Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Similar documents
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Lung Cell Apoptosis. Man Yi, Rosetta Belcastro, Samuel Shek, Daochun Luo, Martin Post, A Keith Tanswell ON-LINE DATA SUPPLEMENT

Supplementary Material

SUPPLEMENTAL INFROMATION

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

Supplementary Material - Methods

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml

Stefanie C Hummler, Min Rong, Shaoyi Chen, Dorothy Hehre, Deepthi Alapati, Shu Wu. Online Data Supplement

Gα 13 Activation Assay Kit

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

Supplemental Information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Anti-HB-EGF (Human) mab

Cdc42 Activation Assay Kit

Supplemental Information. Materials and methods.

Rab5 Activation Assay Kit

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

Division of Molecular Cardiology, Department of Medicine, College of Medicine,

SUPPLEMENTARY INFORMATION

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

RheB Activation Assay Kit

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Supplemental material

Arf6 Activation Assay Kit

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

Immunoprecipitation Protocol

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Description of supplementary material file

Firefly luciferase mutants as sensors of proteome stress

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

DCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supporting Information

Supplemental Material

Gα i Activation Assay Kit

ab Ran Activation Assay Kit

The following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from

SUPPLEMENTAL MATERIAL. Supplemental Methods:

Supplemental methods:

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

Proteasome Activity Fluorometric Assay Kit II (Cat. # J4120)

Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated

Supplementary Materials and Methods

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning

Western Blot Tool Box

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.

SUPPLEMENTARY INFORMATION

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not

supplementary information

Supporting Information

T H E J O U R N A L O F C E L L B I O L O G Y

Supporting Information

T H E J O U R N A L O F C E L L B I O L O G Y

APO-BrdU TUNEL Assay Kit

Electronic Supplementary Information. and purified according to previously published procedures(1). GlcNAc and Phos-FLAG were

Gel filtration PTP1B (5 μm) was incubated with 10 μm MSI-1436 in a final volume of 200 μl buffer (50

ab Ubiquitylation Assay Kit (HeLa lysate-based)

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Supplementary methods

Supporting Information

Supplementary material and methods

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

Supplementary information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm

ab G alpha i Activation Assay Kit

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed

Anti-p62 C-terminal pab

Confocal immunofluorescence microscopy

Supplementary Figure 1. The chemical structure of compound A. Compound A has an amino terminal methyl alanine and compound B has an

Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.

For Research Use Only. Not for use in diagnostic procedures.

1. Cross-linking and cell harvesting

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Protocol(Research use only)

Protein A Agarose Immunoprecipitation Kit

Supplementary Figure Legends

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2,

Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.

Supplemental Materials and Methods

ab Ubiquitylation Assay Kit

Supporting Information

Transcription:

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham ONLINE DATA SUPPLEMENT E1

Supplemental Materials and Methods Histology Lung sections at indicated developmental stage were isolated from wild-type, Hspa4l -/-, Hspa4 -/-, and Hspa4l -/- Hspa4 -/- embryos and stained with hematoxylin and eosin (H&E). Average saccular size (µm 2 ) and mesenchymal septal thickness (µm) were measured using NIH Image J software (National Institutes of Health, Bethesda, MD). These measurements were performed on 6 sections from each of 4 different lung samples/embryonic stage/genotype. Sections were also stained with periodic acid-schiff (PAS) (Sigma- Aldrich, Munich, Germany) according to the manufacturer s instructions. PAS-positive cells were counted in 3 sections of each lung from 4 different pups at E18.5 of each genotype. Immunofluorescence Embryonic lung sections from different genotypes were incubated with the following primary rabbit antibodies: prosp-c (1:1000; Chemicon, Hofheim, Germany), SP-B (1:300; Santa Cruz Biotechnology, Santa Cruz, CA), Aquaporin 5 (AQP5) (1:200; Alomone Labs, Israel), cleaved caspase-3 (1:200; Cell Signaling Technology, Danvers, MA), HSPA4L (1:200; Santa Cruz) and HSPA4 (1:100; Santa Cruz) followed by secondary Alexa Fluor 488 conjugated IgG antibody (1:500; Invitrogen, Karlsruhe, Germany). Caspase-3-positive cells were counted at 20X magnification from 5-8 fields per each lung from 4 different embryos at E18.5 of each genotype. Terminal deoxynucleotidyl transferase dutp nick end labeling (TUNEL) assay Lungs from E18.5 of different genotypes were subjected to TUNEL assay using an ApopTag peroxidase in situ apoptosis detection kit (Qbiogene, Heidelberg, Germany) according to manufacturer's instructions. TUNEL-positive cells were counted in 20x images from 5-8 fields per each lung from 4 different pups of each genotype. Proliferation assay Pregnant females were injected i.p. with 5-bromo-2 -deoxyuridine (BrdU) (50 µg/g body weight; Sigma- Aldrich) and killed 2 h later. Sections of E18.5 lungs from different genotypes were incubated with rat anti- E2

BrdU antibody (1:500; Abcam, Cambridge, MA, USA). BrdU-positive cells were counted in 5 fields per each lung from 4 different pups of each genotype. Immunoblotting For proteins extraction, the lungs and hearts of E18.5 pups were homogenized in cold RIPA lysis buffer, 10X (0.5M Tris-HCl, ph 7.4, 1.5M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10mM EDTA) supplemented just before running the assay with protease inhibitor cocktail (Roche Diagnostics Corp., Mannheim, Germany) and PMSF (1mM; Sigma-Aldrich). The homogenates were sonicated and then centrifuged at 12,000 g at 4 C for 20 min. Supernatants (20 µg of protein concentration) were combined at least 1:1 with sample buffer (62.5 mm Tris, ph 6.8, 2% SDS, 25% glycerol, 0.01% bromophenol blue, 200 mm β-mercaptoethanol), heated at 95 C for 5 minutes, resolved on 4 12% SDS-PAGE (Invitrogen), and transferred onto nitrocellulose membrane (Amersham Pharmacia, Freiburg, Germany). Membranes were then blocked for 1 h with 5% non-fat milk in 0.1% Tween 20 in Tris-buffered saline. Blots were probed at 4 o C overnight with antibodies against HSPA4L (1:2000), HSPA4 (1:2000), Ubiquitin (1:4000; DakoCytomation, CA, USA), ProSP-C (1:4000), SP-B (1:1000), AQP5 (1:1000), rabbit anti HSPH1 (1:5000; Sigma-Aldrich), goat anti HSP90α (1:1000; Santa Cruz), mouse anti HSP70 (1:2000; Sigma- Aldrich), rabbit anti BCL-2 (1:1000; Cell Signaling Technology) mouse anti α-tubulin (1:5000; Sigma- Aldrich) and followed by incubation with a secondary peroxidase-conjugated antibody (1:5000; Sigma- Aldrich). Signals were detected using a chemiluminescent kit (Santa Cruz). Signals were quantified by AlphaView software; Version: 3.2.0 (Cell Bioeciences. Inc, Santa. Clara, USA). 20S Proteasome activity Lung protein lysates from E18.5 wild-type and Hspa4l -/- Hspa4 -/- pups were isolated, and 20S Proteasome activity was measured using 20S Proteasome Assay Kit (10008041; Biomol, Hamburg, Germany) according to the manufacturer s instructions. In short, a synthetic 20S substrate, SUC-LLVY-AMC was used which, upon cleavage by the active enzyme, generates a highly fluorescent product that can be measured using excitation and emission wavelengths of 360 nm and 480 nm, respectively. Assay was E3

carried out with and without a specific 20S inhibitor, epigallocatechin gallate (EGCG). The difference between the two fluorescence readings was attributed to proteasomal activity. Transmission electron microscopy (TEM) TEM analysis was performed as described previously (1) using a TEM (EM 902, Zeiss, Oberkochen, Germany). Statistical analysis Data were expressed as mean ± S.D. Differences among groups were tested by Student s t test. A P value < 0.05 was considered to be significantly different. E4

Reference E1. Peng X, Kraus MS, Wei H, Shen TL, Pariaut R, Alcaraz A, Ji G, Cheng L, Yang Q, Kotlikoff MI, Chen J, Chien K, Gu H, Guan JL. Inactivation of focal adhesion kinase in cardiomyocytes promotes eccentric cardiac hypertrophy and fibrosis in mice. J Clin Invest 2006;116:217 227. E5

Supplemental figure legends Supplemental figure E1. Expression of HSPA4L and HSPA4 in embryonic and adult murine lungs. Total protein lysates were isolated from wild-type lungs at different developmental stages. Immunoblotting was performed with the indicated antibodies. α-tubulin (TUB) was used as a loading control, n = 3 per developmental stage. Supplemental figure E2. Cellular distribution of HSPA4L and HSPA4 in the lung. Paraffin sections of lungs from wild-type (E16.5, E18.5 and adult) and E18.5 Hspa4l -/- Hspa4 -/- pups were immunostained with antibodies against HSPA4L or HSPA4. Nuclei were stained blue with 4,6-diamidino-2-phenylindole (DAPI). Scale bar: 30 µm. DKO, double knockout. E6

Figure E1 80x42mm (300 x 300 DPI)

Figure E2 122x63mm (300 x 300 DPI)