Linkage Disequilibrium. Biostatistics 666

Size: px
Start display at page:

Download "Linkage Disequilibrium. Biostatistics 666"

Transcription

1 Linkage Disequilibrium iostatistics 666

2 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower

3 Previously asic roerties of a locus llele Frequencies Genotye Frequencies Hardy-Weinberg Equilibrium Relationshi between allele and genotye frequencies that holds for most genetic markers Exact Tests for Hardy-Weinberg Equilibrium

4 Today We ll consider roerties of airs of alleles Halotye frequencies Linkage equilibrium Linkage disequilibrium

5 Let s consider the history of two neighboring alleles

6 lleles that exist today arose through ancient mutation events efore Mutation C G T G T C G T C G T G T C G C G fter Mutation C G T G T C G T C G T G T C G C G C G T C G T C Mutation G T C G T G T C G C G

7 lleles that exist today arose through ancient mutation events efore Mutation fter Mutation C Mutation

8 One allele arose first, and then the other efore Mutation G C G fter Mutation G C G C C Mutation

9 Recombination generates new arrangements for ancestral alleles C C efore Recombination G G C fter Recombination G C G C C C Recombinant Halotye

10 Linkage Disequilibrium Chromosomes are mosaics Extent and conservation of mosaic ieces deends on Recombination rate Mutation rate Poulation size Natural selection ncestor Present-day Combinations of alleles at very close markers reflect ancestral halotyes

11 Why is linkage disequilibrium imortant for gene maing?

12 ssociation Studies and Linkage Disequilibrium If all olymorhisms were indeendent at the oulation level, association studies would have to examine every one of them Linkage disequilibrium makes tightly linked variants strongly correlated roducing cost savings for association studies

13 Tagging SNPs In a tyical short chromosome segment, there are only a few distinct halotyes Carefully selected SNPs can determine status of other SNPs Halo1 T T T Halo2 T T T Halo3 T T T Halo4 T T T 30% 20% 20% 20% Halo5 T T T 10%

14 asic Descritors of Linkage Disequilibrium

15 Commonly Used Descritors Halotye Frequencies The frequency of each tye of chromosome Contain all the information rovided by other summary measures Commonly used summaries D D r 2 or Δ 2

16 Halotye Frequencies Locus b Totals Locus a a b ab a Totals b 1.0

17 Linkage Equilibrium Exected for Distant Loci ) )(1 (1 ) (1 ) (1 b a ab a a b b = = = = = = =

18 Linkage Disequilibrium Exected for Nearby Loci ) )(1 (1 ) (1 ) (1 b a ab a a b b = = =

19 Disequilibrium Coefficient D b a ab a a b b D D D D D + = = = + = =

20 D is hard to interret Sign is arbitrary common convention is to set, to be the common allele and a, b to be the rare allele Range deends on allele frequencies Hard to comare between markers

21 What is the range of D? What are the maximum and minimum ossible values of D when = 0.3 and = 0.3 = 0.2 and = 0.1 Can you derive a general formula for this range?

22 D scaled version of D D' D min( = D min( b,, a a b ) ) D D < 0 > 0 Ranges between 1 and +1 More likely to take extreme values when allele frequencies are small ±1 imlies at least one of the observed halotyes was not observed

23 More on D Pluses: D = 1 or D = -1 means no evidence for recombination between the markers If allele frequencies are similar, high D means the markers are good surrogates for each other Minuses: D estimates inflated in small samles D estimates inflated when one allele is rare

24 ² (also called r 2 ) ² = = χ ² 2n (1 2 D ) (1 Ranges between 0 and 1 1 when the two markers rovide identical information 0 when they are in erfect equilibrium Exected value is 1/2n )

25 More on r 2 r 2 = 1 imlies the markers rovide exactly the same information The measure referred by oulation geneticists Measures loss in efficiency when marker is relaced with marker in an association study With some simlifying assumtions (e.g. see Pritchard and Przeworski, 2001)

26 When does linkage equilibrium hold?

27 Equilibrium or Disequilibrium? We will resent simle argument for why linkage equilibrium holds for most loci alance of factors Genetic drift (a function of oulation size) Random mating Distance between markers

28 Why Equilibrium is Reached Eventually, random mating and recombination should ensure that mutations sread from original halotye to all halotyes in the oulation Simle argument: ssume fixed allele frequencies over time

29 Generation t, Initial Configuration b a b a a b D D a D D b + + ssume arbitrary values for the allele frequencies and disequilibrium coefficient

30 Generation t+1, Without Recombination b a b a a b D D a D D b + + Halotye Frequencies Remain Stable Over Time Outcome has robability 1- R

31 Generation t+1, With Recombination b b a b a b a b Halotye Frequencies re Function of llele Frequencies Outcome has robability R

32 Generation t+1, Overall b a b a b b D r D r a D r D r b ) (1 ) (1 ) (1 ) (1 + + Disequilibrium Decreases

33 Recombination Rate (R) Probability of an odd number of crossovers between two loci Proortion of time alleles from two different grand-arents occur in the same gamete Increases with hysical (base-air) distance, but rate of increase varies across genome

34 Decay of D with Time Ө = R = Disequilibrium Ө = 0.1 R = 0.1 R = 0.01 Ө = 0.01 Ө = R = R = 0.5 Ө = Generations

35 Predictions Disequilibrium will decay each generation In a large oulation fter t generations D t = (1-R) t D 0 better model should allow for changes in allele frequencies over time

36 Linkage Equilibrium In a large random mating oulation halotye frequencies converge to a simle function of allele frequencies

37 Some Examles of Linkage Disequilibrium Data

38 Summary of Disequilibrium in the Genome How much disequilibrium is there? What are good redictors of disequilibrium?

39 Raw D data from Chr D' Physical Distance (kb) Dawson et al, Nature, 2002

40 Raw ² data from Chr r Physical Distance (kb) Dawson et al, Nature, 2002

41 Summarizing Disequilibrium

42 Comaring Emirical of LD Poulations (chromosome 2, R²) Statistic Han, Jaanese Yoruba CEPH Distance (kb) LD extends further in CEPH and the Han/Jaanese than in the Yoruba International HaMa Consortium, Nature, 2005

43 Variation in Linkage Disequilibrium long The Genome

44 Comaring Genomic Regions Rather than comare curves directly, it is convenient to a ick a summary for the decay curves One common summary is the distance at which the curve crosses a threshold of interest (say 0.50)

45 Extent of Linkage Disequilibrium 12 Half-Life of R² Chromosome LD extends further in the larger chromosomes, which have lower recombination rates

46 ut within each chromosome, there is still huge variability!

47 Proortion of Genome Extent of LD Extent of LD cross the Genome (in 1Mb Windows) verage Extent: Median Extent: 10 th ercentile: 90 th ercentile: Extent of LD (r²) 11.9 kb 7.8 kb 3.5 kb 20.9 kb

48 Genomic Variation in LD (CEPH) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005

49 Genomic Variation in LD (JPT + CH) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005

50 Genomic Variation in LD (YRI) Exected r 2 at 10kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005

51 Genomic Distribution of LD (YRI) Exected r 2 at 30kb right Red > 0.88 Dark lue < 0.12 Smith et al, Genome Research, 2005

52 Sequence Comosition vs. LD (some selected comarisons) Genome Quartiles, Defined Using LD (Low LD) (High LD) Genome Q1 Q2 Q3 Q4 Trend asic Sequence Features GC ases (%) Decreases With LD ases in CG Islands (%) Decreases With LD Polymorhism ( Π 10,000 ) Decreases With LD Genes and Related Features Known Genes (er 1000 kb) U shaed Genic ases (Exon, Intron, UTR, %) U shaed Coding ases (%) U shaed Conserved Non-Coding Sequence (%) Decreases with LD Reeat Content Total ases in Reeats (%) Increases with LD ases in LINE reeats (%) Increases with LD ases in SINE reeats (%) U shaed Smith et al, Genome Research, 2005

53 Gene Function in Regions of High and Low Disequilibrium nnotated Gene Function (GO Term) Genes Low LD High LD χ² P-value ll Swissrot Entries Examined DN metabolism <.0001 Immune Resonse <.0001 Cell cycle <.0001 Protein Metabolism <.0001 Organelle Organization and iogenesis <.0001 Intracellular Transort <.0001 Organogenesis Cell Organization and Metabolism RN Metabollism Results from a comarison of the distribution of 40 most common gene classifications in the GENE Ontology Database

54 Imlications for ssociation Studies

55 Linkage Disequilibrium in ssociation Studies: Psoriasis and IL23 Examle Multile nearby SNPs show evidence for association with soriasis. The SNPs are all in linkage disequilibrium, so it is hard to inoint causal SNP. Nair et al, Nature Genetics, 2009

56 Linkage Disequilibrium in ssociation Studies: Tag SNP Picking Many nearby SNPs will tyically rovide similar evidence for association To decrease genotying costs, most association studies will examine selected tag SNPs in each region The most common tagging strategy focuses on airwise r 2 between SNPs

57 Linkage Disequilibrium in ssociation Studies: Pairwise Tagging lgorithm Select an r 2 threshold, tyically 0.5 or 0.8 SNPs with r 2 above threshold can serve as roxies for each other For each marker being considered, count the number of SNPs with r 2 above threshold Genotye SNP with the largest number of airwise roxies Remove SNP and all the SNPs it tags from consideration Reeat the revious three stes until there are no more SNPs to ick or genotying budget is exhausted Carlson et al, JHG, 2004

58 Potential Number of tag SNPs Current tag SNP anels tyically examine 500,000 1,000,000 SNPs for a cost of $200 - $500 er samle. It is anticiated that future anels will allow for as many as 5 million SNPs. The International HaMa Consortium, Nature, 2007

59 Today asic descritors of linkage disequilibrium Learn when linkage disequilibrium is exected to hold (or not!)

60 dditional Reading I Dawson E et al (2002). first-generation linkage disequilibrium ma of human chromosome 22. Nature 418: The International HaMa Consortium. (2005). halotye ma of the human genome. Nature 437: Carlson CS et al (2004). Selecting a maximally informative set of single-nucleotide olymorhisms for association analyses using linkage disequilibrium. m J Hum Genet 74:

61 dditional Reading II Cardon and ell (2001) ssociation study designs for comlex diseases. Nature Reviews Genetics 2:91-99 Surveys imortant issues in analyzing oulation data. Illustrates shift from focus on linkage to association maing for comlex traits.

Genes in Populations: Hardy Weinberg Equilibrium. Biostatistics 666

Genes in Populations: Hardy Weinberg Equilibrium. Biostatistics 666 Genes in Poulations: Hardy Weinberg Equilibrium Biostatistics 666 Previous Lecture: Primer In Genetics How information is stored in DNA How DNA is inherited Tyes of DNA variation Common designs for genetic

More information

Genotypes, Phenotypes and Hardy Weinberg Equilibrium. Biostatistics 666 Lecture II

Genotypes, Phenotypes and Hardy Weinberg Equilibrium. Biostatistics 666 Lecture II Genotyes, Phenotyes and Hardy Weinberg Equilibrium Biostatistics 666 Lecture II Previously: Refresher on Genetics DNA sequence Human Genome Inheritance of genetic information Sequence variation VNTRs,

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Linkage Disequilibrium. Adele Crane & Angela Taravella

Linkage Disequilibrium. Adele Crane & Angela Taravella Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay

More information

Analysis of genome-wide genotype data

Analysis of genome-wide genotype data Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version

More information

Haplotypes, linkage disequilibrium, and the HapMap

Haplotypes, linkage disequilibrium, and the HapMap Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,

More information

Algorithms for Genetics: Introduction, and sources of variation

Algorithms for Genetics: Introduction, and sources of variation Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual

More information

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1 Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the

More information

Genetic Association Analysis Using Data from Triads and Unrelated Subjects

Genetic Association Analysis Using Data from Triads and Unrelated Subjects Am. J. Hum. Genet. 76:592 68, 25 Genetic Association Analysis Using Data from Triads and Unrelated Subjects Michael P. Estein, 1 Colin D. Veal, 3 Richard C. Trembath, 3 Jonathan N. W. N. Barker, 4 Chun

More information

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get

More information

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012 Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation

More information

The Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm

The Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm The Whole Genome TagSNP Selection and Transferability Among HapMap Populations Reedik Magi, Lauris Kaplinski, and Maido Remm Pacific Symposium on Biocomputing 11:535-543(2006) THE WHOLE GENOME TAGSNP SELECTION

More information

Course Announcements

Course Announcements Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)

More information

S G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics

S G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public

More information

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.

More information

Office Hours. We will try to find a time

Office Hours.   We will try to find a time Office Hours We will try to find a time If you haven t done so yet, please mark times when you are available at: https://tinyurl.com/666-office-hours Thanks! Hardy Weinberg Equilibrium Biostatistics 666

More information

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases). Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are

More information

Understanding genetic association studies. Peter Kamerman

Understanding genetic association studies. Peter Kamerman Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -

More information

Association studies (Linkage disequilibrium)

Association studies (Linkage disequilibrium) Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a

More information

The Firm and the Market

The Firm and the Market Almost essential Firm: Demand and Suly The Firm and the Market MICROECONOMICS Princiles and Analysis Frank Cowell October 2005 Introduction In revious resentations we ve seen how an otimising agent reacts

More information

THE FIRM AND THE MARKET

THE FIRM AND THE MARKET Prerequisites Almost essential Firm: Demand and Suly THE FIRM AND THE MARKET MICROECONOMICS Princiles and Analysis Frank Cowell Note: the detail in slides marked * can only be seen if you run the slideshow

More information

LD Mapping and the Coalescent

LD Mapping and the Coalescent Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave

More information

Supplementary Note: Detecting population structure in rare variant data

Supplementary Note: Detecting population structure in rare variant data Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to

More information

The Firm and the Market

The Firm and the Market Prerequisites Almost essential Firm: Demand and Suly The Firm and the Market MICROECONOMICS Princiles and Analysis Frank Cowell October 2005 Introduction In revious resentations we ve seen how an otimising

More information

Human linkage analysis. fundamental concepts

Human linkage analysis. fundamental concepts Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal

More information

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique

More information

Genome-Wide Association Studies (GWAS): Computational Them

Genome-Wide Association Studies (GWAS): Computational Them Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus

More information

Human linkage analysis. fundamental concepts

Human linkage analysis. fundamental concepts Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas u used exerimental method

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions.

Nature Genetics: doi: /ng Supplementary Figure 1. Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions. Supplementary Figure 1 Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions. Relationships of cultivated and wild rice correspond to previously observed relationships 40. Wild rice

More information

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011 EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS

More information

Population stratification. Background & PLINK practical

Population stratification. Background & PLINK practical Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major

More information

Gregor Mendel. Genetics & The Work of Mendel. Mendel s work. Terminology. " Heritable features that vary among individuals are called characters.

Gregor Mendel. Genetics & The Work of Mendel. Mendel s work. Terminology.  Heritable features that vary among individuals are called characters. Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas which he began breeding a 1857. Genetics & The Work of Mendel He

More information

Three-dimensional design against fatigue failure and the implementation of a genetic algorithm

Three-dimensional design against fatigue failure and the implementation of a genetic algorithm K. Krishnaillai and R. Jones Three-dimensional design against fatigue failure and the imlementation of a genetic algorithm K. KRISHNAPILLAI and R. JONES CIEAM, Deartment of Mechanical Engineering Monash

More information

Why do we need statistics to study genetics and evolution?

Why do we need statistics to study genetics and evolution? Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes

More information

Computational Workflows for Genome-Wide Association Study: I

Computational Workflows for Genome-Wide Association Study: I Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

More information

ARTICLE Maximizing the Power of Principal-Component Analysis of Correlated Phenotypes in Genome-wide Association Studies

ARTICLE Maximizing the Power of Principal-Component Analysis of Correlated Phenotypes in Genome-wide Association Studies ARTICLE Maximizing the Power of Princial-Comonent Analysis of Correlated Phenotyes in Genome-wide Association Studies Hugues Aschard, 1, * Bjarni J. Vilhjálmsson, 1, Nicolas Greliche, 3,4,5 Pierre-Emmanuel

More information

The Evolution of Populations

The Evolution of Populations The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

Statistical Methods for Quantitative Trait Loci (QTL) Mapping

Statistical Methods for Quantitative Trait Loci (QTL) Mapping Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson

More information

AP Biology. Gregor Mendel. Chapter 14. Mendel & Genetics. Mendel s work. What did Mendel s findings mean? Looking closer at Mendel s work

AP Biology. Gregor Mendel. Chapter 14. Mendel & Genetics. Mendel s work. What did Mendel s findings mean? Looking closer at Mendel s work A Biology Chater 14. Mendel & Genetics Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas used eerimental method used

More information

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain

More information

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,

More information

Genome-wide association studies (GWAS) Part 1

Genome-wide association studies (GWAS) Part 1 Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations

More information

TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?

TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human? TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day

More information

Mendel s work. AP Biology. Genetics & The Work of Mendel. What did Mendel s findings mean? Looking closer at Mendel s work

Mendel s work. AP Biology. Genetics & The Work of Mendel. What did Mendel s findings mean? Looking closer at Mendel s work Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid- 1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in eas used eerimental method used quantitative

More information

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus. NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops

More information

An introduction to genetics and molecular biology

An introduction to genetics and molecular biology An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular

More information

Genotyping Technology How to Analyze Your Own Genome Fall 2013

Genotyping Technology How to Analyze Your Own Genome Fall 2013 Genotyping Technology 02-223 How to nalyze Your Own Genome Fall 2013 HapMap Project Phase 1 Phase 2 Phase 3 Samples & POP panels Genotyping centers Unique QC+ SNPs 269 samples (4 populations) HapMap International

More information

Population Genetics II. Bio

Population Genetics II. Bio Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT

More information

On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study

On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)

More information

Human Genetics and Gene Mapping of Complex Traits

Human Genetics and Gene Mapping of Complex Traits Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:

More information

Genetic data concepts and tests

Genetic data concepts and tests Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure

More information

Take Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization

Take Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization Take Home Message Molecular Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University This may be the most important thing I say in this lecture.

More information

The HapMap Project and Haploview

The HapMap Project and Haploview The HapMap Project and Haploview David Evans Ben Neale University of Oxford Wellcome Trust Centre for Human Genetics Human Haplotype Map General Idea: Characterize the distribution of Linkage Disequilibrium

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Multistage Cross-Sell Model of Employers in the Financial Industry

Multistage Cross-Sell Model of Employers in the Financial Industry Paer 4-8 Multistage Cross-Sell Model of Emloyers in the Financial Industry Kwan Park and Steve Donohue The Princial Financial Grou ABSTRACT This aer details the stes to develo a multistage cross-sell model

More information

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université

More information

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles: The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,

More information

Familial Breast Cancer

Familial Breast Cancer Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management

More information

Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift

Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Heather J. Cordell Professor of Statistical Genetics Institute of Genetic Medicine Newcastle University,

More information

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15 Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

Population Genetics Sequence Diversity Molecular Evolution. Physiology Quantitative Traits Human Diseases

Population Genetics Sequence Diversity Molecular Evolution. Physiology Quantitative Traits Human Diseases Population Genetics Sequence Diversity Molecular Evolution Physiology Quantitative Traits Human Diseases Bioinformatics problems in medicine related to physiology and quantitative traits Note: Genetics

More information

Genetic Drift and Natural Selection:

Genetic Drift and Natural Selection: llele Overview Genetic Drift and Natural Selection: n Exploration of llele Frequencies Within a Population Harvey Mudd College Math 164: Scientific Computing 29 pril 2008 llele Overview Presentation Outline

More information

PERSPECTIVES. A gene-centric approach to genome-wide association studies

PERSPECTIVES. A gene-centric approach to genome-wide association studies PERSPECTIVES O P I N I O N A gene-centric approach to genome-wide association studies Eric Jorgenson and John S. Witte Abstract Genic variants are more likely to alter gene function and affect disease

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA

More information

PP x pp. Looking closer at Mendel s work. Gregor Mendel a monk named Gregor Mendel documented inheritance in peas in the mid-1800s

PP x pp. Looking closer at Mendel s work. Gregor Mendel a monk named Gregor Mendel documented inheritance in peas in the mid-1800s Gregor Mendel a monk named Gregor Mendel documented inheritance in eas in the mid-1800s used eerimental method used quantitative analysis collected data & counted them ecellent eamle of scientific method

More information

Cross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing

Cross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing Cross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing André R. de Vries a, Ilja M. Nolte b, Geert T. Spijker c, Dumitru Brinza d, Alexander Zelikovsky d,

More information

Supplementary Material online Population genomics in Bacteria: A case study of Staphylococcus aureus

Supplementary Material online Population genomics in Bacteria: A case study of Staphylococcus aureus Supplementary Material online Population genomics in acteria: case study of Staphylococcus aureus Shohei Takuno, Tomoyuki Kado, Ryuichi P. Sugino, Luay Nakhleh & Hideki Innan Contents Estimating recombination

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

COMPUTER SIMULATIONS AND PROBLEMS

COMPUTER SIMULATIONS AND PROBLEMS Exercise 1: Exploring Evolutionary Mechanisms with Theoretical Computer Simulations, and Calculation of Allele and Genotype Frequencies & Hardy-Weinberg Equilibrium Theory INTRODUCTION Evolution is defined

More information

Evolutionary Mechanisms

Evolutionary Mechanisms Evolutionary Mechanisms Tidbits One misconception is that organisms evolve, in the Darwinian sense, during their lifetimes Natural selection acts on individuals, but only populations evolve Genetic variations

More information

ABSTRACT STRATEGIES IN OLIGOPOLIES. This dissertation is part of the effort to contribute to our understanding of Price

ABSTRACT STRATEGIES IN OLIGOPOLIES. This dissertation is part of the effort to contribute to our understanding of Price STRCT Title of Dissertation: ESSYS ON PRICE COMPETITION ND IRM STRTEGIES IN OLIGOPOLIES Heisnam Thoihen Singh, Doctor of Philosohy 007 Dissertation directed by: Professor Daniel Vincent Deartment of Economics

More information

Summary. Introduction

Summary. Introduction doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size

More information

Lecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013

Lecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013 Lecture 19: Hitchhiking and selective sweeps Bruce Walsh lecture notes Synbreed course version 8 July 2013 1 Hitchhiking When an allele is linked to a site under selection, its dynamics are considerably

More information

Efficient Association Study Design Via Power-Optimized Tag SNP Selection

Efficient Association Study Design Via Power-Optimized Tag SNP Selection doi: 10.1111/j.1469-1809.2008.00469.x Efficient Association Study Design Via Power-Optimized Tag SNP Selection B. Han 1,H.M.Kang 1,M.S.Seo 2, N. Zaitlen 3 and E. Eskin 4, 1 Department of Computer Science

More information

What is genetic variation?

What is genetic variation? enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center

More information

Human Genetics and Gene Mapping of Complex Traits

Human Genetics and Gene Mapping of Complex Traits Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2017 Human Genetics Series Tuesday 4/10/17 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:

More information

Using the Association Workflow in Partek Genomics Suite

Using the Association Workflow in Partek Genomics Suite Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within

More information

Linkage Disequilibrium

Linkage Disequilibrium Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level

More information

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Permanent City Research Online URL:

Permanent City Research Online URL: Thomas, P.J. & Chrystal, A. (3). Retail rice otimisation from sarse demand data. American Journal of Industrial and Business Management, 3(3),. 95-36. doi:.436/ajibm.3.3335 City Research Online Original

More information

7-1. Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium)

7-1. Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium) 7-1 Biology 1001 Lab 7: POPULATION GENETICS PREPARTION Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium) OBECTIVES At the end of

More information

Petar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.

Petar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY. The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo

More information

Resources at HapMap.Org

Resources at HapMap.Org Resources at HapMap.Org HapMap Phase II Dataset Release #21a, January 2007 (NCBI build 35) 3.8 M genotyped SNPs => 1 SNP/700 bp # polymorphic SNPs/kb in consensus dataset International HapMap Consortium

More information

Genetics Effective Use of New and Existing Methods

Genetics Effective Use of New and Existing Methods Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for

More information

Structure, Measurement & Analysis of Genetic Variation

Structure, Measurement & Analysis of Genetic Variation Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

PopGen1: Introduction to population genetics

PopGen1: Introduction to population genetics PopGen1: Introduction to population genetics Introduction MICROEVOLUTION is the term used to describe the dynamics of evolutionary change in populations and species over time. The discipline devoted to

More information

An Introduction to Population Genetics

An Introduction to Population Genetics An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Planning and Design of Flex-Route Transit Services

Planning and Design of Flex-Route Transit Services Transortation Research Record 1791 59 Paer No. 2-2324 Planning and Design of Flex-Route Transit Services Liing Fu A theoretical investigation is resented of various issues involved in the lanning and design

More information

Whole Genome Regression and Prediction Methods Applied to Plant and Animal Breeding. & Mario P. L. Calus ᶲ

Whole Genome Regression and Prediction Methods Applied to Plant and Animal Breeding. & Mario P. L. Calus ᶲ Genetics: Published Articles Ahead of Print, ublished on June 8, 01 as 10.1534/genetics.11.143313 Whole Genome Regression and Prediction Methods Alied to Plant and Animal Breeding Gustavo de los Camos*

More information

Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?

Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both? Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies

More information