Pseudomonas syringae causing bacterial canker on cherries and sweet cherries in Poland
|
|
- Cynthia Carr
- 5 years ago
- Views:
Transcription
1 Pseudomonas syringae causing bacterial canker on cherries and sweet cherries in Poland Monika Kałużna and Joanna Puławska Research Institute of Horticulture, Pomology Division, Pomologiczna 18 str., Skierniewice, Poland
2 It occurs in all fruit trees growing areas in the world, causing the most damage in orchards and nurseries of stone fruit trees caused by Pseudomonas syringae polyphagous this pathogen can decrease trees resistance to frost cankers developing on the branches and main trunk may lead to death of whole trees losses caused by the disease on susceptible varieties in young orchards can reach even 75% in 2007 and 2011 the disease was observed in the high intensity in Poland
3 The aim of our study: to characterize the population of bacteria causing bacterial canker on stone fruits in Poland to design primers enabling specific detection of bacteria belonging to 2 races of P.s. pv. morsprunorum originating from different symptomatic tissue of stone fruits in Poland.
4 Symptoms
5 Bacterial cankerin Poland Pseudomonas syringae pv. syringae Pseudomonas syringae pv. morsprunorum race 1 and 2 NO Pseudomonas syringae pv. avii Pseudomonas syringae pv. persicae
6 Isolates Of 767 samples collected (316 from cherry, 179 from sweet cherry, 145 fromplum,107frompeach,14fromapricot,3fromnectarineand3frommirabelle) 150 isolates of Pseudomonas syringae were obtained: 5 from peach,20fromsweetcherry,47fromplumand78fromcherry were obtained 112 isolates were classified to pv. syringae 32 isolates to pathovar morsprunorum race 1 6isolatestomorsprunorumrace2
7 Stepsof identification and differentiation Aspects of disease etiology I. Phenotypic characteristics (morphology, biochemistry, physiology)-lopat tests, GATTa tests, L-lactate utilization II. Pathogenicity and virulence determination on sweet cherry fruitlets
8 Stepsof identification and differentiation III. Syringomycin production growth inhibition of Rhodotorula pilimanae MUCL IV. Study on synergism between bacteria and frost Pss without exposition to frost isolates Psmi Pss exposed to frost
9 Stepsof identification and differentiation V. Molecular study, genetic diversity of bacteria a. DNA isolationby modifiedmethodof Aljanabiii Martinez (1997) b. Detectionof the genes encodingtoxincoronatine, syringomycine and siderophore yersiniabactin c. Geneticdiversity: rep-pcr(box, ERIC, REP and IS50), PCR MP, MLST (gyrb, gapa, gltaand rpod)
10 Detection of the genes encoding toxin coronatine, syringomycine andsiderophoreyersiniabactin M of Psmrace 1 possess cflgene encoding for coronatine M Product 650 bp 5 strains of Psm race 2 possess irp gene encoding for yersiniabactin. M Product 943 bp Product 752bp Over 40 strains of Pss possess syrb gene encoding for syringomycine
11 Genetic diversity: repetitive PCR, PCR MP P.s. pv. syringae Psmrasa 2 P.s. pv..? Psmrasa 1 Amplification of a limited number of DNA fragments, whose number and size compared after electrophoresis gives information about the genetic differences between the investigated strains. Rep-PCRs and PCR MP methods confirmed the homogeneity of races within pathovar morsprunorum and the diversity within the isolates belonging to pathovar syringae
12 Multilocus sequence typing (MLST) 4 housekeeping genes: gyrb, gapa, glta and rpod rpoD 77rpoD 417rpoD 3800rpoD rpoD 240rpoD 236rpoD 234rpoD 233rpoD 24 68rpoD 264rpoD 437rpoD 222rpoD 242rpoD rpoD rpoD 256rpoD rpoD rpoD 239rpoD rpoD rpoD rpoD rpoD 657rpoD 1247rpoD rpoD 663rpoD 258rpoD rpoD 106rpoD 110rpoD rpoD 109rpoD 2905rpoD 103rpoD 141rpoD rpoD 959rpoD 91rpoD 122rpoD 211rpoD rpoD 970arpoD 1021rpoD 215rpoD 25B rpod 217rpoD 250rpoD Psmrace 1 283rpoD 1061rpoD 2222rpoD Psmrace 2 Pseudomonas fluorescens LMG5831 Pss Pss homogenic group 0.02
13 Detection-primer designing two primer pairs designed for the detection of strains of race 1 and race 2 ofpsm they were specific to the group for which were designated the designed primers constitute the first system for specific detection of Psmrace 1 and 2. PCR amplification of the 793-bp fragment specific for the strains of Pseudomonas pv. morsprunorum race 1 PCR amplification of the 398-bp fragment specific for the strains of Pseudomonas pv. morsprunorum race 2
14 Control Prevention treatments: Afterfruit harvest cut and removed from the orchard infested stems, branches with reserve: cm and even whole trees if neccesary Protect the wound after cutting by using Funaben03 PA or white emulsion supplemented with 1% of copper Use the slips from healthy trees, nursery stock must be absolutely free of bacterial cancer
15 Chemical control: Use of coppercompoundsin spring and autumn The range of chemicals mainly based on copper compounds-occurring of bacteria resistance The copper compounds are good bactericides however work only on the surface and do not treat/cure infected plants They can cause side effect such as flowers or buds russeting of the fruits
16 Conclusions Bacterial canker in Poland are maily caused by Pssand Psmrace 1 Among Pss and Psm race 1 some mutants with lack of syringomycin and coronatine respectively were found The pathogenicity test on immature sweet cherry fruits cv. Napoleon divided the tested strains into two groups: one causing black brown necroses and second water soaked superficial lesions Results of rep-pcr and PCR MP confirmed the homogeneity of races within pathovar morsprunorum and the diversity within the isolates belonging to pathovar syringae However, among isolates of pathovar syringae originating from sour cherry, the homogenous group of isolates showing atypical pathogenic abilities (similar to those of pathovar morsprunorum) was found. This may suggest that they belong to an intermediate form between pathovars syringae and morsprunorum or to a new patovar
17 Thank you very much for your attention
PHENOTYPING PROTOCOLS FOR TOLERANCE TO IMPORTANT CHERRY DISEASES. Fruit Growing Institute, Plovdiv; Department of Plant Protection
STSM Scientific Report: Subject: PHENOTYPING PROTOCOLS FOR TOLERANCE TO IMPORTANT CHERRY DISEASES STSM Reference number: COST-STSM-FA1104-20571 Period: 2014-07-01 to 2014-07-31 COST Action number: FA1104
More informationDiagnostic and Epidemiological Tools for Cherry Pathogenic Bacteria based on Genomics and MALDI-TOF Mass Spectrometry
Diagnostic and Epidemiological Tools for Cherry Pathogenic Bacteria based on Genomics and MALDI-TOF Mass Spectrometry Michela Ruinelli (1), Joël Pothier (1), Jochen Blom (2), Alexander Goesmann (2), Valentin
More informationBACTERIAL CANKER OF AVOCADO
South African Avocado Growers Association Yearbook 1985. 8:63-65 BACTERIAL CANKER OF AVOCADO L KORSTEN AND JM KOTZÉ DEPARTMENT OF MICROBIOLOGY AND PLANT PATHOLOGY UNIVERSITY OF PRETORIA PROGRESS REPORT
More informationGrower Summary HNS 179. Management of bacterial canker in Prunus spp. Annual 2012
Grower Summary HNS 179 Management of bacterial canker in Prunus spp. Annual 2012 Disclaimer AHDB, operating through its HDC division seeks to ensure that the information contained within this document
More informationA New Generation of Clonal Seed Orchards of Wild Cherry. Selection of Clones and Spatial Design. Bart De Cuyper
A New Generation of Clonal Seed Orchards of Wild Cherry. Selection of Clones and Spatial Design Bart De Cuyper Research Institute for Nature and Forest, Gaverstraat 4, 9500 Geraardsbergen, Belgium E- mail
More informationHistorical Diversity and Molecular Diagnosis of Bacterial Pathogens on Tomato in Pennsylvania
Historical Diversity and Molecular Diagnosis of Bacterial Pathogens on Tomato in Pennsylvania Ekaterina (Katya) Nikolaeva Pennsylvania Department of Agriculture Bureau of Plant Industry Division of Plant
More informationMicrobiological diagnosis of Bacillus anthracis. Member of the Bacillus cereus group
Microbiological diagnosis of Bacillus anthracis The first bacterium shown to be the cause of a disease: 1877 by Robert Koch Member of the Bacillus cereus group B. cereus B. anthracis B. thuringiensis B.
More informationBacterial blight in field pea
Bacterial blight in field pea Efficient phenotyping method developed in controlled environment for pre-breeding and breeding Dr Pragya Kant- Horsham, Vic Bacterial blight epidemic in Rupanyup, Vic, 2012
More informationJournal of Plant Pathology (2012), 94 (1, Supplement), S1.69-S1.73 Edizioni ETS Pisa, 2012 S1.69
012_COST(Golanowska)_S69 15-06-2012 11:29 Pagina 69 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.69-S1.73 Edizioni ETS Pisa, 2012 S1.69 COMBINED EFFECT OF THE ANTAGONISTIC POTENTIAL OF SELECTED
More informationSEED ORCHARD CONFERENCE. Bart De Cuyper. About picky trees and stubborn bumble bees. Bart De Cuyper. A New Generation of
SEED ORCHARD CONFERENCE A New Generation of Clonal Seed Orchards of Wild Cherry Selection of Clones and Spatial Design Bart De Cuyper Research Institute for Nature and Forest Geraardsbergen, Belgium www.inbo.be
More informationGenetics of Plant-Pathogen Interactions (Plant Immunity) Topics on Systemic Acquired Resistance (SAR)
Genetics of Plant-Pathogen Interactions (Plant Immunity) Topics on Systemic Acquired Resistance (SAR) Major types of plant pathogens - Bacteria - Fungi (>80% loss) - Viruses - Viroid Can you name a few
More informationPHYTOSANITARY PROCEDURES
EPPO Standards PHYTOSANITARY PROCEDURES PSEUDOMONAS SYRINGAE PV. PERSICAE SAMPLING AND TEST METHODS PM 3/44(1) English oepp eppo Organisation Européenne et Méditerranéenne pour la Protection des Plantes
More information1
1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using
More informationA NEW BACTERIAL DISEASE ON BLUBERRY (VACCINIUM CORYMBOSUM) CAUSED BY PSEUDOMONAS SPP.
JOURNAL OF PLANT PROTECTION RESEARCH Vol. 53, No. 1 (2013) DOI: 10.2478/jppr-2013-0004 A NEW BACTERIAL DISEASE ON BLUBERRY (VACCINIUM CORYMBOSUM) CAUSED BY PSEUDOMONAS SPP. Monika Kałużna*, Joanna Puławska,
More informationDistributed at The Empire State Fruit & Vegetable Expo; January 26,
RESEARCH YIELDS GREATER UNDERSTANDING OF BACTERIAL DISEASES OF ONION IN NEW YORK Steven V. Beer a, Jo Ann E. Asselin b*, Jean M. Bonasera c*, and Ali M. Zaid d* Professor a, Post-doctoral Associate b,
More informationPasteurella multocida
BACTOTYPE PCR Amplification Kit Pasteurella multocida Labor Diagnostik Leipzig Manual Technology The product group BACTOTYPE PCR Amplification Kit comprises optimised systems for the identification of
More informationNone. Dr S J Roberts
Project number TF 217 Project title: Improving the management of bacterial canker in stone fruits Project leader: Dr S J Roberts, Plant Health Solutions Ltd. Report: Final report, May 2015 Previous report:
More informationMOLECULAR TYPING TECHNIQUES
MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise
More informationReview of lecture 1: Significance of Plant Disease. Lecture 2: Disease Concept
Review of lecture 1: Significance of Plant Disease 10% of all food production is lost to disease (30% to all pests) The introduction of exotic plant pathogens has caused great losses: e.g., American chestnut
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationDetermination of vegetative compatibility groups using molecular markers, and their aggressiveness of Verticillium dahliae occurring on sunflower
Determination of vegetative compatibility groups using molecular markers, and their aggressiveness of Verticillium dahliae occurring on sunflower Kholoud M. Alananbeh Samuel Markell Thomas Gulya and Neil
More informationVegetative and Cutting Propagation
15 Vegetative and Cutting Propagation Text Pages: 597 601; 623 628. Objectives: 1. Be able to describe and explain the origins of clones. 2. Be able to describe, explain, and summarize managing sources
More informationPhytopathogenic bacteria. review of arms race Effector-triggered immunity Effector diversification
Phytopathogenic bacteria review of arms race Effector-triggered immunity Effector diversification Arms race of plant-pathogen interactions plants have different layers of immunity 1 st layer: PAMP-triggered
More informationMolecular Characteristics of Pseudomonas syringae pv. actinidiae Strains Isolated in Korea and a Multiplex PCR Assay for Haplotype Differentiation
Plant Pathol. J. 30(1) : 96-101 (2014) http://dx.doi.org/10.5423/ppj.nt.09.2013.0095 pissn 1598-2254 eissn 2093-9280 Note Open Access The Plant Pathology Journal The Korean Society of Plant Pathology Molecular
More informationBacterial Genetics. Stijn van der Veen
Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating
More informationAssessment of the sanitary status of pome fruit crops in Kosovo, with particular emphasis to the bacterial disease the Fire Blight
ORIGINAL SCIENTIFIC PAPER Assessment of the sanitary status of pome fruit crops in Kosovo, with particular emphasis to the bacterial disease the Fire Blight Naim KRASNIQI 1, Arben MUSLIU 1, Kujtim LEPAJA
More informationFinal Report, August 31, Evaluation of Species Susceptibility and Chemical Management of Phomopsis Decline
Amount: $10,000.00 Dates: June 1, 2014 through June 30, 2015. Final Report, August 31, 2015 Evaluation of Species Susceptibility and Chemical Management of Phomopsis Decline 791N3200369 MSU Transmittal
More informationTaxonomy. Classification of microorganisms 3/12/2017. Is the study of classification. Chapter 10 BIO 220
Taxonomy Is the study of classification Organisms are classified based on relatedness to each other Chapter 10 BIO 220 Fig. 10.1 1 Species Binomial nomenclature for species identification A eukaryotic
More informationHLA-DR TYPING OF GENOMIC DNA
HLA-DR TYPING OF GENOMIC DNA Zofia SZCZERKOWSKA, Joanna WYSOCKA Institute of Forensic Medicine, Medical University, Gdañsk, Poland ABSTRACT: Advances in molecular biology techniques allowed for introduction
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationRecombinant DNA, Biotechnology, and Microbes. Microbiology 221
Recombinant DNA, Biotechnology, and Microbes Microbiology 221 Overview Putting microbes to Work Molecular Cloning Recombinant DNA technology utilizes the power of microbiological selection and screening
More informationAppendix. Section 1. Guidelines for proposals seeking funding to collect data on existing germplasm evaluation trials
Appendix Plant improvement germplasm evaluation guidelines Section 1. Guidelines for proposals seeking funding to collect data on existing germplasm evaluation trials CRDF recognizes that there are existing
More informationOhio Vegetable & Small Fruit Research & Development Program
Ohio Vegetable & Small Fruit Research & Development Program Project Title: Controlling Angular Leaf Spot on pumpkin using seed treatments and foliar applications Jim Jasinski, OSUE IPM Program Sally Miller
More informationGenetic and pathogenic diversity of Pseudomonas syringae strains isolated from cucurbits
Eur J Plant Pathol (2015) 141:1 14 DOI 10.1007/s10658-014-0524-4 Genetic and pathogenic diversity of Pseudomonas syringae strains isolated from cucurbits Renata Słomnicka & Helena Olczak-Woltman & Grzegorz
More informationDr. Sabri M. Naser Department of Biology and Biotechnology An-Najah National University Nablus, Palestine
Molecular identification of lactic acid bacteria Enterococcus, Lactobacillus and Streptococcus based on phes, rpoa and atpa multilocus sequence analysis (MLSA) Dr. Sabri M. Naser Department of Biology
More informationSuggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
More informationEnvironmental Genomics and Systems Biology Institute of Natural Resource Sciences Zurich University of Applied Sciences, Wädenswil, Switzerland
Environmental Genomics and Systems Biology Institute of Natural Resource Sciences Zurich University of Applied Sciences, Wädenswil, Switzerland www.zhaw.ch MALDI-TOF MS for microorganism identification:
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationFuture Management Strategies in Disease Control
Future Management Strategies in Disease Control K.G. Pegg, QHI Time to Reflect Phytophthora Root Rot The early days to the 1980s: muck and magic Muck and Magic straw chicken manure gypsum Muck and Magic
More informationApplying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.
Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of
More informationAP235 Developing safe foliar spraying of phosphonic acid to control peach and apple Phytophthora. Dr T Lim Agriculture Victoria
AP235 Developing safe foliar spraying of phosphonic acid to control peach and apple Phytophthora Dr T Lim Agriculture Victoria AP235 This report is published by the Horticultural Research and Development
More informationBreeding for Disease Resistance
Breeding for Disease Resistance Resistance refers to the ability of the host to interfere with the normal growth and for development of the pathogen. The plant affected by the disease is known as host
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationApplication of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms
Application of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms Pejvak Khaki Department of Microbiology Razi Vaccine & Serum Research Institute Karaj,
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationSpeed Detection of Pests in China
INVASIVE ALIEN SPECIES AND THE IPPC, September 2003,Germany Speed Detection of Pests in China Ning Hong (Agriculture Ministry of China) Phytosanitary falls back on technology. Today, with the rapidly development
More informationYield Impacts and Management Strategies for Wheat Diseases that Fungicides Don t Control (BYD and BLS) Dr. Madeleine Smith and Dr.
Yield Impacts and Management Strategies for Wheat Diseases that Fungicides Don t Control (BYD and BLS) Dr. Madeleine Smith and Dr. Ruth Dill-Macky Wheat Pathology Collaboration - BLS Bacterial Leaf Streak
More informationVTEC strains typing: from traditional methods to NGS
VTEC strains typing: from traditional methods to NGS 2 nd course on bioinformatics tools for Next Generation Sequencing data mining: use of bioinformatics tools for typing pathogenic E. coli ISS, Rome
More informationBiological Warfare Defense at DARPA Program Overview
Biological Warfare Defense at DARPA Program Overview Stephen S. Morse, Ph.D. DARPA/ smorse@darpa.mil DARPA BWD Program (including novel or bioengineered pathogens) DARPA BWD Program (most current techniques
More informationGenetic diversity of Pseudomonas syringae pv. lachrymans strains isolated from cucumber leaves collected in Poland
Doi: 10.1111/j.1365-3059.2006.01550.x Blackwell Publishing Ltd Genetic diversity of Pseudomonas syringae pv. lachrymans strains isolated from cucumber leaves collected in Poland H. Olczak-Woltman a *,
More informationINCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO
INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO Zindović J., 1 Božović V., 1 Miladinović Z., 2 Rubies Autonell C. 3, Ratti C. 3 1 2 3 Peach production in Montenegro Stone fruit
More informationGenomic selection in American chestnut backcross populations
Genomic selection in American chestnut backcross populations Jared Westbrook The American Chestnut Foundation TACF Annual Meeting Fall 2017 Portland, ME Selection against blight susceptibility in seed
More informationTHE ROLE OF WATER IN MICROCLIMATE MANIPULATION IN ORHARDS
THE ROLE OF WATER IN MICROCLIMATE MANIPULATION IN ORHARDS L. LAKATOS 1 ABSTRACT. - The Role of Water in Microclimate Manipulation in Orhards. Irrigation in some countries is a horticultural practice mainly
More informationDNAble Field Test Kit for Rapid Detection of Clavibacter michiganensis subsp. michiganensis in Tomato Tissue
DNAble Field Test Kit for Rapid Detection of Clavibacter michiganensis subsp. michiganensis in Tomato Tissue Tania R. Spenlinhauer, PhD Manager, Molecular Diagnostics Applications Development EnviroLogix
More informationLate blight resistance of potato hybrids with diverse genetic background
Late blight resistance of potato hybrids with diverse genetic background E. Rogozina, M. Kuznetsova, O. Fadina, M. Beketova, E. Sokolova and E. Khavkin EuroBlight workshop 14-17 May 2017, Aarhus, Denmark
More informationMLST and antibiotic resistance determination of Swiss Campylobacter using a multiplex scheme and online database
MLST and antibiotic resistance determination of Swiss Campylobacter using a multiplex scheme and online database Peter Kuhnert Institute of Veterinary Bacteriology Overview > 1. Introduction Situation
More informationThe Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae
Letters in General Microbiology The Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae Rachel Sohn, Melissa Kane and Michelle Wong Department of Biology, Rutgers University, Camden
More informationWhat Copper Formulations are Best for Tree Fruit Applications?
What Copper Formulations are Best for Tree Fruit Applications? 2012 Mid-Atlantic Fruit and Vegetable Convention Hershey, PA 1 February 2012 Dave Rosenberger Cornell University s Hudson Valley Lab Highland,
More informationFoliage Color Density Leaf size and shape Wilting? Retention
Diagnosing Tree Diseases: The Good, The Bad, and the Ugly! Fred Baker Department Wildland Resources Utah State University Disease Any deviation from the normal function of a plant... Disease Any deviation
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green
More informationRecombinant DNA Libraries and Forensics
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier
More informationBATTLING BUGS: INROADS IN INFECTIOUS DISEASES
UW MEDICINE PATIENTS ARE FIRST BATTLING BUGS: INROADS IN INFECTIOUS DISEASES UW MINI-MEDICAL SCHOOL Brad T. Cookson M.D., Ph.D. February 11, 2014 FEVER: THE HOST RESPONDS Humanity has but three great enemies:
More informationDiagnosis and detection of different genotypes of Paenibacillus larvae, the causal agent of American Foulbrood disease
OIE SYMPOSIUM ON EMERGING INFECTIOUS AGENTS IN HONEY BEES AND OIE-LISTED DISEASES 45th APIMONDIA International Apicultural Congress Istanbul, Turkey, 2017 Diagnosis and detection of different genotypes
More informationCOST FA1104 Training School Molecular diagnostics of bacterial diseases
COST FA1104 Training School Molecular diagnostics of bacterial diseases Zurich University of Applied Sciences School of Life Sciences and Facility Management Institute of Natural Resource Sciences Environmental
More informationBegomovirus resistance z Resistance TYLCV ToMoV Yield Fruit size Designation Source Spring Fall Spring Fall (kg/plant) (g)
Introduction. Five breeding lines are released that have begomovirus resistance gene Ty-3 which provides resistance to tomato yellow leaf curl virus (TYLCV), the new world virus tomato mottle virus (ToMoV),
More informationDNA amplification and analysis: minipcr TM Food Safety Lab
Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health
More informationSupplemental Information:
Supplemental Information: Detection of ESKAPE bacterial pathogens at the point-of-care using isothermal DNAbased assays in a portable, de-gas microfluidic diagnostic assay platform # Lars D. Renner 1,2,
More informationTable S1. Primers and PCR digestion schemes used in this study
Table S1. Primers and schemes used in this study PS locus promoter region Primer sequence (5-3 ) Product size (bp) Enzyme Fragment sizes (bp) when promoter is on off psa TGTGTAAATGATAGGAGGCTAGGG GTTGACGGAAATGATCGGTATAG
More informationUnderstanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationCHAPTER 24. Immunology
CHAPTER 24 Diagnostic i Microbiology and Immunology Growth-Dependent Diagnostic Methods Isolation of Pathogens from Clinical Specimens Proper sampling and culture of a suspected pathogen is the most reliable
More informationSchool of Allied Medical Sciences. Course Description Guide Associate in Medical Laboratory Sciences. Page 1 of 15
School of Allied Medical Sciences Course Description Guide Associate in Medical Laboratory Sciences Page 1 of 15 Program Name & Definition: Associate in Medical Laboratory Sciences Laboratory sciences
More informationMolecular detection and characterization of viruses infecting sweet cherry trees in Greece
Molecular detection and characterization of viruses infecting sweet cherry trees in Greece V.I. Maliogka, A.T. Katsiani, V. Drougkas, K. Efthimiou, N.I. Katis Lab of Plant Pathology, School of Agriculture,
More informationPathological Studies on Bacterial Canker Disease on Some Fruit Trees
Pathological Studies on Bacterial Canker Disease on Some Fruit Trees By Ahmed Abd ElHady ElSiesy B.Sc. Agricultural Sciences (Plant Pathology), Fac. Agric. Moshtohor, Zagazig Univ. Benha Branch, 2003 Thesis
More information5.36 Biochemistry Laboratory Spring 2009
MIT OpenCourseWare http://ocw.mit.edu 5.36 Biochemistry Laboratory Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. Laboratory Manual for URIECA
More informationINSECT-TRANSMITTED PROCARYOTES
Fourteenth IOCV Conference, 2000 Insect-Transmitted Procaryotes INSECT-TRANSMITTED PROCARYOTES Improved Sensitivity in the Detection and Differentiation of Citrus Huanglongbing Bacteria from South Africa
More informationGenetics and Biotechnology 13.2 DNA Technology
Biotechnology Genetic Engineering Technology that involves manipulating the DNA of one organism in order to insert the DNA of another organism An electric current is used to separate DNA fragments according
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationDNA Structure and Function
DNA Structure and Function DNA Structure DNA Replication Ch 4: Nucleic Acids and the Origin of LIfe Ch 13: DNA and its role in heredity Discussion Summary: Week 12 Stirring the Simmering Designer Baby
More informationSustainable irrigation of highintensity. Dr Eleftheria Stavridou
Sustainable irrigation of highintensity tree fruit orchards Dr Eleftheria Stavridou Presentation outline Introduction of NIAB EMR FERTINNOWA: transferring knowledge to improve water and nutrient use efficiency
More informationDNA Markers for Identification of Pseudomonas syringae pv. actinidiae
Mol. Cells, Vol. 13, No. 2, pp. 309-314 M olecules and Cells KSMCB 2002 DNA Markers for Identification of Pseudomonas syringae pv. actinidiae Young Jin Koh and Ill Sup Nou 1, * Major of Applied Biology,
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More informationIdentification and characterization of a pathogenicity-related gene VdCYP1 from Verticillium dahliae
Identification and characterization of a pathogenicity-related gene VdCYP1 from Verticillium dahliae Dan-Dan Zhang*, Xin-Yan Wang*, Jie-Yin Chen*, Zhi-Qiang Kong, Yue-Jing Gui, Nan-Yang Li, Yu-Ming Bao,
More information3. Protein(s)or polypeptide(s): a. are a chain of amino acids b. is a rare molecule in an organism
2018 Iowa FFA Ag Biotechnology CDE General Knowledge Exam 1. A plant breeder makes a cross between two plants that are both the genotype Aa (Aa X Aa). How many different genotypes with respect to the A,a
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationGene structure, gene expression and control of gene expression
Gene structure, gene expression and control of gene expression Transcription and translation Promoter, coding sequence, untranslated regions Ch 14: From DNA to Protein; Gene Expression Discussion Summary:
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationI. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
More informationCOOLEY SPRUCE GALL ADELGID
Problem Pests of Trees/Shrubs Problem Pests Workshop 2017 Cooley Spruce Gall Adelgid Cankers Physiol/Enviro Damage + Browning of Evergreens Gall formers Black Knot Bronze Leaf Disease Yellow headed Spruce
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationFrom transnational research collaboration to regional Standards: the case of the EPPO Diagnostic Protocol on Xylella fastidiosa
From transnational research collaboration to regional Standards: the case of the EPPO Diagnostic Protocol on Xylella fastidiosa Françoise Petter & Baldissera Giovani EPPO Secretariat EPPO IN A FEW WORDS
More informationMochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
More informationMethods that do not require growth in laboratory PCR
Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences
More information