that cannot be assigned to any known spa type

Transcription

1 JCM Accepts, published online ahead of print on 2 December 2009 J. Clin. Microbiol. doi: /jcm Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 Identification of a new methicillin-resistant Staphylococcus aureus strain that cannot be assigned to any known spa type MARIA REISCHAUER 1,2, MARIE BERNKOPF 3, AND CHRISTINE WEBERSINKE 1 * Institut für allgemeine Pathologie und Neuropathologie, Labor für Molekularbiologie, LNK Wagner-Jauregg, Linz, 1 FH Wels, Studiengang Bio- und Umwelttechnik, Stelzhamerstr. 23, 4600 Wels, 2 Labor für Molekularbiologie und Tumorzytogenetik, Krankenhaus der Barmherzigen Schwestern, Linz, 3 Austria spa typing is a method used in molecular typing of methicillin-resistant Staphylococcus aureus (MRSA). Due to the lack of an amplification product in one of 55 MRSA cases a new PCR setup was performed, which allows an indicative description of a previously unknown type Methicillin-resistant Staphylococcus aureus (MRSA) has become one of the most prevalent nosocomial pathogens throughout the world (3). Thus, control and tracing of MRSA spread, which are possible by molecular typing methods, are becoming more and more important. Pulsed-field gel electrophoresis (PFGE) is considered the "gold standard" for molecular typing of MRSA. It exhibits high discriminatory power but is time-consuming and expensive (5). However, spa typing, which is based on DNA sequencing of short sequence repeats (SSRs) of the polymorphic X region of the staphylococcal protein A gene (spa), has advantages in terms of speed, interpretation, and interlaboratory comparison (4). 1

2 In this study, spa typing was carried out in 55 human isolates positive for MRSA whereby spa types were determined using Ridom StaphType software (version 1.5; Würzburg, Germany [ DNA preparation was performed as previously described (4) except that the culture material was suspended in TE buffer (10 mm Tris-HCl [ph 8.0], 1 mm EDTA) instead of H 2 O and that the supernatant (centrifuge for 850 g for 1 min) instead of the suspension was used for PCR. Also amplification was performed using the previously described primers spa- 1113f and spa-1514r (4) but using HotMaster Taq DNA polymerase (5 Prime Inc., Gaithersburg, MD). For one of the 55 MRSA strains (M54) no amplification product was obtained with these primers. Therefore, another PCR was performed using primers which are located in the same gene but make a bigger product. These primers - SA_spa_729.for (5 - TGTAAAACGACGGCCAGTACTAGGTGTAGGTATTGCATCTGT) and SA_spa_1984.rev (5 -CAGGAAACAGCTATGACCTCCAGCTAATAACGCTGCACCTAA) containing an M13 primer sequence - have been previously published (2). Because the 5 sequence of the amplification product was located too far away from the gene region of interest, sequencing for the latter would have been useless. To be able to confirm the correctness of the sequence through alignment of the forward and reverse sequences, a PCR was performed combining the primers spa-1113f and SA_spa_1984.rev. The amplification product was purified with ExoSAP-IT reagent according to the manufacturer s instructions (USB Corporation, Cleveland, OH). Sequencing was performed on an Applied Biosystems 3130 Genetic Analyzer (Foster City, CA) by using the BigDye Terminator Cycle Sequencing Kit according to the manufacturer s instructions (version 1.1, Applied Biosystems, CA). The sequence obtained (GenBank accession number FJ755003) was analysed by Ridom but the software failed due to a problem not previously known to the Ridom company (D. Harmsen, personal communication). 2

3 In analysing the sequence of strain M54 by Ridom, the Spa Type is unknown and Spa-typing reliability is poor (not reliable) whereas excellent is desirable. The reason is that the 3 signature could not be detected. To allow reliable spa typing, a DNA sequence has to contain so called 5 and 3 signature sequences which are located outside the repeat-containing region of the spa gene. To detect whether the 3 signature is deleted or mutated, the nucleotide sequence of strain M54 was aligned with the sequence AM from the EMBL-Bank which contains the 3 signature. The EMBOSS Pairwise Alignment Algorithms were used to compare both nucleotide sequences. Thus, it could be shown that the sequence of strain M54 contains a deletion of 255 bp, which comprises the 3 signature as well as the binding site of the reverse primer spa-1514r. To establish whether there was a precedent for this case, the Ridom company was contacted. According to Ridom there exist a few isolates that probably possess a mutation in the primer binding site and therefore do not enable amplification (D. Harmsen, personal communication). However, the company reported that until now never any isolate without a 3 signature was found. This lead to the suggestion that a new and previously unknown spa type has been detected. The sequence of isolate M54 cannot be assigned to a spa type because the detected repeat succession of the sequence ( ) does not match with that of any known spa type. The PFGE type of strain M54 is ST22 (Barnim) / subtype 2, whereas a similar MRSA strain accessored to spa type t020 belongs to the same PFGE type. Strains with spa type t310 differ only in the subtype of the PFGE result which is ST22 (Barnim) / subtype 4. According to Ghebremedhin et al. (1), Barnim MRSA is linked with spa type t032 and t022. In Table 1, the repeat successions of the spa types mentioned and the Nearest Spa-Types (aligned) detected by Ridom are compared. This comparison shows that the repeat succession of strain M54 differs greatly from that of the spa types t310, t020 and t022, but is similar to that of the spa 3

4 types t032, t683, t1602, t3861, t1292, t981, t3759 and t1021; thus, the repeats of strain M54 correspond to the first eleven repeats of these spa types. Strain M54 may have originated from a strain which contains one of these spa types due to a deletion at the end of the SSR region of the spa gene, mainly from t032, because this like strain M54 belongs to the ST22 (Barnim) types. The other potential spa types need to be further tested in order to establish whether they can be characterized to be of this PFGE type or not. Nucleotide sequence accession number. The part of DNA sequence of MRSA strain M54 was deposited in GenBank under accession number FJ We thank Prof. Serge Weis 1 for proofreading this manuscript *Corresponding author. Mailing address: Institut für allgemeine Pathologie und Neuropathologie, Labor für Molekularbiologie, LNK Wagner-Jauregg, Wagner-Jaureggweg 15, A-4020 Linz, Austria

5 REFERENCES 1. Ghebremedhin, B., W. König, W. Witte, K. J. Hardy, P. M. Hawkey, and B. König Subtyping of ST22-MRSA-IV (Barnim epidemic MRSA strain) at a university clinic in Germany from 2002 to J. Med. Microbiol. 56: Kuhn, G., P. Francioli, and D. S. Blanc Double-locus sequence typing using clfb and spa, a fast and simple method for epidemiological typing of methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 45: Melter, O., I. Santos Sanches, J. Schindler, M. Aires de Sousa, R. Mato, V. Kovárova, H. Zemlicková, and H. de Lencastre Methicillin-resistant Staphylococcus aureus clonal types in the Czech Republic. J. Clin. Microbiol. 37: Ruppitsch, W., A. Indra, A. Stöger, B. Mayer, S. Stadlbauer, G. Wewalka, and F. Allerberger Classifying spa types in complexes improves interpretation of typing results for methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 44: Strandén, A., R. Frei, and A. F. Widmer Molecular typing of methicillin-resistant Staphylococcus aureus: can PCR replace pulsed-field gel electrophoresis? J. Clin. Microbiol. 41:

6 TABLE 1. Comparison of repeat successions of the sequence of strain M54 with different spa types. Overlapping repeats are bold Spatype Repeat succession M t t t t t t t t t t t