Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed among 23 pairs of chromosomes Only about 90 million base pairs of the human genome (about 3%) are actually genes The rest of the genome consists of non-coding sequences such as Long Interspersed repeats (LINEs), like the old retrovirus that codes for reverse transcriptase in Alu, SINEs (like Alu itself), STRs (Short Tandem Repeats) also called microsatellites, and VNTRs (Variable Number of Tandem Repeats) also known as minisatellites Indeed, in Chapter 1, we discussed the estimation that over 10% of our DNA is composed simply of Alu SINE inserts Figure 1 Amplification of VNTRs and STRs from mother and father using PCR Boxes indicate repeat number Comparing human genomes, the similarities are striking; less than 01 % (about 3 million bases) differs from one person to the other These variable differences tend to be concentrated in "variable regions" Forensic scientists use these variable regions as genetic markers to generate a DNA profile (a genetic bar code) of an individual, using samples from blood, bones, hair, or any other body tissues or products that contain inteact cells with DNA The two main types of human genomic DNA sequences that are used in the applications for DNA profiling are minisatellite DNA and microsatellite DNA Minisatellites have core repeats with 9-80 bp, while microsatellites contains 2-5 bp repeats These sequences are widespread throughout the human genome and show sufficient variability (polymorphism) among individuals in a population due to differences in the number of the core repeats Variable Number of Tandem Repeats (VNTR) DNA profiling uses the variability in the number of tandemly repeated copies in minisatellites, while Short Tandem Repeats (STR) DNA profiling uses microsatellites The DNA forensic community has moved toward the use of STRs for its greater fidelity Click Here Figure 2 Dolan DNA interactive website DNA fingerprinting flash animation
and reproducibility STRs are amplified using polymerase chain reaction using a set of primers that flank the STR loci The gels will reflect the number of repeats in the two chromosomes As both chromosomes originate from different parents, two different lengths of product may result from one set of primers (Figure 1) You can see an example of how this works at: http://wwwdnaiorg/d/indexhtml At the bottom left, click on human identification, then on the top left, click on profiling You should get a screen like Figure 2 Click on the circle with the two peaks in it and it should take you to a modern DNA fingerprinting flash animation As a 2-5 bp difference in length should be distinguished, we utilize polyacrylamide (rather than agarose) gels for separation of the PCR products, just as we did in sequencing A genetic profile Figure 3 FBI CODIS "bar code" that reflects the genomic variability of an individual can be examined using multiple STRs The Federal Bureau of Investigations (FBI) adopted the use of 13 loci to constitute the core of the United States CODIS (Combined DNA Index System) database (Figure 3) In addition to the nuclear DNA (nudna), the cell contains mitochondria (mtdna) Forensic scientists typically turn to mtdna STR analysis to determine possible maternal relationships, or if there is only a limited amount of specimen available This is because in humans, all mitochondria are inherited from the mother and there are hundreds of them in each cell Refer to Appendix I for an example on DNA profile probability calculations In this experiment, you use your own DNA from the sample of cheek cells you collected by saline mouthwash in lab 1 A PCR reaction is then performed on the DNA using multiple primers (multiplex PCR) to amplify four separate STRs on different chromosomes simultaneously The lengths of the PCR products are then analyzed on a polyacrylamide gel A DNA size marker is included as a size reference Figure 4 Automated Genotype generated by using fluorescent primers on an ABI 377 automated DNA sequencer The Profiler plus ladder is very similar to the 100kb ladder we use in experiment 1 Norma is homozygous with 15 repeats for D351358 and heterozygous for the vwa locus with 14 and 16 repeats and heterozygous for the FGA locus with 24 and 25 repeats The resolving power of polyacrylamide gels is larger than of agarose gels, and they can reliably separate DNA molecules whose
lengths differ by 1% The 10% polyacrylamide gel used in this experiment allows separation of fragments that differ by 3-4 bases Polyacrylamide gels are much thinner than agarose gels (to improve resolution) and are poured in between two glass plates to avoid differences in thickness The FBI uses sophisticated DNA automated profiler machines that can determine the genotype of an individual in a matter of a few hours (Figure 4) Refer to Table 1 and Table 2 for information on the loci that will be amplified in this experiment Table 1 Locus Chromosome Repeat Structure Repeat # Genbank accession number D7S820 7 GATA 5-15 G08616 CSF1PO 5 AGAT 6-16 X1420 Y-GATA- H4 Y (TAGAATGGATAGATT A (GATG)pAA(TAGA)q HUMTH01 11 TCAT 3-14 D00269 Human genome database * G42676 AC011751 * Repeat numbers are not clearly defined Table 2 Locus Forward primer Reverse primer D7S820 5'GTCATAGTTTAGAACGAACTAACG3' 5'CTGAGGTATCAAAAACTCAGAGG3' CSF1PO 5'CTGAGTCTGCCAAGGACTAGC3' 5'CACACACCACTGGCCATCTTC3' Y-GATA-H4 5'CCTAAGCAGAGATGTTGGTTTTC3' 5'CTGATGGTGAAGTAATGGAATTAG3' HUMTH01 5'GTGGGCTGAAAAGCTCCCGAT3' 5'CAAAGGGTATCTGGGCTCTGG3' Materials 10% Chelex P20, P200, P1000 and tips 09% NaCl 15 ml culture tubes PCR mix Mineral oil Disposable gloves Paper cup ddh 2 O 100 C water bath Ice 15 ml tubes 05 ml PCR tubes Boiling water bath DNA thermal cycler Forceps Procedure Note: if you already have ample DNA from experiment number 1, you can skip the DNA isolation protocol and go straight to PCR
DNA Isolation from Cheek Cells PCR Collecting cheek cells 1 Label a 15 ml culture tube containing saline solution with your name Pour all the solution into your mouth and save the empty tube Vigorously swish the saline solution in your mouth for 10 seconds 2 Release the saline solution from your mouth into a paper cup, then carefully transfer into the labeled 15 ml culture tube 3 Place the cap on the culture tube, and pellet the cells by centrifuging in a balanced clinical centrifuge for 10 minutes at maximum speed 4 Carefully discard the supernatant (you may want to pipet 15 times with a P1000 if you feel the pellet is loose) making sure not to disturb the pellet, and then place the tube on ice Binding metal ions that inhibit PCR 1 Add 500 µl of 10% Chelex (a chelating resin) to the cell pellet, and resuspend the cell pellet by pipetting in and out several times Complete resuspension is essential for obtaining a good yield of DNA and for a successful PCR 2 Transfer the well-suspended cells into a 15 ml microcentrifuge tube Cell lysis 1 Incubate the cells in a boiling water bath for 10 minutes 2 Cool the tube containing the mixture by incubating it on ice for 1 minute 3 Centrifuge the sample in a microcentrifuge for 30 seconds to pellet the Chelex beads 4 Transfer 200 µl of the supernatant into a fresh microcentrifuge tube, being careful not to transfer any Chelex beads, and label it with your name 1 (Prepared by TAs) The PCR mixture contains the following: Forward and reverse primers for 4 different loci 20 pmoles/µl (see Table 2) 8 µl ddh 2 O 305 µl Taq polymerase 250 units/µl 05 µl dntp 10 mm (each nucleotide) 10 µl 10X PCR buffer (500 mm KCl; 100 mm Tris-HCl (ph 83); 15 mm MgCl 2 ) 50 µl 2 Label a microcentrifuge tube, which contains the PCR mix, with your name 3 Add 5 µl of the DNA that was extracted from the cheek cells to the PCR mixture 4 Mix the sample by pipetting the total volume in and out a couple of times 5 Place the sample in the PCR machine that was set to the following parameters: 1 94 C for 3 minutes 2 94 C for 1 minute 3 58 C for 1 minute 4 72 C for 1 minute 5 Repeat steps 2-4 35 times 6 4 C hold
Prelab Questions 1 What is the purpose of Chelex resin? 2 What are the possibilities regarding the number of bands that can be obtained from each locus? Explain 3 What are the criteria for selecting a collection of STRs for forensic DNA profiling? 4 Which method of DNA profiling (VNTR or STR) is of most use by forensic scientists? Why? 5 Compare nudna and mtdna, then compare their use in STR analysis Which type of DNA is most suited in STR analysis for identification of severely damaged victims (badly burned, for example)? Denaturing Vertical Polyacrylamide Gel Electrophoresis (PAGE) Materials 10% denaturing polyacrylamide gel (with 7 M urea) 10 µg/ml ethidium bromide staining solution Loading dye PCR product ddh 2 O 5x TBE buffer Disposable gloves 100 bp DNA marker 05 ml microcentrifuge tubes P20, P200 and tips 10% ammonium persulfate TEMED 5% formamide Method Loading polyacrylamide gel 1 A 10% polyacrylamide gel was prepared and poured by the TAs 2 Transfer the PCR product into a new labeled 05 ml microcentrifuge tube being careful not to transfer any mineral oil 3 Boil sample and immediately place on ice 4 Add 4 µl of 95% formamide to the PCR sample 5 Add 5 µl of loading dye to the PCR sample, and mix by pipetting the total volume in and out 6 Load sample on the polyacrylamide gel Record the well number of your sample since the gel will be shared with your classmates 7 Load 100 bp DNA marker 8 Electrophorese at 350 watts for about 3 hours 9 Turn off the power supply and remove the gel from the electrophoresis glass plates 10 Stain the gel in ethidium bromide solution for 20-30 minutes 11 Rinse the gel in water and view under UV light 12 Photograph your gel Prelab Questions 1 What are the advantages of using a polyacrylamide gel over an agarose gel? Lab Report
1 Discuss the number and size of alleles for each of the STR loci examined Include your gel photograph 2 Compare your STR DNA profile to that of your classmate Appendix 1 Reagents for PAGE Gels Acrylamide 30% polyacrylamide-100 ml Bisacrylamide 29 g 1 g Bring volume up to 100 ml with ddh 2 O Heat in 37 C water bath to dissolve 10% ammonium persulfate- 10 ml Ammonium persulfate 1 g Bring volume up to 10 ml with ddh 2 O 5X TBE 1000 ml Tris base (MW 1214) 54 9 g Boric acid EDTA (05 M, ph 75) 272 g 20 ml 22% acrylamide- 50 ml 30% acrylamide 367 ml ddh 2 O 3 ml 3% ammonium persulfate 03 ml 5x TBE 10 ml TEMED 15 µl DNA Profile Frequency Calculations Genotype Probability at any STR Locus Part of the work of forensic DNA analysis is the creation of population databases for the STR loci studied Probability calculations are based on knowing allele frequencies for each STR locus for a representative human population (and showing Hardy-Weinberg equilibrium for the population by statistical tests) Allele frequency is defined as the number of copies of the allele in a population divided by the sum of all alleles in a population
For a heterozygous individual, if the two alleles have frequencies of p and q in a population, the probability (P) of an individual of having both alleles at a single locus is P = 2pq If an individual is homozygous for an allele with a frequency of p, the probability (P) of the genotype is P = p 2 We saw earlier (Figure 4) that Norma Liu is heterozygous for the FGA locus with 24 and 25 repeats Thus she has the genotype 24, 25 at the locus FGA In a reference database of 2000 US Asians (below), the frequency of the alleles 24 and 25 was 0162 and 0069, respectively The frequency of the 24, 25 genotype is therefore P = 2 (0162) (0069) = 0112, or 111% CFS Asian ProfilerPlus Allele Frequency Table Locus Allele Frequency Locus Allele Frequency Locus Allele Frequency FGA 16 0010 FGA 20 0054 FGA 232 0013 FGA 161 0000 FGA 202 0000 FGA 24 0162 FGA 172 0000 FGA 21 0121 FGA 242 0003 FGA 18 0031 FGA 212 0015 FGA 243 0000 FGA 182 0000 FGA 22 0187 FGA 25 0069 FGA 19 0059 FGA 222 0003 FGA 252 0008 FGA 20 0054 FGA 23 0197 FGA 26 0049 Probability for a DNA profile of Multiple Loci If databases of allele frequency for different loci can be shown to be independently inherited by appropriate statistical tests, the probability for the combined genotype can be determined by the multiplication (product rule) The probability (P) for a DNA profile is the product of the probability (P 1, P 2, P n ) for each individual locus, ie Profile Probability = (P 1 ) (P 2 ) (P n ) So for example, earlier we calculated the probability that Norma Liu would bet heterozygous for 24,25 at the FGAlocus at 0112 We can multiply that by her probability that she would be heterozygous 14, 16 for the vwa locus as well Locus Allele Frequency VWA 14 0269
VWA 15 0046 VWA 16 0151 VWA 17 0241 Use the table above to calculate the probability for the vwa locus and then use the multiplication rule to determine the probability she would have the genotype at both loci As you can see, the probability can be an extremely low numbers when all 13 CODIS STR markers are included in the DNA profile Norma Liu calculated her own profile probability for all 13 CODIS at 13 times 10-16, or no more frequent than 1 in 77 quadrillion individuals (77 million billion), which is more than a million times the population of the planet