APPLICATIONS FOR MICROSATELLITE MARKERS IN THE MANAGEMENT AND CONSERVATION OF FOREST TREES,
|
|
|
- Janice Shelton
- 6 years ago
- Views:
Transcription
1 APPLICATIONS FOR MICROSATELLITE MARKERS IN THE MANAGEMENT AND CONSERVATION OF FOREST TREES, illustration with: Baillonella toxisperma and Milicia excelsa Ndiade Bourobou D, Moussavou H, NZENGUE E, Favreau B, Mignot A, Bouvet JM. CENAREST, IRAF Laboratoire de Biotechnologie végétale/gabon CIRAD UPR 39, BIOS BAILLARGUET/Montpellier FAO International technical conference of Agricultural Biotechnologie in Developing Countries (ABDC 10) Guadalajara, 1 4 March 2010
2 Summarize
3 Historical: Climate changes (Glacial and hot periods during pleistocene and Holocene) Restricted and expansion phases of species area ranges Bottleneck (reduction of gene diversity for many tree species) Contemporary : intensification of Human Activities (Agricultural, logging, urbanisation ), climate changes Disturbances in tree populations dynamic (spatial population structure, changes in gene flow.) Disturbances in landscape ( forest fragmentation, reduction of tree populations density.)
4 Conservation and preservation of plants genetic diversity Reforestation programs Seeds bank collections (diversificated gene pools) Specific Protected Areas Preservation of endangered species Sustainable forest management Appropriated Minimum logging diameter (Adults tree) Respect of logging cycles for forest plots (20 25 years) Certificated forest companies for logging (Economics statistics of logged wood, Forest plots logging planification )
5 How to implement efficiences Conservation and Sustainable forest Management programs if we do not understand how tree species work? We must know : Natural dynamics of Plant populations.!!! Climates changes and anthropogenics activities effects on it..!!!
6 III Genetic of populations as a tool for forest Conservation and Management asks? What about? Organisms are considered as genes and populations as gene pools. Main goals? Study genes movement inside and among populations through space and time : Estimate genetic structure, gene flow and spatial patterns of gene movement in different landscape and geographical sites among life stages, between cohorts.ect. Determinates ecologicals and biologicals traits that are linked to the genetic dynamic of plant populations. Issues and Recommandations for plants conservation and Forest Management Important insights to feed theoricals and biologicals models of simulations
7 III 1.Microsatellites Markers : An usefulltoolfor assessing spatial and genetics patterns of tree populations What about? Sequences of tandem, tri, or tetra repetitions of nucleotids acids localised in all organisms DNA. Two microsats differ by their tall: polymorphism of fragment lenght Two most Used : Nuclear (biparental) and chloroplast (maternal) microsats GAG GAG GAG GAG GAG GAG GAG GAG Main Caracteristics? High polymorphism : high power of segregation for individuals Good indicators of genetic diversity level Simple to use Even if not always simple to implement robust specific microsatellite markers banks (with many highly polymorphic markers). Usefull tools in most of Ecological and Biological studies!!!!!
8 What do we know about Genetic Dynamics of very weak tree species of the tropical rain Forest? B.toxisperma No genetic insights about..! Not enough..! nothing!!!!!! How work tropical tree species with very weak density? M.excelsa Asks: Did these species present the same observed patterns of genetic diversity distribution as dense species? 1 What is the level of genetic diversity of a rare tropical tree specie? 2 What are the spatial patterns of genetic diversity for these kind of species? Spatial Genetic Structure (SGS) Gene flow estimates (seeds, pollen, global)
9 Application with Baillonella toxisperma Pierre (Moabi): An endangered keystone specie of the tropical rain forest of congolese bassin (Central African Tree)
10 Baillonella Toxisperma, Sapotaceae Widespread,Weak density : 5 6 isolated Adult /km 2 One of the most large Guineo Congolese bassin forest tree (Old forest ): From South of Nigeria to Angola (Cabinda) Light demanding, Hermaphrodite, Entomophilous, Seeds Animal dispersed Regular fructification diameter = Minimum Logging Diameter (100 cm)..!!!!!!
11 Butter Fruits Isolated Adult tree Joinery Seedlings
12 Studied sites: Logging concession in Northwest of Gabon 247 Trees (Adults and Juveniles) 300 km 2 of Natural Forest Mean density : 2 Adults/Km 2
13 Materiels and Methods Molecular Biology Tools: 15 Nuclear microsatellites : na= chloroplast microsatellites: na= 2 5 Sequencing and genotyping Genetics of Populations softwares Spatial Autocorrelation methods Gene dispersal inference methods
14 1 What is the level of genetic diversity of B.toxisperma? 2 What are the spatial patterns of genetic diversity for these kind of species? Spatial Genetic Structure (SGS) Gene flow estimates (seeds, pollen, global)
15 Estimates of Genetic diversity parameters Nuclear Microsatellites: He nuc : 0.570, Similar to that of: The dense tropical tree specie A.klaineana (Burseraceae) (Born et al.2008) : He nuc = and one of the rare wind pollinated tropical tree M.excelsa (Moraceae)(Bizoux et al.2009): He nuc = Chloroplast Microsatellites :He cp : and na cp =12 High haplotype diversity (maternal lineages) for a little scale compared to many others trees as: Vitellaria paradoxa (Sapotaceae) (Fontaine et al.2004) : He cp : 0.71 and na cp =7 in its all natural range ( 12 Countries).
16 1 What is the level of genetic diversity of a rare tropical tree specie? 2 What are the spatial patterns of genetic diversity for these kind of species? A Spatial Genetic Structure (SGS) : How are genes organized in space? B Gene flow estimates (seeds, pollen, global)
17 Patterns of Spatial Genetic Structure (SGS) Marker b Ld S p Nuclear ** Chloroplast ** SGS: Kinship distance regression slope (b Ld ) show the Link between geographical distance and relatedness between pairwise individuals..!!!!!! Observed SGS : show more genetic similarities between neighbors than distant individuals: Structured spatial organization of genes (individuals) inside population (not due to hazard) Spatial extent (Sp) : SGS 5 times more stronger with chloroplast (haplotype) than nuclear, thus suggest restricted seeds dispersal compared to pollen.
18 1 What is the level of genetic diversity of a rare tropical tree specy? 2 What are the spatial patterns of genetic diversity for these kind of species? A Spatial Genetic Structure (SGS) : How are genes organized in space? B Gene flow estimates (seeds, pollen, global): How long are B. toxisperma genes dispersed
19 Inference of historical gene dispersals of pollen, seeds and global genes According to two effective densities (D e / 4 ;D e / 10 ) Global gene flow : σ g = km Seeds flow : σ s = 4 6.3Km Pollen flow : σ p = Km No common high gene dispersal events for an heavy diaspores tropical forest tree : probably due to efficient gene vectors
20 Guidelines for conservation and Forest Management
21 Milicia excelsa (Moraceae) Caracteristics: Low density : 10 Adults/km 2 Range : From Ivory Coast to Mozambic Dioecious, Light demanding Large tall, fleshy fruits Animal dispersed and one of the rare wind pollinated tropical tree Problem???? Intensively logged (one of the five) in Cameroon Poor regeneration Observation : M.excelsa stands declined in the last decades thus. threatened specie
22 Spatial genetic structure in Milicia excelsa (BIZOUX, DAINOU et al.2009) Experimentation: Sites: 4 natural populations in Cameroon Individuals : 287 Trees Molecular Tools: 8 nuclear microsatellites Results Genetic diversity : Nuclear Microsatellites: He nuc = Gene diversity similar to that of any tropical trees Spatial Genetic Structure (SGS): observed Spatial organization of gene Intensity of SGS: Sp=0.006, weak SGS compared to any others trees Global gene flow (both seeds and pollen) : σg = km, long gene dispersal events probably due to pollen flow mediated by wind...!!!! Detection of logging effect on 2 populations presenting a high inbreeding coefficient (Fis>0): Mating between relatives probably as a consequence of pollen limitations due to Selective Logging...!!!!!
23 Guidelines for conservation and Forest Management Note that an increasing inbreeding depression in species reduces gene diversity and seedlings fitness.!!!!, then For the 2 populations presenting a high breeding coefficient : Seed collection : collected seeds at least 10 20km from mothers tree (to avoid collecting related seeds or trees that represent a subset of genetic diversity!!!) Because of the observed extensive geneflow, no real risk of inbreeding effects, But Possibility to include reforestation programs with trees from different gene pools. For the 2 other populations (not presenting a Fis>0) guidelines for seeds bank can be the same to that of B.toxisperma..!!!!!
24 Futures for B.toxisperma Genetic studies 1 Spatial Genetic structures of B.toxisperma populations situated in the both sides of the Equator line (Gabon vs Cameroon) (Study in progress). 2 Impact of logging in spatial patterns of gene diversity with B.toxisperma: Parentage analysis, contemporary vs historical geneflow (Study in progress).
25 Biological and Ecological asks From Empirical observations, Published Papers Use of Genetic of Populations Spatial and temporal evolution of Genetic structure inside populations (among cohorts) Changes in Spatial patterns of gene diversity (gene flow ) Results: robust indicators of Human and Ecological disturbances with diversificated scientific insights Issues and Recommendations Feeding Theoricals prediction Models, Bioinformatic Simulations Efficient decisions for Conservation and Forest Management
26 Thank for your attention!!!!
Mediterranean forest genetic diversity and adaptive conservation strategies
Mediterranean forest genetic diversity and adaptive conservation strategies Aristotelis C. Papageorgiou Forest Genetics Laboratory Democritus University of Thrace Orestiada, Greece Genetic component of
Seed Dispersal in Tropical Forests
INTRODUCTION The goal of this activity is to use concepts of plant dispersal mechanisms to better understand how plants are distributed. A second goal is to make predictions about how forest fragmentation
Gene Flow and Paternity Analysis. Oct 6, 2006
Gene Flow and Paternity Analysis Oct 6, 2006 Last Time Variation among populations: F- statistics Indirect estimates of gene flow Today Lab recap More about indirect measures of gene flow Direct measures
b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
FOREST GENETICS. The role of genetics in domestication, management and conservation of forest tree populations
FOREST GENETICS The role of genetics in domestication, management and conservation of forest tree populations Yousry A. El-Kassaby y.el-kassaby@ubc.ca Department of Forest and Conservation Sciences Forest
Genomic Selection in Breeding Programs BIOL 509 November 26, 2013
Genomic Selection in Breeding Programs BIOL 509 November 26, 2013 Omnia Ibrahim omniyagamal@yahoo.com 1 Outline 1- Definitions 2- Traditional breeding 3- Genomic selection (as tool of molecular breeding)
Why do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
The Evolution of Populations
The Evolution of Populations Population genetics Population: a localized group of individuals belonging to the same species Species: a group of populations whose individuals have the potential to interbreed
Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?
Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies
Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
Evolution of Populations (Ch. 17)
Evolution of Populations (Ch. 17) Doonesbury - Sunday February 8, 2004 Beak depth of Beak depth Where does Variation come from? Mutation Wet year random changes to DNA errors in gamete production Dry year
Mapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
University of York Department of Biology B. Sc Stage 2 Degree Examinations
Examination Candidate Number: Desk Number: University of York Department of Biology B. Sc Stage 2 Degree Examinations 2016-17 Evolutionary and Population Genetics Time allowed: 1 hour and 30 minutes Total
Genetic Implications of Forest Management in the Mediterranean
Genetic Implications of Forest Management in the Mediterranean Aristotelis C. Papageorgiou Department of Forestry, Environment and Natural Resources, Democritus University of Thrace, Greece Solsona 2004
5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations
Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.
Marginal and peripheral forests: a key genetic resource for enhancing the resilience of European forests to global change
FPS COST Action FP1202 Policy Brief Marginal and peripheral forests: a key genetic resource for enhancing the resilience of European forests to global change Global environmental change, and particularly
Use of molecular markers to enhance genetic gains in the maritime pine breeding program
Use of molecular markers to enhance genetic gains in the maritime pine breeding program Laurent Bouffier, Marjorie Vidal, Jérôme Bartholomé, Christophe Boury, Annie Raffin, Christophe Plomion IUFRO Conference
Comparative genetic structure of two mangrove species in Caribbean and Pacific estuaries of Panama
Cerón-Souza et al. BMC Evolutionary Biology 2012, 12:205 RESEARCH ARTICLE Open Access Comparative genetic structure of two mangrove species in Caribbean and Pacific estuaries of Panama Ivania Cerón-Souza
Questions we are addressing. Hardy-Weinberg Theorem
Factors causing genotype frequency changes or evolutionary principles Selection = variation in fitness; heritable Mutation = change in DNA of genes Migration = movement of genes across populations Vectors
Tropical Forestry Volumes Already Published in this Series
Tropical Forestry Tropical Forestry Volumes Already Published in this Series Tropical Forest Genetics by Finkeldey, R., Hattemer, H. 2007 ISBN: 3-540-37396-9 Sampling Methods, Remote Sensing and GIS Multiresource
Caribbean forested wetlands-pterocarpus officinalis forests as models to understand wetlands in light of expected changes in sea level
Caribbean forested wetlands-pterocarpus officinalis forests as models to understand wetlands in light of expected changes in sea level Elsie Rivera Ocasio 1, Neftalí Rios López 1, Amadou Bâ 2 and Tamara
Climate change and forest genetic resources (FGR): state of knowledge, risks and opportunities
Climate change and forest genetic resources (FGR): state of knowledge, risks and opportunities Bruno Fady INRA URFM, Ecologie des Forêts Méditerranéennes, Avignon Judy Loo, Ian Dawson, Barbara Vinceti
Genetics: Results, experiences and challenges with large-scale genetic inventories of trees as basis for timber tracking Bernd Degen
Genetics: Results, experiences and challenges with large-scale genetic inventories of trees as basis for timber tracking Bernd Degen Thünen-Institute of Forest Genetics, Germany bernd.degen@thuenen.de
Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat
Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,
Genetic diversity in Eucalyptus globulus is affected by hybridisation with the rare species Eucalyptus cordata
Genetic diversity in Eucalyptus globulus is affected by hybridisation with the rare species Eucalyptus cordata Gay McKinnon, Brad Potts School of Plant Science, University of Tasmania Natural hybridisation
Genetic methods and landscape connectivity
Workshop ECONNET; 4 au 7 novembre 2009; Grenoble Genetic methods and landscape connectivity Stéphanie Manel Laboratoire Population Environnement Développement, Université de Provence, Marseille Landscape
Jon Degner PhD candidate Centre for Forest Conservation Genetics University of British Columbia
Molecular methods in forestry: From seeds to trees Connections Through Seed Surrey, BC 17 October, 2018 Jon Degner PhD candidate Centre for Forest Conservation Genetics University of British Columbia jonathan.degner@ubc.ca
Molecular tools to assess genetic diversity: Examples. from temperate and tropical forests. Reiner Finkeldey. Freiburg, Workshop Oct 2009
Freiburg, Workshop Oct 2009 Molecular tools to assess genetic diversity: Examples from temperate and tropical forests Reiner Finkeldey 1 Outline/objectives 2 Presentation for workshop Objectives (here:
Introduction. Materials and Methods
Chapter 5: Preliminary investigation of chloroplast variation in three Tasmanian endemic cool temperate rainforest plants: Olearia persoonioides (Asteraceae), Phyllocladus aspleniifolius (Podocarpaceae)
Diversität und Differenzierung mitteleuropäischer Eichen
Diversität und Differenzierung mitteleuropäischer Eichen Nachhaltige Bewirtschaftung flexibler Arten Jutta Buschbom Aki Höltken Bernd Degen Céline Jolivet Birgit Kersten Heike Liesebach Hilke Schröder
Chapter 3: Evolutionary genetics of natural populations
Chapter 3: Evolutionary genetics of natural populations What is Evolution? Change in the frequency of an allele within a population Evolution acts on DIVERSITY to cause adaptive change Ex. Light vs. Dark
A Primer of Ecological Genetics
A Primer of Ecological Genetics Jeffrey K. Conner Michigan State University Daniel L. Hartl Harvard University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface xi Acronyms,
DRAFT FOR CONSIDERATION AT THE APRIL 27, 2006 MEETING OF NATURAL RESOURCES COMMITTEE OF THE HIGHLANDS COUNCIL
RMP Component: Resource Assessment / Ecosystem Assessment Technical Report: Forest Integrity Council Committee: Natural Resource Committee Memorandum Title: Technical Approach to Define Highlands Forest
Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs
Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs Luis Hurtado, Isabel Caballero, Danielle Macedo, Mariana Mateos It is important
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
5 FINGERS OF EVOLUTION
MICROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Microevolution refers to changes in allele frequencies in a population over time. NATURAL SELECTION
High-density SNP Genotyping Analysis of Broiler Breeding Lines
Animal Industry Report AS 653 ASL R2219 2007 High-density SNP Genotyping Analysis of Broiler Breeding Lines Abebe T. Hassen Jack C.M. Dekkers Susan J. Lamont Rohan L. Fernando Santiago Avendano Aviagen
TITLE: Refugia genomics: Study of the evolution of wild boar through space and time
TITLE: Refugia genomics: Study of the evolution of wild boar through space and time ESF Research Networking Programme: Conservation genomics: amalgamation of conservation genetics and ecological and evolutionary
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS Summer Methods in Plant Biology: Breeding with Molecular Markers Lecture 1. This course, breeding with molecular markers, will examine the role of marker assisted selection or genome assisted selection
Module 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
Impact of selective logging on inbreeding and gene dispersal
Molecular Ecology (2006) doi: 10.1111/j.1365-294X.2006.03193.x Impact of selective logging on inbreeding and gene dispersal Blackwell Publishing Ltd in an Amazonian tree population of Carapa guianensis
Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
Population Genetics. If we closely examine the individuals of a population, there is almost always PHENOTYPIC
1 Population Genetics How Much Genetic Variation exists in Natural Populations? Phenotypic Variation If we closely examine the individuals of a population, there is almost always PHENOTYPIC VARIATION -
Genetic Variation. Genetic Variation within Populations. Population Genetics. Darwin s Observations
Genetic Variation within Populations Population Genetics Darwin s Observations Genetic Variation Underlying phenotypic variation is genetic variation. The potential for genetic variation in individuals
DEDICATIONS. To the people who have inspired and sustained me throughout my life: Mom, Dad, Mary, Dorothy, Suzie and Antonio. TW
FOREST GENETICS DEDICATIONS To the people who have inspired and sustained me throughout my life: Mom, Dad, Mary, Dorothy, Suzie and Antonio. TW To Cathy, Christine, Michael, Patrick, Neal, Kenda, Halli,
West Africa Centre for Crop Improvement. New Four Year Ph D Programme In Plant Breeding f or West Africa Centre For Crop Improvement
West Africa Centre for Crop Improvement New Four Year Ph D Programme In Plant Breeding f or West Africa Centre For Crop Improvement Introduction The West Africa Centre for Crop Improvement (WACCI), a partnership
An Introduction to Population Genetics
An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 3 Population Genetics Nicholas Wheeler & David Harry Oregon
Mechanisms of succession and regeneration
Mechanisms of succession and regeneration Outline: Mechanisms of succession and vegetation dynamics. Synthetic concepts and simple models of forest dynamics Overview of the modern conceptual framework
POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
CMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
Canopy Structure, and Leaf area, are fundamental features of the landscape. We can t really understand the plant-atmosphere interactions without
Canopy Structure, and Leaf area, are fundamental features of the landscape. We can t really understand the plant-atmosphere interactions without knowing how much vegetation is on the surface. 1 Plants
Population Structure and Gene Flow. COMP Fall 2010 Luay Nakhleh, Rice University
Population Structure and Gene Flow COMP 571 - Fall 2010 Luay Nakhleh, Rice University Outline (1) Genetic populations (2) Direct measures of gene flow (3) Fixation indices (4) Population subdivision and
FLORIDA STATEWIDE ENDANGERED AND THREATENED PLANT CONSERVATION PROGRAM
Rare Plant Conservation Projects funded for 2017-18 (taken from annually submitted APPLICATION FOR FEDERAL ASSISTANCE- WORK PLAN 2017-2018, submitted to United States Fish and Wildlife Service from Florida
The Modern Synthesis. Terms and Concepts. Evolutionary Processes. I. Introduction: Where do we go from here? What do these things have in common?
Evolutionary Processes I. Introduction - The modern synthesis Reading: Chap. 25 II. No evolution: Hardy-Weinberg equilibrium A. Population genetics B. Assumptions of H-W III. Causes of microevolution (forces
A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
Initiatives for improving productivity in Southern Pine plantations. IFA Plantation Productivity Symposium Mt Gambier 12 May 2014
Initiatives for improving productivity in Southern Pine plantations IFA Plantation Productivity Symposium Mt Gambier 12 May 2014 Background HQPlantations sold by Queensland State Government to institutional
Bertrand Gauffre, Sophie Mallez, Marie-Pierre Chapuis, Raphael Leblois, Isabelle Litrico, Sabrina Delaunay, Isabelle Badenhausser
Spatial heterogeneity in landscape structure influences dispersal and genetic structure: empirical evidence from a grasshopper in an agricultural landscape Bertrand Gauffre, Sophie Mallez, Marie-Pierre
Linkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
Exam 3 4/25/07. Total of 7 questions, 100 points.
Exam 3 4/25/07 BISC 4A P. Sengupta Total of 7 questions, 100 points. QUESTION 1. Circle the correct answer. Total of 40 points 4 points each. 1. Which of the following is typically attacked by the antibody-mediated
Landscape genetic analysis and population structure of three sympatric amphibians in managed redwood forest of northwestern California
1 Landscape genetic analysis and population structure of three sympatric amphibians in managed redwood forest of northwestern California Cindy Castaneda, CSU Los Angeles February 10, 2014 - February 10,
2017 present FCT Postdoctoral Fellow. Centre for Applied Ecology Prof. Baeta Neves. Instituto Superior de Agronomia (ISA). (Advisors: Jose Fedriani)
ANTONIO R. CASTILLA Centre for Applied Ecology Prof. Baeta Neves Instituto Superior de Agronomia (ISA) Universidade de Lisboa Tapada da Ajuda, 1349-017 Lisbon, Portugal Phone: + 351 21 3653333 Fax: + 351
Wolf population genetics in Europe
Wolf population genetics in Europe A systematic review, meta-analysis and suggestions for conservation and management Hindrikson et al. 2016 Introduction Wolf, once a threat, nowdays apex predator Conservation
Using genetic markers in analyses of natural populations
Using genetic markers in analyses of natural populations Mark P. Miller U.S. Geological Survey Forest and Rangeland Ecosystem Science Center 3200 SW Jefferson Way Corvallis, OR 97331 MIGRATE Student Eperience
JEMU call for proposals 2016
JEMU call for proposals 2016 THE JOINT EXPERIMENTAL MOLECULAR UNIT (JEMU) Established in 2007 Royal Belgian Institute of Natural Sciences (RBINS) Royal Museum for Central Africa (RMCA) Mission: supporting
The Theory of Evolution
The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same
Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon
Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon Nahla Bassil 1, Michael Dossett 2, Vidyasagar Sathuvalli 2, Chad Finn
Computational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
Linkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
Exam 1, Fall 2012 Grade Summary. Points: Mean 95.3 Median 93 Std. Dev 8.7 Max 116 Min 83 Percentage: Average Grade Distribution:
Exam 1, Fall 2012 Grade Summary Points: Mean 95.3 Median 93 Std. Dev 8.7 Max 116 Min 83 Percentage: Average 79.4 Grade Distribution: Name: BIOL 464/GEN 535 Population Genetics Fall 2012 Test # 1, 09/26/2012
Glacial Refugia: Hot Spots But Not Melting Pots of Genetic Diversity. By Remy J. Petit et al.
Glacial Refugia: Hot Spots But Not Melting Pots of Genetic Diversity By Remy J. Petit et al. Fossil pollen data and macrofossil remains have indicated several small areas in the Iberian, Italian, and Balkan
Whole Genome-Assisted Selection. Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist
Whole Genome-Assisted Selection Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics UC Davis alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/
DEPARTMENT OF PLANT BREEDING AND GENETICS
DEPARTMENT OF PLANT BREEDING AND GENETICS Course No. PBG 511 (Principles of Genetics and Cell Biology ) Cr. Hr. 3(2+1) Teacher Dr. D.K.Gothwal 16 5.10.15 Extra chromosomal inheritance 17 6.10.15 Concepts
Distinguishing Among Sources of Phenotypic Variation in Populations
Population Genetics Distinguishing Among Sources of Phenotypic Variation in Populations Discrete vs. continuous Genotype or environment (nature vs. nurture) Phenotypic variation - Discrete vs. Continuous
Adaptive genetic variation within and among populations. Kathleen O Malley Associate Professor, OSU 2017 Annual Meeting Genetics Workshop
Adaptive genetic variation within and among populations Kathleen O Malley Associate Professor, OSU 2017 Annual Meeting Genetics Workshop Structure i. Concept Genetic diversity - neutral and adaptive ii.
Ami E. Wilbur Shellfish Research Hatchery Department of Biology & Marine Biology Center for Marine Science University of North Carolina Wilmington
Ami E. Wilbur Shellfish Research Hatchery Department of Biology & Marine Biology Center for Marine Science University of North Carolina Wilmington What do we mean by restoration? Variety of activities
B. Incorrect! 64% is all non-mm types, including both MN and NN. C. Incorrect! 84% is all non-nn types, including MN and MM types.
Genetics Problem Drill 23: Population Genetics No. 1 of 10 1. For Polynesians of Easter Island, the population has MN blood group; Type M and type N are homozygotes and type MN is the heterozygous allele.
The Role of Pollen and Pollinators in Long-term Conservation Strategies of Plant Genetic Resources
The Role of Pollen and Pollinators in Long-term Conservation Strategies of Plant Genetic Resources Jan Engels and Ehsan Dulloo Genetic Resources Management Advisor Bioversity International Rome, Italy
LECTURE 1 : GENETICS
LECTURE 1 : GENETICS Introduction to Genetics and heredity Gregor Mendel Genetic terminology (glossary) Monohybrid crosses Patterns of inheritance Dihybrid crosses Test cross Introduction to Genetics GENETICS
Summary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
Allegheny-Clarion Valley School District
Allegheny-Clarion Valley School District Jr./Sr. High School Name of Course: Ecology Grade Level: 9-12 Persons Writing/Revising Curriculum: Joni Runyan Laura Jamison *** Created 2015-16 School Year Unit
Requirements on wood raw material used in IKEA products
Issued By: Approved By: Date: Edition: IKEA Supply AG INGKA Holding B.V. 2010.06.02 5 IWAY Standard: Forestry Section Scope and contents This document applies to all virgin wood fiber contained in solid
Summary for BIOSTAT/STAT551 Statistical Genetics II: Quantitative Traits
Summary for BIOSTAT/STAT551 Statistical Genetics II: Quantitative Traits Gained an understanding of the relationship between a TRAIT, GENETICS (single locus and multilocus) and ENVIRONMENT Theoretical
B7 Quick Revision Questions
B7 Quick Revision Questions H = Higher tier only SS = Separate science only Question 1... of 50 What type of variation is due to differences that arise during development? Answer 1... of 50 Environmental
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
RANDOM FORESTS OF FORESTS:
RANDOM FORESTS OF FORESTS: integrating data sources to combat illegal logging Rich Cronn 1, Kristen Finch 2, Ed Espinoza 3, Andy Jones 2 1 Pacific Northwest Research Station, US Forest Service, Corvallis,
Wild service tree Sorbus torminalis
Technical guidelines for genetic conservation and use Wild service tree Sorbus torminalis EUFORGEN B. Demesure-Musch and S. Oddou-Muratorio INRA, Genetic Conservation of Forest Trees ONF, Olivet, France
Testing Criteria and Indicators forassessing the Sustainability of Forest Management: Genetic Criteria and Indicators
WORKING PAPER NO. 10 CIFOR CENTER FOR INTERNATIONAL FORESTRY RESEARCH Jul 1996 Testing Criteria and Indicators forassessing the Sustainability of Forest Management: Genetic Criteria and Indicators Gene
Crash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
Name Class Date. a. identify similarities and
Chapter 13 enetic Engineering Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Selective breeding produces a. more offspring.
COMPREHENSIVE MOLECULAR GENETIC CHARACTERIZATION AMONG WEST
COMPREHENSIVE MOLECULAR GENETIC CHARACTERIZATION AMONG WEST AFRICA AND BRAZIL LOCALLY ADAPTED POULTRY BREEDS: CREATION OF A BASIS FOR GERMPLASM EXCHANGE Report Call For Report Call for final report Africa-Brazil
AN EVALUATION OF POWER TO DETECT LOW-FREQUENCY VARIANT ASSOCIATIONS USING ALLELE-MATCHING TESTS THAT ACCOUNT FOR UNCERTAINTY
AN EVALUATION OF POWER TO DETECT LOW-FREQUENCY VARIANT ASSOCIATIONS USING ALLELE-MATCHING TESTS THAT ACCOUNT FOR UNCERTAINTY E. ZEGGINI and J.L. ASIMIT Wellcome Trust Sanger Institute, Hinxton, CB10 1HH,
Progress Report on UC Riverside Asparagus Breeding Program
Progress Report on UC Riverside Asparagus Breeding Program M. L. Roose and N. K. Stone Department of Botany and Plant Sciences University of California, Riverside CA 92521 October, 2008 The overall objective
STAT 536: Genetic Statistics
STAT 536: Genetic Statistics Karin S. Dorman Department of Statistics Iowa State University August 22, 2006 What is population genetics? A quantitative field of biology, initiated by Fisher, Haldane and
The Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Summary report of the Pine Wilt Disease Conference October 15 18, 2013 in Braunschweig, Germany
Summary report of the Pine Wilt Disease Conference October 15 18, 2013 in Braunschweig, Germany co-organized by the IUFRO and the REPHRAME Project Hervé JACTEL umr BIOGECO INRA Bordeaux Dominique PIOU
Tree Improvement: An International Perspective and Opportunities for the U.K.
Tree Improvement: An International Perspective and Opportunities for the U.K. John MacKay ICF Annual Conference - 27 April 2016 Productivity Diversity Sustainability Tree Improvement Productive Forestlands
Population Genetics, Systematics and Conservation of Endangered Species
Population Genetics, Systematics and Conservation of Endangered Species Discuss Population Genetics and Systematics Describe how DNA is used in species management Wild vs. Captive populations Data Generation:
Module 20: Population Genetics, Student Learning Guide
Name: Period: Date: Module 20: Population Genetics, Student Learning Guide Instructions: 1. Work in pairs (share a computer). 2. Make sure that you log in for the first quiz so that you get credit. 3.