Genotyping Technology How to Analyze Your Own Genome Fall 2013
|
|
- Michael Stone
- 5 years ago
- Views:
Transcription
1 Genotyping Technology How to nalyze Your Own Genome Fall 2013
2 HapMap Project Phase 1 Phase 2 Phase 3 Samples & POP panels Genotyping centers Unique QC+ SNPs 269 samples (4 populations) HapMap International Consortium Reference Nature (2005) 437:p samples (4 populations) Perlegen 1.1 M 3.8 M (phase I+II) Nature (2007) 449:p851 1,115 samples (11 populations) road & Sanger 1.6 M (ffy 6.0 & Illumina 1M) Draft Rel. 1 (May 2008)
3 Phase 3 Samples label population sample # samples QC+ Draft 1 SW* frican ancestry in Southwest US CEU* Utah residents with Northern and Western European ancestry from the CEPH collection CH Han Chinese in eijing, China CHD Chinese in Metropolitan Denver, Colorado GIH Gujarati Indians in Houston, Texas JPT Japanese in Tokyo, Japan LWK Luhya in Webuye, Kenya MEX* Mexican ancestry in Los ngeles, California MKK* Maasai in Kinyawa, Kenya TSI Toscans in Italy YRI* Yoruba in Ibadan, Nigeria ,301 1,115 * Population is made of family trios
4 HapMap rowser 1a. Go to 1b. Select HapMap phase 3
5 Overview Genotyping technology - SNPs and copy number variaeons Processing the data from genotyping assays - Linkage disequilibrium - Haplotype inference, phasing - Tag SNP seleceon Preliminary analysis of HapMap data
6 SNP Genotyping with SNP rray SNP arrays make use of the biochemical principle that nucleoede bases bind to their complementary partners ( binds to T, C binds to G) n array of oligonucleoede sequences is laid across the surface of the chip. The sample s DN is amplified, and hybridized to the array. The array is scanned to quanefy the relaeve amount of sample bound to each feature. For SNPs, there is a pair of probes: one for each of the alleles. Widely used SNP array technology ffymetrix vs. Illumina SNP arrays
7 ffymetrix GeneChip Probe rray
8 SNP rray Technology: ffymetrix rray The fragment of DN harboring an /C SNP to be interrogated by the probes 25- mer probes for both alleles The locaeon of the SNP locus varies from probe to probe 25- mer (25 nucleoedes) The DN binds to both probes regardless of the allele it carries, but it does so more efficiently when it is complementary to all 25 bases (bright yellow) rather than mismatching the SNP site (dimmer yellow). This impeded binding manifests itself in a dimmer signal.
9 SNP rray Technology: Illumina rray The fragment of DN harboring an /C SNP to be interrogated by the probes \ached to each Illumina bead is a 50- mer sequence complementary to the sequence adjacent to the SNP site. The single- base extension (T or G) that is complementary to the allele carried by the DN ( or C, respecevely) then binds and results in the appropriately- colored signal (red or green, respecevely)
10 Calling Genotypes The raw signal intensiees from the SNP array can be noisy How to cope with the noise Pool the raw signal intensiees from muleple individuals for each SNP and perform a cluster analysis Three clusters for each of the three possible genotypes (,, ) Each dot represents the raw signal intensity for a SNP for each individual
11 CNV Genotyping with rray CGH Genomic DN from two cell populaeons is differeneally labeled (red and green) and hybridized to a microarray Copy numbers are mostly the same across the chromosome between Test and Ref samples ReducEon by a factor of two in copy numbers Log 2 (red/green) =log 2 (red)- log 2 (green)
12 Overview Genotyping technology - SNPs and copy number variaeons Processing the data from genotyping assays - Linkage disequilibrium - Haplotype inference, phasing - Tag SNP seleceon Preliminary analysis of HapMap data
13 Linkage Disequilibrium (LD) LD reflects the relaeonship between alleles at different loci. Ocen, r 2 (correlaeon coefficient) is used as a measure of LD. Locus Locus
14 asic Concepts Parent 1 Parent 2 "" " " a "" "b X "" " " a "" "b a a b b OR a b a b a b a b b etc High LD -> No Recombination (r 2 = 1) SNP1 tags SNP2 Low LD -> Recombination Many possibilities
15 How to Compute r 2 Individuals SNP1 SNP2 SNP r 2 =1.0 SNP1 SNP2 SNP3 r 2 matrix SNP1 SNP2 SNP r 2 =0.0 R 2 =0.0
16 Linkage Disequilibrium in SNP Data r 2 in SNP data from a populaeon of individuals (lack: r 2 =1, white: r 2 =0) genome PopulaEon 2 PopulaEon 2 genome PopulaEon 1 PopulaEon 1
17 Summary SNP/CNV genotyping technology and genotype- calling methods Linkage disequilibrium in the neighboring loci are due to non- random recombinaeon sites across the genome The level of linkage disequilibrium can be quanefied by r 2
Haplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationResources at HapMap.Org
Resources at HapMap.Org HapMap Phase II Dataset Release #21a, January 2007 (NCBI build 35) 3.8 M genotyped SNPs => 1 SNP/700 bp # polymorphic SNPs/kb in consensus dataset International HapMap Consortium
More informationHaplotypes Personalized Medicine: Understanding Your Own Genome Fall 2014
Haplotypes 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Terminology Review llele: different forms of genecc variacons at a given gene or genecc locus Locus 1 has two alleles, and
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplementary Table 1: RT-qPCR primer sequences. Sequences are shown from 5 to 3 direction; all primers are designed using mouse genome as reference. 36B4-F; TGAAGCAAAGGAAGAGTCGGAGGA
More informationGENOME-WIDE data sets from worldwide panels of
Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.116681 Population Structure With Localized Haplotype Clusters Sharon R. Browning*,1 and Bruce S. Weir *Department of Statistics,
More informationI/O Suite, VCF (1000 Genome) and HapMap
I/O Suite, VCF (1000 Genome) and HapMap Hin-Tak Leung April 13, 2013 Contents 1 Introduction 1 1.1 Ethnic Composition of 1000G vs HapMap........................ 2 2 1000 Genome vs HapMap YRI (Africans)
More informationThe HapMap Project and Haploview
The HapMap Project and Haploview David Evans Ben Neale University of Oxford Wellcome Trust Centre for Human Genetics Human Haplotype Map General Idea: Characterize the distribution of Linkage Disequilibrium
More informationHuman Population Differentiation Is Strongly Correlated with Local Recombination Rate
Human Population Differentiation Is Strongly Correlated with Local Recombination Rate Alon Keinan 1,2,3 *, David Reich 1,2 1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, United
More informationPopulation description. 103 CHB Han Chinese in Beijing, China East Asian EAS. 104 JPT Japanese in Tokyo, Japan East Asian EAS
1 Supplementary Table 1 Description of the 1000 Genomes Project Phase 3 representing 2504 individuals from 26 different global populations that are assigned to five super-populations Number of individuals
More informationDe novo human genome assemblies reveal spectrum of alternative haplotypes in diverse
SUPPLEMENTARY INFORMATION De novo human genome assemblies reveal spectrum of alternative haplotypes in diverse populations Wong et al. The Supplementary Information contains 4 Supplementary Figures, 3
More informationHuman Population Differentiation is Strongly Correlated With Local Recombination Rate
Human Population Differentiation is Strongly Correlated With Local Recombination Rate The Harvard community has made this article openly available. Please share how this access benefits you. Your story
More informationThe Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm
The Whole Genome TagSNP Selection and Transferability Among HapMap Populations Reedik Magi, Lauris Kaplinski, and Maido Remm Pacific Symposium on Biocomputing 11:535-543(2006) THE WHOLE GENOME TAGSNP SELECTION
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationNews. The International HapMap Project
HapMap News A Publication of the Coriell Institute for Medical Research, V olume 1, 2004 The International HapMap Project Excitement is building as scientists begin to construct a resource called the haplotype
More informationARTICLE Population-Genetic Properties of Differentiated Human Copy-Number Polymorphisms
ARTICLE Population-Genetic Properties of Differentiated Human Copy-Number Polymorphisms Catarina D. Campbell, 1 Nick Sampas, 2 Anya Tsalenko, 2 Peter H. Sudmant, 1 Jeffrey M. Kidd, 1,3 Maika Malig, 1 Tiffany
More informationSupplementary Figure 1 a
Supplementary Figure 1 a b GWAS second stage log 10 observed P 0 2 4 6 8 10 12 0 1 2 3 4 log 10 expected P rs3077 (P hetero =0.84) GWAS second stage (BBJ, Japan) First replication (BBJ, Japan) Second replication
More informationHuman Populations: History and Structure
Human Populations: History and Structure In the paper Novembre J, Johnson, Bryc K, Kutalik Z, Boyko AR, Auton A, Indap A, King KS, Bergmann A, Nelson MB, Stephens M, Bustamante CD. 2008. Genes mirror geography
More informationPopula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on Computa.onal Genomics Seyoung Kim
Popula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on 02-710 Computa.onal Genomics Seyoung Kim Overview Two fundamental forces that shape genome sequences Recombina.on Muta.on, gene.c
More informationOffice Hours. We will try to find a time
Office Hours We will try to find a time If you haven t done so yet, please mark times when you are available at: https://tinyurl.com/666-office-hours Thanks! Hardy Weinberg Equilibrium Biostatistics 666
More informationAlkes Price Harvard School of Public Health January 24 & January 26, 2017
EPI 511, Advanced Population and Medical Genetics Week 1: Intro + HapMap / 1000 Genomes Linkage Disequilibrium Alkes Price Harvard School of Public Health January 24 & January 26, 2017 EPI 511: Course
More informationIL1B-CGTC haplotype is associated with colorectal cancer in. admixed individuals with increased African ancestry
IL1B-CGTC haplotype is associated with colorectal cancer in admixed individuals with increased African ancestry María Carolina Sanabria-Salas 1, 2,*, Gustavo Hernández-Suárez 1, Adriana Umaña- Pérez 2,
More informationGenotype Prediction with SVMs
Genotype Prediction with SVMs Nicholas Johnson December 12, 2008 1 Summary A tuned SVM appears competitive with the FastPhase HMM (Stephens and Scheet, 2006), which is the current state of the art in genotype
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationGenotype quality control with plinkqc Hannah Meyer
Genotype quality control with plinkqc Hannah Meyer 219-3-1 Contents Introduction 1 Per-individual quality control....................................... 2 Per-marker quality control.........................................
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationGenome variation - part 1
Genome variation - part 1 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 21 th January 2016 Aims of the session Introduce major
More informationEvaluation of a multipoint method for imputing genotypes using HapMap III
Mathematical Statistics Stockholm University Evaluation of a multipoint method for imputing genotypes using HapMap III Emil Rehnberg Examensarbete 2009:5 Postal address: Mathematical Statistics Dept. of
More informationPetar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.
The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo
More informationPractical consideration of genotype imputation: Sample size, window size, reference choice, and untyped rate
Statistics and Its Interface Volume 4 (2011) 339 351 Practical consideration of genotype imputation: Sample size, window size, reference choice, and untyped rate Boshao Zhang, Degui Zhi, Kui Zhang, Guimin
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationAnalysing Alu inserts detected from high-throughput sequencing data
Analysing Alu inserts detected from high-throughput sequencing data Harun Mustafa Mentor: Matei David Supervisor: Michael Brudno July 3, 2013 Before we begin... Even though I'll only present the minimal
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationUpdate on the Genomics Data in the Health and Re4rement Study. Sharon Kardia Jennifer A. Smith University of Michigan April 2013
Update on the Genomics Data in the Health and Re4rement Study Sharon Kardia Jennifer A. Smith University of Michigan April 2013 Genetic variation in SNPs (Single Nucleotide Polymorphisms) ATTGCAATCCGTGG...ATCGAGCCA.TACGATTGCACGCCG
More informationStructure, Measurement & Analysis of Genetic Variation
Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine
More informationGenotyping requirements for complex disease studies
Genotyping requirements for complex disease studies Grant Montgomery Molecular Epidemiology, Queensland Institute of Medical Research, Australia Queensland Institute of Medical Research Outline Background
More informationGenome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma. Supplementary Information
Genome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma Vinod Kumar 1,2, Naoya Kato 3, Yuji Urabe 1, Atsushi Takahashi 2, Ryosuke Muroyama 3, Naoya Hosono
More informationQuality Measures for CytoChip Microarrays
Quality Measures for CytoChip Microarrays How to evaluate CytoChip Oligo data quality in BlueFuse Multi software. Data quality is one of the most important aspects of any microarray experiment. This technical
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationThe Human Genome. The raw data. The repeat content. Composition of the human genome bases. A s T s C s and G s and N s.
3000000000 bases The Human Genome The raw data GATCTGATAAGTCCCAGGACTTCAGAAGagctgtgagaccttggccaagt cacttcctccttcaggaacattgcagtgggcctaagtgcctcctctcggg ACTGGTATGGGGACGGTCATGCAATCTGGACAACATTCACCTTTAAAAGT TTATTGATCTTTTGTGACATGCACGTGGGTTCCCAGTAGCAAGAAACTAA
More informationSNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions
SNP Selection Outline of Tutorial Concepts of tagsnps University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for Human Genetics
More informationPopulation Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
More informationAnalyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek
Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of
More informationGenome-wide analyses in admixed populations: Challenges and opportunities
Genome-wide analyses in admixed populations: Challenges and opportunities E-mail: esteban.parra@utoronto.ca Esteban J. Parra, Ph.D. Admixed populations: an invaluable resource to study the genetics of
More informationEfficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation
Efficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation Asif Javed 1,2, Petros Drineas 2, Michael W. Mahoney 3 and Peristera Paschou 4 1 Computational Biology Center, IBM T. J. Watson
More informationSupplementary Figure 1. Study design of a multi-stage GWAS of gout.
Supplementary Figure 1. Study design of a multi-stage GWAS of gout. Supplementary Figure 2. Plot of the first two principal components from the analysis of the genome-wide study (after QC) combined with
More informationLinkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
More informationSupplementary Materials
Supplementary Materials Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers Hongxing Zhang 1, Yun Zhai 1, Zhibin
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationA genome wide association study of metabolic traits in human urine
Supplementary material for A genome wide association study of metabolic traits in human urine Suhre et al. CONTENTS SUPPLEMENTARY FIGURES Supplementary Figure 1: Regional association plots surrounding
More informationB) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationIntroduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron
Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Genotype calling Genotyping methods for Affymetrix arrays Genotyping
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationIN recent years there has been considerable interest in
Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.113977 Natural Selection and the Distribution of Identity-by-Descent in the Human Genome Anders Albrechtsen,*,1,2 Ida Moltke,1
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationWu et al., Determination of genetic identity in therapeutic chimeric states. We used two approaches for identifying potentially suitable deletion loci
SUPPLEMENTARY METHODS AND DATA General strategy for identifying deletion loci We used two approaches for identifying potentially suitable deletion loci for PDP-FISH analysis. In the first approach, we
More informationSupplementary Information
Supplementary Information Genome-partitioning of genetic variation for complex traits using common SNPs Jian Yang, Teri A. Manolio, Louis R. Pasquale 3, Eric Boerwinkle 4, Neil Caporaso 5, Julie M. Cunningham
More informationFrequently asked questions
Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationGenetics and Psychiatric Disorders Lecture 1: Introduction
Genetics and Psychiatric Disorders Lecture 1: Introduction Amanda J. Myers LABORATORY OF FUNCTIONAL NEUROGENOMICS All slides available @: http://labs.med.miami.edu/myers Click on courses First two links
More informationGenome-Wide Association Studies. Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey
Genome-Wide Association Studies Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey Introduction The next big advancement in the field of genetics after the Human Genome Project
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationSequence variation Introductory bioinformatics for human genomics workshop, UNSW
Sequence variation Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 29 th January 2016 Aims of the session Introduce major human
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationFamilial Breast Cancer
Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management
More informationIllumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era Anthony Green Sr. Genotyping Sales Specialist North America 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx,
More informationABSTRACT. In recent years population-based association studies have been advocated as the most
ABSTRACT DICKSON, SAMUEL PRICE. Improving Discovery of Causal Variants in Genetic Association Studies. (Under the direction of committee, Dr. Greg Gibson and Dr. Marie Davidian). In recent years population-based
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationRedefine what s possible with the Axiom Genotyping Solution
Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationMeasures of human population structure show heterogeneity among genomic regions
Measures of human population structure show heterogeneity among genomic regions Bruce S. Weir, Lon R. Cardon, Amy D. Anderson, et al. Genome Res. 2005 15: 1468-1476 Access the most recent version at doi:10.1101/gr.4398405
More informationIntroduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationUKPMC Funders Group Author Manuscript Nature. Author manuscript; available in PMC 2011 April 1.
UKPMC Funders Group Author Manuscript Published in final edited form as: Nature. 2010 October 28; 467(7319): 1061 1073. doi:10.1038/nature09534. A map of human genome variation from population scale sequencing
More informationA haplotype map of the human genome
Vol 437 27 October 2005 doi:10.1038/nature04226 A haplotype map of the human genome The International HapMap Consortium* ARTICLES Inherited genetic variation has a critical but as yet largely uncharacterized
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Sequence variations Single nucleotide polymorphisms Insertions/deletions Copy number variations (large: >1kb) Variable (short) number tandem repeats Single Nucleotide
More informationPhasing of 2-SNP Genotypes based on Non-Random Mating Model
Phasing of 2-SNP Genotypes based on Non-Random Mating Model Dumitru Brinza and Alexander Zelikovsky Department of Computer Science, Georgia State University, Atlanta, GA 30303 {dima,alexz}@cs.gsu.edu Abstract.
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationLinkage Disequilibrium. Biostatistics 666
Linkage Disequilibrium iostatistics 666 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower Previously asic roerties of a locus llele Frequencies Genotye Frequencies
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationCornell Probability Summer School 2006 Ancestral Recombination Graph
Cornell Probability Summer School 200 Ancestral Recombination Graph Simon Tavaré Lecture 3 Why recombination? In the era of genomic polymorphism data, the need for models that include recombination is
More informationLinkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
More informationPopulation differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia
Population differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia Kevin Galinsky Harvard T. H. Chan School of Public Health American Society
More informationIntroduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron
Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron Many sources of technical bias in a genotyping experiment DNA sample quality and handling
More informationWORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Twelfth Session Ottawa, Canada, May 11 to 13, 2010
E BMT/12/9 ORIGINAL: English DATE: April 9, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR
More informationSAC review Haplotype mapping in human disease
10.1576/toag.11.4.277.27532 http://onlinetog.org Haplotype mapping in human disease Author Linda Morgan Key content: Many obstetric and gynaecological disorders result from complex interactions between
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationRoadmap: genotyping studies in the post-1kgp era. Alex Helm Product Manager Genotyping Applications
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era Alex Helm Product Manager Genotyping Applications 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa,
More informationDeep learning sequence-based ab initio prediction of variant effects on expression and disease risk
Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong
More information