Linkage Disequilibrium. Biostatistics 666
|
|
- Isabel Wilkins
- 5 years ago
- Views:
Transcription
1 Linkage Disequilibrium iostatistics 666
2 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower
3 Previously asic roerties of a locus llele Frequencies Genotye Frequencies Hardy-Weinberg Equilibrium Relationshi between allele and genotye frequencies that holds for most genetic markers Exact Tests for Hardy-Weinberg Equilibrium
4 Today We ll consider roerties of airs of alleles Halotye frequencies Linkage equilibrium Linkage disequilibrium
5 Let s consider the history of two neighboring alleles
6 lleles that exist today arose through ancient mutation events efore Mutation C G T G T C G T C G T G T C G C G fter Mutation C G T G T C G T C G T G T C G C G C G T C G T C Mutation G T C G T G T C G C G
7 lleles that exist today arose through ancient mutation events efore Mutation fter Mutation C Mutation
8 One allele arose first, and then the other efore Mutation G C G fter Mutation G C G C C Mutation
9 Recombination generates new arrangements for ancestral alleles C C efore Recombination G G C fter Recombination G C G C C C Recombinant Halotye
10 Linkage Disequilibrium Chromosomes are mosaics Extent and conservation of mosaic ieces deends on Recombination rate Mutation rate Poulation size Natural selection ncestor Present-day Combinations of alleles at very close markers reflect ancestral halotyes
11 Why is linkage disequilibrium imortant for gene maing?
12 ssociation Studies and Linkage Disequilibrium If all olymorhisms were indeendent at the oulation level, association studies would have to examine every one of them Linkage disequilibrium makes tightly linked variants strongly correlated roducing cost savings for association studies
13 Tagging SNPs In a tyical short chromosome segment, there are only a few distinct halotyes Carefully selected SNPs can determine status of other SNPs Halo1 T T T Halo2 T T T Halo3 T T T Halo4 T T T 30% 20% 20% 20% Halo5 T T T 10%
14 asic Descritors of Linkage Disequilibrium
15 Commonly Used Descritors Halotye Frequencies The frequency of each tye of chromosome Contain all the information rovided by other summary measures Commonly used summaries D D r 2 or Δ 2
16 Halotye Frequencies Locus b Totals Locus a a b ab a Totals b 1.0
17 Linkage Equilibrium Exected for Distant Loci ) )(1 (1 ) (1 ) (1 b a ab a a b b = = = = = = =
18 Linkage Disequilibrium Exected for Nearby Loci ) )(1 (1 ) (1 ) (1 b a ab a a b b = = =
19 Disequilibrium Coefficient D b a ab a a b b D D D D D + = = = + = =
20 D is hard to interret Sign is arbitrary common convention is to set, to be the common allele and a, b to be the rare allele Range deends on allele frequencies Hard to comare between markers
21 What is the range of D? What are the maximum and minimum ossible values of D when = 0.3 and = 0.3 = 0.2 and = 0.1 Can you derive a general formula for this range?
22 D scaled version of D D' D min( = D min( b,, a a b ) ) D D < 0 > 0 Ranges between 1 and +1 More likely to take extreme values when allele frequencies are small ±1 imlies at least one of the observed halotyes was not observed
23 More on D Pluses: D = 1 or D = -1 means no evidence for recombination between the markers If allele frequencies are similar, high D means the markers are good surrogates for each other Minuses: D estimates inflated in small samles D estimates inflated when one allele is rare
24 ² (also called r 2 ) ² = = χ ² 2n (1 2 D ) (1 Ranges between 0 and 1 1 when the two markers rovide identical information 0 when they are in erfect equilibrium Exected value is 1/2n )
25 More on r 2 r 2 = 1 imlies the markers rovide exactly the same information The measure referred by oulation geneticists Measures loss in efficiency when marker is relaced with marker in an association study With some simlifying assumtions (e.g. see Pritchard and Przeworski, 2001)
26 When does linkage equilibrium hold?
27 Equilibrium or Disequilibrium? We will resent simle argument for why linkage equilibrium holds for most loci alance of factors Genetic drift (a function of oulation size) Random mating Distance between markers
28 Why Equilibrium is Reached Eventually, random mating and recombination should ensure that mutations sread from original halotye to all halotyes in the oulation Simle argument: ssume fixed allele frequencies over time
29 Generation t, Initial Configuration b a b a a b D D a D D b + + ssume arbitrary values for the allele frequencies and disequilibrium coefficient
30 Generation t+1, Without Recombination b a b a a b D D a D D b + + Halotye Frequencies Remain Stable Over Time Outcome has robability 1- R
31 Generation t+1, With Recombination b b a b a b a b Halotye Frequencies re Function of llele Frequencies Outcome has robability R
32 Generation t+1, Overall b a b a b b D r D r a D r D r b ) (1 ) (1 ) (1 ) (1 + + Disequilibrium Decreases
33 Recombination Rate (R) Probability of an odd number of crossovers between two loci Proortion of time alleles from two different grand-arents occur in the same gamete Increases with hysical (base-air) distance, but rate of increase varies across genome
34 Decay of D with Time Ө = R = Disequilibrium Ө = 0.1 R = 0.1 R = 0.01 Ө = 0.01 Ө = R = R = 0.5 Ө = Generations
35 Predictions Disequilibrium will decay each generation In a large oulation fter t generations D t = (1-R) t D 0 better model should allow for changes in allele frequencies over time
36 Linkage Equilibrium In a large random mating oulation halotye frequencies converge to a simle function of allele frequencies
37 Some Examles of Linkage Disequilibrium Data
38 Summary of Disequilibrium in the Genome How much disequilibrium is there? What are good redictors of disequilibrium?
39 Raw D data from Chr D' Physical Distance (kb) Dawson et al, Nature, 2002
40 Raw ² data from Chr r Physical Distance (kb) Dawson et al, Nature, 2002
41 Summarizing Disequilibrium
42 Comaring Emirical of LD Poulations (chromosome 2, R²) Statistic Han, Jaanese Yoruba CEPH Distance (kb) LD extends further in CEPH and the Han/Jaanese than in the Yoruba International HaMa Consortium, Nature, 2005
43 Variation in Linkage Disequilibrium long The Genome
44 Comaring Genomic Regions Rather than comare curves directly, it is convenient to a ick a summary for the decay curves One common summary is the distance at which the curve crosses a threshold of interest (say 0.50)
45 Extent of Linkage Disequilibrium 12 Half-Life of R² Chromosome LD extends further in the larger chromosomes, which have lower recombination rates
46 ut within each chromosome, there is still huge variability!
47 Proortion of Genome Extent of LD Extent of LD cross the Genome (in 1Mb Windows) verage Extent: Median Extent: 10 th ercentile: 90 th ercentile: Extent of LD (r²) 11.9 kb 7.8 kb 3.5 kb 20.9 kb
48 Genomic Variation in LD (CEPH) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005
49 Genomic Variation in LD (JPT + CH) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005
50 Genomic Variation in LD (YRI) Exected r 2 at 10kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005
51 Genomic Distribution of LD (YRI) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005
52 Sequence Comosition vs. LD (some selected comarisons) Genome Quartiles, Defined Using LD (Low LD) (High LD) Genome Q1 Q2 Q3 Q4 Trend asic Sequence Features GC ases (%) Decreases With LD ases in CG Islands (%) Decreases With LD Polymorhism ( Π 10,000 ) Decreases With LD Genes and Related Features Known Genes (er 1000 kb) U shaed Genic ases (Exon, Intron, UTR, %) U shaed Coding ases (%) U shaed Conserved Non-Coding Sequence (%) Decreases with LD Reeat Content Total ases in Reeats (%) Increases with LD ases in LINE reeats (%) Increases with LD ases in SINE reeats (%) U shaed Smith et al, Genome Research, 2005
53 Gene Function in Regions of High and Low Disequilibrium nnotated Gene Function (GO Term) Genes Low LD High LD χ² P-value ll Swissrot Entries Examined DN metabolism <.0001 Immune Resonse <.0001 Cell cycle <.0001 Protein Metabolism <.0001 Organelle Organization and iogenesis <.0001 Intracellular Transort <.0001 Organogenesis Cell Organization and Metabolism RN Metabollism Results from a comarison of the distribution of 40 most common gene classifications in the GENE Ontology Database
54 Imlications for ssociation Studies
55 Linkage Disequilibrium in ssociation Studies: Psoriasis and IL23 Examle Multile nearby SNPs show evidence for association with soriasis. The SNPs are all in linkage disequilibrium, so it is hard to inoint causal SNP. Nair et al, Nature Genetics, 2009
56 Linkage Disequilibrium in ssociation Studies: Tag SNP Picking Many nearby SNPs will tyically rovide similar evidence for association To decrease genotying costs, most association studies will examine selected tag SNPs in each region The most common tagging strategy focuses on airwise r 2 between SNPs
57 Linkage Disequilibrium in ssociation Studies: Pairwise Tagging lgorithm Select an r 2 threshold, tyically 0.5 or 0.8 SNPs with r 2 above threshold can serve as roxies for each other For each marker being considered, count the number of SNPs with r 2 above threshold Genotye SNP with the largest number of airwise roxies Remove SNP and all the SNPs it tags from consideration Reeat the revious three stes until there are no more SNPs to ick or genotying budget is exhausted Carlson et al, JHG, 2004
58 Potential Number of tag SNPs Current tag SNP anels tyically examine 500,000 1,000,000 SNPs for a cost of $200 - $500 er samle. It is anticiated that future anels will allow for as many as 5 million SNPs. The International HaMa Consortium, Nature, 2007
59 Today asic descritors of linkage disequilibrium Learn when linkage disequilibrium is exected to hold (or not!)
60 dditional Reading I Dawson E et al (2002). first-generation linkage disequilibrium ma of human chromosome 22. Nature 418: The International HaMa Consortium. (2005). halotye ma of the human genome. Nature 437: Carlson CS et al (2004). Selecting a maximally informative set of single-nucleotide olymorhisms for association analyses using linkage disequilibrium. m J Hum Genet 74:
61 dditional Reading II Cardon and ell (2001) ssociation study designs for comlex diseases. Nature Reviews Genetics 2:91-99 Surveys imortant issues in analyzing oulation data. Illustrates shift from focus on linkage to association maing for comlex traits.
Genes in Populations: Hardy Weinberg Equilibrium. Biostatistics 666
Genes in Poulations: Hardy Weinberg Equilibrium Biostatistics 666 Previous Lecture: Primer In Genetics How information is stored in DNA How DNA is inherited Tyes of DNA variation Common designs for genetic
More informationGenotypes, Phenotypes and Hardy Weinberg Equilibrium. Biostatistics 666 Lecture II
Genotyes, Phenotyes and Hardy Weinberg Equilibrium Biostatistics 666 Lecture II Previously: Refresher on Genetics DNA sequence Human Genome Inheritance of genetic information Sequence variation VNTRs,
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationLinkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationHaplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationGenetic Association Analysis Using Data from Triads and Unrelated Subjects
Am. J. Hum. Genet. 76:592 68, 25 Genetic Association Analysis Using Data from Triads and Unrelated Subjects Michael P. Estein, 1 Colin D. Veal, 3 Richard C. Trembath, 3 Jonathan N. W. N. Barker, 4 Chun
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationThe Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm
The Whole Genome TagSNP Selection and Transferability Among HapMap Populations Reedik Magi, Lauris Kaplinski, and Maido Remm Pacific Symposium on Biocomputing 11:535-543(2006) THE WHOLE GENOME TAGSNP SELECTION
More informationCourse Announcements
Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More information5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations
Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.
More informationOffice Hours. We will try to find a time
Office Hours We will try to find a time If you haven t done so yet, please mark times when you are available at: https://tinyurl.com/666-office-hours Thanks! Hardy Weinberg Equilibrium Biostatistics 666
More informationB) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationThe Firm and the Market
Almost essential Firm: Demand and Suly The Firm and the Market MICROECONOMICS Princiles and Analysis Frank Cowell October 2005 Introduction In revious resentations we ve seen how an otimising agent reacts
More informationTHE FIRM AND THE MARKET
Prerequisites Almost essential Firm: Demand and Suly THE FIRM AND THE MARKET MICROECONOMICS Princiles and Analysis Frank Cowell Note: the detail in slides marked * can only be seen if you run the slideshow
More informationLD Mapping and the Coalescent
Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationThe Firm and the Market
Prerequisites Almost essential Firm: Demand and Suly The Firm and the Market MICROECONOMICS Princiles and Analysis Frank Cowell October 2005 Introduction In revious resentations we ve seen how an otimising
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationThe Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationDivision Ave. High School AP Biology
Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas u used exerimental method
More informationNature Genetics: doi: /ng Supplementary Figure 1. Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions.
Supplementary Figure 1 Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions. Relationships of cultivated and wild rice correspond to previously observed relationships 40. Wild rice
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationGregor Mendel. Genetics & The Work of Mendel. Mendel s work. Terminology. " Heritable features that vary among individuals are called characters.
Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas which he began breeding a 1857. Genetics & The Work of Mendel He
More informationThree-dimensional design against fatigue failure and the implementation of a genetic algorithm
K. Krishnaillai and R. Jones Three-dimensional design against fatigue failure and the imlementation of a genetic algorithm K. KRISHNAPILLAI and R. JONES CIEAM, Deartment of Mechanical Engineering Monash
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationBasic Concepts of Human Genetics
Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationARTICLE Maximizing the Power of Principal-Component Analysis of Correlated Phenotypes in Genome-wide Association Studies
ARTICLE Maximizing the Power of Princial-Comonent Analysis of Correlated Phenotyes in Genome-wide Association Studies Hugues Aschard, 1, * Bjarni J. Vilhjálmsson, 1, Nicolas Greliche, 3,4,5 Pierre-Emmanuel
More informationThe Evolution of Populations
The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationStatistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
More informationAP Biology. Gregor Mendel. Chapter 14. Mendel & Genetics. Mendel s work. What did Mendel s findings mean? Looking closer at Mendel s work
A Biology Chater 14. Mendel & Genetics Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas used eerimental method used
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationOverview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat
Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationTEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?
TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day
More informationMendel s work. AP Biology. Genetics & The Work of Mendel. What did Mendel s findings mean? Looking closer at Mendel s work
Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid- 1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas used eerimental method used quantitative
More informationb. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationGenotyping Technology How to Analyze Your Own Genome Fall 2013
Genotyping Technology 02-223 How to nalyze Your Own Genome Fall 2013 HapMap Project Phase 1 Phase 2 Phase 3 Samples & POP panels Genotyping centers Unique QC+ SNPs 269 samples (4 populations) HapMap International
More informationPopulation Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
More informationOn the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study
On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationGenetic data concepts and tests
Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure
More informationTake Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization
Take Home Message Molecular Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University This may be the most important thing I say in this lecture.
More informationThe HapMap Project and Haploview
The HapMap Project and Haploview David Evans Ben Neale University of Oxford Wellcome Trust Centre for Human Genetics Human Haplotype Map General Idea: Characterize the distribution of Linkage Disequilibrium
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationMultistage Cross-Sell Model of Employers in the Financial Industry
Paer 4-8 Multistage Cross-Sell Model of Emloyers in the Financial Industry Kwan Park and Steve Donohue The Princial Financial Grou ABSTRACT This aer details the stes to develo a multistage cross-sell model
More informationHISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY
Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université
More informationTwo-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:
The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,
More informationFamilial Breast Cancer
Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management
More informationPopulation and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift
Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Heather J. Cordell Professor of Statistical Genetics Institute of Genetic Medicine Newcastle University,
More informationIntroduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15
Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationPopulation Genetics Sequence Diversity Molecular Evolution. Physiology Quantitative Traits Human Diseases
Population Genetics Sequence Diversity Molecular Evolution Physiology Quantitative Traits Human Diseases Bioinformatics problems in medicine related to physiology and quantitative traits Note: Genetics
More informationGenetic Drift and Natural Selection:
llele Overview Genetic Drift and Natural Selection: n Exploration of llele Frequencies Within a Population Harvey Mudd College Math 164: Scientific Computing 29 pril 2008 llele Overview Presentation Outline
More informationPERSPECTIVES. A gene-centric approach to genome-wide association studies
PERSPECTIVES O P I N I O N A gene-centric approach to genome-wide association studies Eric Jorgenson and John S. Witte Abstract Genic variants are more likely to alter gene function and affect disease
More informationApplied Bioinformatics
Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA
More informationPP x pp. Looking closer at Mendel s work. Gregor Mendel a monk named Gregor Mendel documented inheritance in peas in the mid-1800s
Gregor Mendel a monk named Gregor Mendel documented inheritance in eas in the mid-1800s used eerimental method used quantitative analysis collected data & counted them ecellent eamle of scientific method
More informationCross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing
Cross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing André R. de Vries a, Ilja M. Nolte b, Geert T. Spijker c, Dumitru Brinza d, Alexander Zelikovsky d,
More informationSupplementary Material online Population genomics in Bacteria: A case study of Staphylococcus aureus
Supplementary Material online Population genomics in acteria: case study of Staphylococcus aureus Shohei Takuno, Tomoyuki Kado, Ryuichi P. Sugino, Luay Nakhleh & Hideki Innan Contents Estimating recombination
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationCOMPUTER SIMULATIONS AND PROBLEMS
Exercise 1: Exploring Evolutionary Mechanisms with Theoretical Computer Simulations, and Calculation of Allele and Genotype Frequencies & Hardy-Weinberg Equilibrium Theory INTRODUCTION Evolution is defined
More informationEvolutionary Mechanisms
Evolutionary Mechanisms Tidbits One misconception is that organisms evolve, in the Darwinian sense, during their lifetimes Natural selection acts on individuals, but only populations evolve Genetic variations
More informationABSTRACT STRATEGIES IN OLIGOPOLIES. This dissertation is part of the effort to contribute to our understanding of Price
STRCT Title of Dissertation: ESSYS ON PRICE COMPETITION ND IRM STRTEGIES IN OLIGOPOLIES Heisnam Thoihen Singh, Doctor of Philosohy 007 Dissertation directed by: Professor Daniel Vincent Deartment of Economics
More informationSummary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
More informationLecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013
Lecture 19: Hitchhiking and selective sweeps Bruce Walsh lecture notes Synbreed course version 8 July 2013 1 Hitchhiking When an allele is linked to a site under selection, its dynamics are considerably
More informationEfficient Association Study Design Via Power-Optimized Tag SNP Selection
doi: 10.1111/j.1469-1809.2008.00469.x Efficient Association Study Design Via Power-Optimized Tag SNP Selection B. Han 1,H.M.Kang 1,M.S.Seo 2, N. Zaitlen 3 and E. Eskin 4, 1 Department of Computer Science
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2017 Human Genetics Series Tuesday 4/10/17 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationUsing the Association Workflow in Partek Genomics Suite
Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within
More informationLinkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
More informationDeep learning sequence-based ab initio prediction of variant effects on expression and disease risk
Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationPermanent City Research Online URL:
Thomas, P.J. & Chrystal, A. (3). Retail rice otimisation from sarse demand data. American Journal of Industrial and Business Management, 3(3),. 95-36. doi:.436/ajibm.3.3335 City Research Online Original
More information7-1. Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium)
7-1 Biology 1001 Lab 7: POPULATION GENETICS PREPARTION Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium) OBECTIVES At the end of
More informationPetar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.
The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo
More informationResources at HapMap.Org
Resources at HapMap.Org HapMap Phase II Dataset Release #21a, January 2007 (NCBI build 35) 3.8 M genotyped SNPs => 1 SNP/700 bp # polymorphic SNPs/kb in consensus dataset International HapMap Consortium
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationStructure, Measurement & Analysis of Genetic Variation
Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationPopGen1: Introduction to population genetics
PopGen1: Introduction to population genetics Introduction MICROEVOLUTION is the term used to describe the dynamics of evolutionary change in populations and species over time. The discipline devoted to
More informationAn Introduction to Population Genetics
An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationPlanning and Design of Flex-Route Transit Services
Transortation Research Record 1791 59 Paer No. 2-2324 Planning and Design of Flex-Route Transit Services Liing Fu A theoretical investigation is resented of various issues involved in the lanning and design
More informationWhole Genome Regression and Prediction Methods Applied to Plant and Animal Breeding. & Mario P. L. Calus ᶲ
Genetics: Published Articles Ahead of Print, ublished on June 8, 01 as 10.1534/genetics.11.143313 Whole Genome Regression and Prediction Methods Alied to Plant and Animal Breeding Gustavo de los Camos*
More informationVariation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?
Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies
More information