Senior scientist Henrik Hasman, National Food Institute-DTU. Henrik Hasman

Transcription

1 Staphylococcus aureus Protein A (spa) (p) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman hhas@food.dtu.dk

2 Typing method for S. aureus Gold standard - Phage typing and PFGE Phage and Band based Labourious: 2-6 days Analysis is subjective and can give non-typable results Communication of data is problematic DNA sequence-based methods Standardized protocol: 1-2 days Analysis is unambiguous Sequence data can easily be transferred Eg. MLST, coa, spa successfully used for S. aureus MLST is not suitable for routine surveillance of MRSA High cost and access to a high-throughput DNA sequencing facility The discriminative power of PFGE is generally higher than most DNA-based methods

3 2150bp Surface protein Virulence factor Protein A (spa) in S. aureus Binds to IgG via Fc-binding domain Reduce phagocytosis X-region-variable number of repeats Highly polymorphic» Deletion and duplication of repeats, and point mutations

4 Region X spontaneous point mutations, loss and/or gain of repeats Variations in the number of repeats DNA polymerase slippage and various recombination events Variations in individual id repeats are a result of mutagenesis 506 repeats known today (Nov ) 21-30nt (encode triplet codon) Repeats are assigned an numerical code (in Ridom/Bionummerics) spa type is deduced from the sequence and order of specific repeats

5

6 Spa-typing of S. aureus PCR and sequencing RCAMCAAAA SL r04 r20 r17 r20 r34 SR TAYATGTCGT 24 nt repeats (21 to 30 nt) GAGGAAGACAATAACAAGCCTGGT r04 AAAGAAGACAACAACAAACCTGGC r20 r04r20r17r20r34 = t2906

7 The SPA principle

8 How to translate sequence into SPA type? Manually (NOT recomended) d) Identify SL and SR Identify repeats Compare to list of all known repeat sequences Computer-based assignment At least two software solutions exists (Ridom and Bionumerics) Both are quiet expensive (3000+ Euros), but you might already have Bionumerics installed. Then the spa module is a free add-on. Or you might find a collaborating institute or hospital who has one of these programs installed. Otherwise contact your EU-RL (me) for help.

9

10

11

12

13 Bionumerics v4.61

14

15

16 Examples of related SPA types Genetic events t034 r08r16r02r25r02r25r34 r24r25 t571 r08r16r02r25r02r25r34 r25 1 t011 r08r16r02r25 r34 r24r25 2 t108 r08r16r02r25 r24r25 1 t1255 r08r16 r34 r24r25 2 L t1793 r08r16r02r25r02r25r34r24r24r25 1 t2876 r08r16r02r25r02r25r 24r25 1 S M t1333 r15r12r16r34 r02r25r17r24 >8 t899 r07r16 r23r02r34 >5 T

17 Examples of pittfalls in relating SPA types t528 r04 6,72,12,43,49,67,59 ST151 CC151 t524 r04r17 18,1,1,1,1,5,3 ST71 CC97 t529 r04r34 6,72,12,43,49,67, ST151 CC151

18 SPA typing vs MLST typing SPA typing has in general higher discriminative power than MLST and lower discriminative power than PFGE! - This means that many SPA types can belong to the same MLST type (also called Sequence Type ST). - Furthermore, closely related Sequence Types can be organized into so-called Clonal Complexes (CC s). t011 t034 t108 t571 t1255 t1793 t2876 ST398 ST804 ST1067 ST752 ST1232 ST621 CC398

19 SPA typing vs MLST typing In far the most cases, a SPA type will always belong to a certain Sequence Type. However, a few deviations from this rule exists! The SPA type t899 has been shown to belong to both ST9 and ST398.

20 T899 ST398 vs ST9 t t t t ST398 ST9

21 Multi Locus Sequence Typing (MLST) Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman

22 CC398 S. aureus isolates can in most cases be allocated into Clonal Complexes based on their Sequence type (at least human isolates ).

23 MLST.S(equence) T(ype).C(lonal) C(omplex)???? MLST is performed to obtain the Sequence Type (ST) The ST can often be associated with certain CC s If not, they are called Singletons S. aureus has major (human) CC s Each CC has a ST as founder and many ST s as members MLST is performed by sequencing 7 household genes These are selected based on their molecular clock MLST t b tit t PFGE th h diff t MLST can not substitute PFGE as they have different molecular clocks.

24 Genes which are sequenced in the MLST arc (Carbamate kinase) aro (Shikimate dehydrogenase) glp (Glycerol kinase) gmk (Guanylate kinase) pta (Phosphate acetyltransferase) tpi (Triosephosphate isomerase) yqi (Acetyle coenzyme A acetyltransferase)

25 arcc The MLST principle Primer 1797 (100.0%) Primer 1798 (100.0%) Primer 1809 (100.0%) Primer 1810 (100.0%) yqil S. aureus MRSA252 BX bp Primer 1805 (100.0%) Primer 1806 (100.0%) pta Primer 1807 (95.7%) tpi Primer 1808 (100.0%) aroe Primer 1799 (100.0%) Primer 1800 (95.7%) Primer 1803 (95.0%) Primer 1804 (100.0%) Primer 1801 (100.0%) Primer 1802 (95.7%) glpf gmk

26 Primers and PCR conditions

27 The MLST principle MLST allele sizes: Gene arcc: aroe: glpf: gmk: pta: tpi: yqil: Size 456 bp 456 bp 465 bp 429 bp 474 bp 402 bp 516 bp

28 How many different alleles? Gene Number of Alleles arcc: 213 aroe: 304 glpf: 274 gmk: 163 pta: 228 tpi: 235 yqil: 235

29 The MLST principle A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T 3833 Fragment MRSA- 9B- 1797_ A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T

30 The MLST principle

31 The MLST principle Fragment with required length! Delete/trim

32 MLST Databases

33 MLST Databases

34 MLST Databases

35 MLST Databases

36 MLST Databases

37 MLST Databases

38 MLST profile: Gene Allelle arcc: 108 aroe: 13 glpf: 1 gmk: 1 pta: 12 tpi: 11 yqil: 13

39 Finding the Sequence Type (ST):

40 Finding the Sequence Type (ST):

41 Finding the Sequence Type (ST):

42 Alternative 1 Assemble the 7 sequences in CLCbio or similar software Export these 7 assemblies to a common FASTA file Submit to the MLST server at Get the ST type from the MLST server

43 MLST the fast version. CLCbio DNA workbench + MLST module

44 Results Drag n Drop sequences

45 Allele 1 NGS Illumina PacBio Assembly pipeline MLST Allele 2 Resistance Allele Nature 3 paper gene profile Allele 4 Allele 5 ST Sanger FASTA List of genes (100% or >95%) Accession numbers Theoretical resistance phenotype Optional BLAST output Home- Resistanc Virulence brew e genes DB Henrik Hasman hhas@food.dtu.dk

46 Thank you for your attention Questions and remarks?