The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The

Similar documents
Nature Biotechnology: doi: /nbt.4086

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Supplementary Figure 1 (Page1)

Supplementary Methods

15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.

The presence of T cell epitopes is important for induction of antibody

Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors

isolated from ctr and pictreated mice. Activation of effector CD4 +

Supporting Information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

Supplementary Material & Methods

Table S1. Antibodies and recombinant proteins used in this study

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

In vitro DC migration assays and DC activation. A DC line, JAWSII (ATCC, Manassas, VA) was used for in vitro experiments

Female 6-7-week-old BALB/c mice were purchased from Japan SLC (Hamamatsu, Japan).

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x

Supplementary Table S1

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA

Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer

Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity

7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.

Supplementary Materials & Methods

Supplemental methods Supplemental figure and legend...7. Supplemental table.. 8

Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar *

In vivo amelioration of endogenous anti-tumor autoantibodies via low-dose P 4 N through. the LTA4H/activin A/BAFF pathway

Human Astrocytes. ohsv (MOI)

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression

Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.

CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire

SUPPORTING INFORMATION

Supplementary Figure. S1

Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads

Murine in vivo CD8 + T Cell Killing Assay Myoungjoo V. Kim 1*, Weiming Ouyang 2, Will Liao 3, Michael Q. Zhang 4 and Ming O. Li 5

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

Supplemental Figure 1

Murine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells

SUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as

Supplemental Materials and Methods

Supplementary Figures

Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide

Supplementary methods. RNA isolation, cdna synthesis, and quantitative real-time PCR. Total RNAs were

ab pdc Subset Phenotyping Kit

Supplementary Materials for

Supporting Information

A human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3

Supplemental Table 1 Primers used in study. Human. Mouse

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers

SANTA CRUZ BIOTECHNOLOGY, INC.

Human skin punch biopsies were obtained under informed consent from normal healthy

Supplemental Information Inventory

Tumor-infiltrating dendritic cells suppress nucleic acid-mediated. innate immune responses through TIM-3-HMGB1 interactions

Establishing sirna assays in primary human peripheral blood lymphocytes

Supplemental Methods Cell lines and culture

PITT ISL METHODS 1) Flow-based CTL assay 2) Gut Mucosal Processing

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

SUPPLEMENTARY INFORMATION

Supplementary Materials and Methods:

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

Dendritic epidermal T cells regulate skin antimicrobial barrier function

Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume.

Supplementary Table-1: List of genes that were identically matched between the ST2 and

Initial genotyping of all new litters was performed by Transnetyx (Memphis,

Supplementary Figure 1

Figure S1. Correlated scfv and GFP transgene expression following F-28 CAR

CFSE Cell Division Assay Kit

Supplementary Figure 1

Online Supplementary Information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

Supplemental Figure 1. Study flow chart.

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

efluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Generation of mouse BMDCs Vectors Short hairpin RNA constructs cdna constructs and generation of stable cell lines

Nature Immunology: doi: /ni Supplementary Figure 1

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were

Primer Name Sequence (Forward) Sequence (Reverse) GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG ORF73/LANA CCTGGAAGTCCCACAGTGTT AGACACAGGATGGGATGGAG

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

SUPPLEMENTARY INFORMATION

TRIM31 is recruited to mitochondria after infection with SeV.

BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone

Supplementary Materials for

Supplementary Information

Flow Cytometry SOP: Monocytes from Frozen Cells

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

Transcription:

SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM (Life Technologies) in 96-well format. The reactions were performed using fast SYBR Green PCR Master Mix (Life Technologies). IRF7 primer sequence, 5 -aagaccaacttccgctgtgc-3 (sense) and 5 - agcattgctgaggctcactt-3 (antisense); Oas3 primer sequence, 5 -tcattgacctcaaccatgat-3 (sense) and 5 -agatgccagggaggagtatg-3 (antisense). Primer sequences were chosen with the software Primer3 (http://primer3.sourceforge.net/) to detect 3 type-i IFNs related genes. The overall PCR product size was smaller than 200 bases. ELISA assay Mouse IFN-αexpression levels in sera from mice treated with irllc/sev/gm cells or irllc/sev/gm cells plus imiquimod were measured using the VeriKineTM mouse IFNα ELISA kit (PBL Interferon-Source, Piscataway, NJ).

In vivo experiments For prophylactic tumor vaccination assays, on day 11 before tumor challenge with 2.0 10 5 parental LLC cells in the right flank, C57/BL6N mice were s.c. vaccinated with the one million of the indicated tumor vaccine cells (irllc, irllc/sev/gfp or irllc/sev/gm cells) in the left flank. Subcutaneous tumor growth was monitored with a digital caliper every 2-3 days. Flow cytometric analysis On days 2 and 4 after tumor challenge with LLC cells, TDLNs harvested from the indicated groups of mice (n=3-5) were homogenized by mincing in RPMI 1640 medium containing 10% FBS and filtered through a 100-µm cell strainer. Cells were stained with an anti-mouse CD11c antibody in combination with anti-mouse antibodies including anti-mhc class I-PE (28-14-8) (ebioscience, San Diego, CA), anti-cd40-pe (3/23), anti-i-a/i-e-fitc (M5.114.15.2), or anti-ccr7-alexa488 (4B12) (all Biolegend) at a dilution of 1:25-1000 for 30 min. At 24 hours after 2 nd i.p. administration of anti-mouse PDCA-1 antibody, we harvested splenocytes and treated them with ammonium chloride

to lyse red blood. For pdcs detection, splenocytes were stained with anti-pdca-1-apc (JF05-1C2.4.1) (Miltenyi Biotec, Bergisch Gladbach, Germany) and anti-cd11c-percpcy5.5 (N418) (ebioscience). Cells were incubated with antibodies diluted at 1:25 to 1,000 for 30 min on ice and analyzed with BD FACSCalibur flow cytometer, CellQuest software (BD Biosciences), and FlowJo software (Tree star, Ashland, OR).

SUPPLEMENTARY FIGURE LEGENDS Figure S1. Effective depletion of PDCA-1 + cells in mouse splenocytes. Dot plots depict PDCA-1 and CD11c expression on splenocytes in mice treated with isotype (left panel) or anti-pdca-1 antibody (right panel). Figure S2. Validation of gene expression data by quantitative real time PCR. Each column represents the relative amount of mrnas expression level of IRF7 and Oas3. Figure S3. Effects of TLR ligands on body weight changes in mice s.c. treated with LLC/SeV/GM cells. Bar graph represents mean+sem of body weight of each experimental mouse group as indicated in Fig. 4A.

Figure S4. Increased number of TVS-infiltrating PDCA-1 + cells in mice treated with combined irllc/sev/gm cells and imiquimod. At 6 hours after the first tumor vaccination, infiltrating lymphocytes in TVS were as indicated in Fig. 5A. Bar graphs show mean+sem of number of PDCA-1 + cells in TVS. Figure S5. Increased serum IFN-α level in mice treated with combined irllc/sev/gm cells and imiquimod. IFN-α expression levels in mice sera at 6 hours after the first tumor vaccination, were measured by ELISA. Combined data from two independent experiments with similar results are shown. Figure S6. Prophylactic tumor vaccination using irllc/sev/gm cells induced significant

antitumor effects in a syngeneic mouse model. On day 11 before s.c. tumor challenge with 2.0 10 5 parental LLC cells in the right flank of female C57/BL6N mice, mice were s.c. inoculated with HBSS (untreated), 1.0 10 6 irllc cells, irllc/sev/gfp (MOI=100) cells or irllc/sev/gm (MOI=100) cells. Statistically significant difference on day 24 after the tumor challenge is shown between mice treated with irllc/sev/gm cells and other mice groups (*P < 0.05, **P < 0.01). Figure S7. Enhanced expression levels of maturation and co-stimulatory molecules including CCR7, CD40, MHC class I, and MHC class II in tumor cells-derived GM-CSF-sensitized DCs in TDLNs Representative histograms depict MFI of CCR7, CD40, MHC class I, or MHC class II expression, in CD11c + DCs in TDLNs from indicated mouse groups collected on days 2 or 4 after tumor challenge.