition

Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition RESEARCH ARTICLE Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition Moses M. Muraya 1,2, Thomas Schmutzer 1 *, Chris Ulpinnis

More information

Haplotype-based variant detection from short-read sequencing

Haplotype-based variant detection from short-read sequencing Haplotype-based variant detection from short-read sequencing Erik Garrison and Gabor Marth November 4, 2016 Abstract With genomic variant detection methods, we can determine point-wise differences against

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Assignment 9: Genetic Variation

Assignment 9: Genetic Variation Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant

More information

Introduc)on to NGS Variant Calling

Introduc)on to NGS Variant Calling Introduc)on to NGS Variant Calling Bioinforma)cs analysis and annota)on of variants in NGS data workshop Cape Town, 4 th to 6 th April 2016 Sumir Panji, Amel Ghouila, Gerrit Botha Types of variants Learning

More information

What is genetic variation?

What is genetic variation? enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center

More information

A Pipeline for Markers Selection Using Restriction Site Associated DNA Sequencing (RADSeq)

A Pipeline for Markers Selection Using Restriction Site Associated DNA Sequencing (RADSeq) European Journal of Biophysics 2018; 6(1): 7-16 http://www.sciencepublishinggroup.com/j/ejb doi: 10.11648/j.ejb.20180601.12 ISSN: 2329-1745 (Print); ISSN: 2329-1737 (Online) A Pipeline for Markers Selection

More information

Comprehensive Analysis to Improve the Validation Rate for Single Nucleotide Variants Detected by Next- Generation Sequencing

Comprehensive Analysis to Improve the Validation Rate for Single Nucleotide Variants Detected by Next- Generation Sequencing Comprehensive Analysis to Improve the Validation Rate for Single Nucleotide Variants Detected by Next- Generation Sequencing Mi-Hyun Park 1., Hwanseok Rhee 2., Jung Hoon Park 2, Hae-Mi Woo 1, Byung-Ok

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

LUMPY: A probabilistic framework for structural variant discovery

LUMPY: A probabilistic framework for structural variant discovery LUMPY: A probabilistic framework for structural variant discovery Ryan M Layer 1, Aaron R Quinlan* 1,2,3,4 and Ira M Hall* 2,4 1 Department of Computer Science 2 Department of Biochemistry and Molecular

More information

Linking Genetic Variation to Important Phenotypes

Linking Genetic Variation to Important Phenotypes Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

Data Analysis with CASAVA v1.8 and the MiSeq Reporter

Data Analysis with CASAVA v1.8 and the MiSeq Reporter Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Why can GBS be complicated? Tools for filtering, error correction and imputation.

Why can GBS be complicated? Tools for filtering, error correction and imputation. Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

SV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches

SV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches International Journal of Pharma Medicine and Biological Sciences Vol. 5, No. 4, October 2016 SV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches

More information

Sequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:

Sequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer: Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation

More information

OHSU Digital Commons. Oregon Health & Science University. Benjamin Cordier. Scholar Archive

OHSU Digital Commons. Oregon Health & Science University. Benjamin Cordier. Scholar Archive Oregon Health & Science University OHSU Digital Commons Scholar Archive 5-19-2017 Evaluation Of Background Prediction For Variant Detection In A Clinical Context: Towards Improved Ngs Monitoring Of Minimal

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

H3A - Genome-Wide Association testing SOP

H3A - Genome-Wide Association testing SOP H3A - Genome-Wide Association testing SOP Introduction File format Strand errors Sample quality control Marker quality control Batch effects Population stratification Association testing Replication Meta

More information

Variant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017

Variant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017 Variant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017 Up-front acknowledgments Many figures/slides come from: GATK Workshop slides: http://www.broadinstitute.org/gatk/guide/events?id=2038

More information

Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects

Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects Gwenola Tosser-Klopp on behalf of IGGC Outline IGGC presentation

More information

Next-Generation Sequencing Services à la carte

Next-Generation Sequencing Services à la carte Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property

More information

Amapofhumangenomevariationfrom population-scale sequencing

Amapofhumangenomevariationfrom population-scale sequencing doi:.38/nature9534 Amapofhumangenomevariationfrom population-scale sequencing The Genomes Project Consortium* The Genomes Project aims to provide a deep characterization of human genome sequence variation

More information

Best practices for Variant Calling with Pacific Biosciences data

Best practices for Variant Calling with Pacific Biosciences data Best practices for Variant Calling with Pacific Biosciences data Mauricio Carneiro, Ph.D. Mark DePristo, Ph.D. Genome Sequence and Analysis Medical and Population Genetics carneiro@broadinstitute.org 1

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron

Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Genotype calling Genotyping methods for Affymetrix arrays Genotyping

More information

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information

Lees J.A., Vehkala M. et al., 2016 In Review

Lees J.A., Vehkala M. et al., 2016 In Review Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

DNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros

DNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

A light weight SNP detection algorithm for the breast cancer targeted sequencing data.

A light weight SNP detection algorithm for the breast cancer targeted sequencing data. Biomedical Research 2017; 28 (8): 3574-3579 ISSN 0970-938X www.biomedres.info A light weight SNP detection algorithm for the breast cancer targeted sequencing data. Guobin Chen, Xianzhong Xie * Institute

More information

SeqStudio Genetic Analyzer

SeqStudio Genetic Analyzer SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied

More information

Genome-wide association studies (GWAS) Part 1

Genome-wide association studies (GWAS) Part 1 Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations

More information

Create a Planned Run. Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin USER BULLETIN. Publication Number MAN Revision A.

Create a Planned Run. Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin USER BULLETIN. Publication Number MAN Revision A. USER BULLETIN Create a Planned Run Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin Publication Number MAN0013730 Revision A.0 For Research Use Only. Not for use in diagnostic procedures.

More information

UC Davis UC Davis Previously Published Works

UC Davis UC Davis Previously Published Works UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome

More information

Training materials.

Training materials. Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation

More information

Reference genomes and common file formats

Reference genomes and common file formats Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF

More information

Variant Analysis. CB2-201 Computational Biology and Bioinformatics! February 27, Emidio Capriotti!

Variant Analysis. CB2-201 Computational Biology and Bioinformatics! February 27, Emidio Capriotti! Variant Analysis CB2-201 Computational Biology and Bioinformatics February 27, 2015 Emidio Capriotti http://biofold.org/emidio Division of Informatics Department of Pathology Variant Call Format The final

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Sequencing, Assembling, and Correcting Draft Genomes Using Recombinant Populations

Sequencing, Assembling, and Correcting Draft Genomes Using Recombinant Populations INVESTIGATION Sequencing, Assembling, and Correcting Draft Genomes Using Recombinant Populations Matthew W. Hahn,*,,1 Simo V. Zhang, and Leonie C. Moyle* *Department of Biology and School of Informatics

More information

DATA FORMATS AND QUALITY CONTROL

DATA FORMATS AND QUALITY CONTROL HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

More information

Browsing Genes and Genomes with Ensembl

Browsing Genes and Genomes with Ensembl Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.

More information

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and

More information

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements

More information

Read Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

Read Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical

More information

Oral Cleft Targeted Sequencing Project

Oral Cleft Targeted Sequencing Project Oral Cleft Targeted Sequencing Project Oral Cleft Group January, 2013 Contents I Quality Control 3 1 Summary of Multi-Family vcf File, Jan. 11, 2013 3 2 Analysis Group Quality Control (Proposed Protocol)

More information

Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron

Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron Many sources of technical bias in a genotyping experiment DNA sample quality and handling

More information

A pathogenic mutation was identified in the LDLR gene.

A pathogenic mutation was identified in the LDLR gene. Hereditary High Cholesterol Test ORDERING PHYSICIAN Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA SPECIMEN Type: Saliva Barcode: 333 234234 2343 Collected: Jul 15, 2017 Received: Jul 17,

More information

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1 Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the

More information

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics

More information

Introduction to Next Generation Sequencing (NGS)

Introduction to Next Generation Sequencing (NGS) Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it

More information

Whole genome sequencing in drug discovery research: a one fits all solution?

Whole genome sequencing in drug discovery research: a one fits all solution? Whole genome sequencing in drug discovery research: a one fits all solution? Marc Sultan, September 24th, 2015 Biomarker Development, Translational Medicine, Novartis On behalf of the BMD WGS pilot team:

More information

Gap Filling for a Human MHC Haplotype Sequence

Gap Filling for a Human MHC Haplotype Sequence American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human

More information

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

Structural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Structural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Structural variation Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Genetic variation How much genetic variation is there between individuals? What type of variants

More information

Genome Sequencing and Structural Variation

Genome Sequencing and Structural Variation Genome Sequencing and Structural Variation Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #10 Today Structural Variation Deletions Duplications

More information

Bull Selection Strategies Using Genomic Estimated Breeding Values

Bull Selection Strategies Using Genomic Estimated Breeding Values R R Bull Selection Strategies Using Genomic Estimated Breeding Values Larry Schaeffer CGIL, University of Guelph ICAR-Interbull Meeting Niagara Falls, NY June 8, 2008 Understanding Cancer and Related Topics

More information

2. Materials and Methods

2. Materials and Methods Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all

More information