Supplementary methods
|
|
- Anna Dickerson
- 6 years ago
- Views:
Transcription
1 Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into HEK293 cells through retroviral or lentiviral infection using standard protocols. Plasmid or sirna transfection was done using Fugene 6 (Roche) or Dharmafect 1 (Dharmacon), respectively. Surface plasmon resonance assay Binding affinity between RSPO1 and ZNRF3-ECD recombinant proteins with at least 95% purity was measured on a ProteOn SPR36 protein interaction array system using a GLC sensor chip. Briefly, purified ZNRF3 ECD-Fc was immobilized on the chip surface using standard amine coupling at an optimal density. WT or mutant His-tagged RSPO1 in three-fold serial dilutions was injected over the chip at the same time under constant flow rate. Association and dissociation of protein complex was monitored for 200 s and 480 s, respectively. All data were analyzed using the ProteOn Manager v Double referencing was performed against a flow cell immobilized with unrelated protein (FGF21) control and to the simultaneous buffer blank. For each interacting pair, data from the two independent injections were combined and fit simultaneously, with ka and kd fit globally and Rmax fit locally. To measure interaction between SOMAmers and RSPO1, biotin-labeled SOMAmers were immobilized on the Neutravidincoated sensor chip. Fc-tagged RSPO1 was injected over the chip. Association/dissociation of SOMAmer/R-spondin was monitored and affinity calculated as mentioned above. Conditioned media generation and measurement Construct of WT or mutant RSPO1-GFP was transiently transfected to HEK293 cells. Growth media was changed the second day and supernatant was collected 72 hrs after initial transfection. Concentration of RSPO1-GFP in the solution was measured of fluorescence intensity according to a GFP protein standard (Vector Laboratories) by EnVision Multilabel reader (PerkinElmer). Pulldown between SOMAmers and R-spondin
2 Freshly denatured biotin-labeled SOMAmer was mixed with conditioned media containing WT or mutant RSPO1-GFP at the presence of dextran sulfate and protease inhibitors. After two hours incubation at 4 C, prewashed Neutravidin beads (Pierce) were added to the mixture and incubated with rotation overnight at 4 C. Beads were washed three times with RIPA buffer (50 mm Tris-HCl, ph 7.4, 150 mm NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mm EDTA). The bound proteins were eluted in SDS sample buffer and resolved by SDS PAGE for immunoblotting analysis. Immunoblotting and immunoprecipitation Immunoblotting and immunoprecipitation were done as described previously {Hao, /id}. The sources of primary antibodies are: anti-myc tag, anti-gfp (Cell Signaling Technology); anti-ha (Roche). Cell surface protein isolation Cell surface proteins were isolated by whole cell biotinylation and NeutrAvidin agarose pulldown using Pierce Cell Surface Protein Isolation Kit (#89881) according to manufacturer s instructions. Flow cytometric analysis Cells coexpressing LGR4 and Myc-ZNRF3 were treated with wild-type or mutant RSPO1-GFP for twenty four hours. Cell were harvested using Trypsin-free cell dissociation buffer (Invitrogen) and resuspended in FACS buffer (1xPBS with 1% BSA and 0.02% sodium azide). After blocking, cells were incubated with anti-myc-alexa fluor 647 (Cell Signaling Technology) for one hour at 4 C. After extensive washes in FACS buffer, cells were stained with propidium iodide (PI) and subject to multi-channel analysis using BD LSR II flow cytometer. Fluorescence signals from PI negative viable single cells were displayed in histogram plots. Inhibition of RSPO1/receptor interaction by SOMAmer GripTite-293 cells (Invitrogen) were transiently transfected with LGR4, ZNRF3 ECD-TM, or empty vector 48 hrs before the binding analysis. 2ug/mL RSPO1-Fc protein was incubated with 50 nm specific SOMAmer, or its scrambled control, in fresh DMEM with 10% FBS for 30 min
3 at RT. RSPO1/SOMAmer mixture was added to the culture media with transfected cells, and incubated at 37 C for 1 hr. Cells were then washed twice with 1xPBS, fixed in 4% PFA, and stained with goat anti-human IgG Alexa Fluor 488 conjugate (Invitrogen). After final wash, bound RSPO1-Fc was detected by fluorescence microscopy. Statistical analysis Student s t tests were used to determine statistical significance. It is considered significant when P is smaller than 0.01.
4 Legends of Supplementary Figures Figure S1 Alignment of human RSPO1, RSPO2, RSPO3 and RSPO4 Alignment of furin-like domains of human RSPO1, RSPO2, RSPO3, and RSPO4. The asterisks indicate identical amino acid residues, the dots indicate homologous amino acid residues, the filled triangles indicate two residues critical for ZNRF3 binding in the FU1 domain, and the nonfilled triangles indicate two residues critical for LGR4 binding in the FU2 domain. Figure S2 Interaction between RSPO1 FU1 and FU2 double mutants and LGR4 or ZNRF3 ECD-TM in the cell-based binding assay HEK293 cells transiently transfected with empty vector (EV) or LGR4, ZNRF3 ECD-TM expression plasmid were incubated with RSPO1-GFP conditioned medium (CM), and binding of RSPO1-GFP was analyzed by fluorescence microscopy. Figure S3 Interaction between R-spondin recombinant proteins and RSPO1 SOMAmer or scrambled control in the SPR assay To measure interaction between SOMAmers and RSPO1 or RSPO3, biotin-labeled SOMAmers were immobilized on the Neutravidin-coated sensor chip. Fc-tagged RSPO1 or RSPO3 at indicated concentrations was injected over the chip. Association/dissociation of SOMAmer/Rspondin was monitored and affinity calculated.
5 hrspo1 hrspo2 hrspo3 hrspo4 hrspo1 hrspo2 hrspo3 hrspo4 31 R I S A E G S Q A C A K G C E L C S E V N G C L K C S P K L F I L L E R N D I R Q V G V C L P S C P 31 - R A S Y V S N P I C K G C L S C S K D N G C S R C Q Q K L F F F L R R E G MR Q Y G E C L H S C P 32 R MH P N V S Q G C Q G G C A T C S D Y N G C L S C K P R L F F A L E R I G MK Q I G V C L S S C P 26 - Q V G T G L G G N C T G C I I C S E E N G C S T C Q Q R L F L F I R R E G I R Q Y G K C L H D C P ** **. *** *. : ** : :. *. : : * * **. ** FU1 81 P G Y F D A R N P D MN K C I K C K I E H C E A C F S H N F C T K C K E G L Y L H K G R C Y P A C P 80 S G Y Y G H R A P D MN R C A R C R I E N C D S C F S K D F C T K C K V G F Y L H R G R C F D E C P 82 S G Y Y G T R Y P D I N K C T K C K A D - C D T C F N K N F C T K C K S G F Y L H L G K C L D N C P 75 P G Y F G I R G Q E V N R C K K C G A T - C E S C F S Q D F C I R C K R Q F Y L Y K G K C L P T C P. ** :. * : : * : * : * * : : **. : : ** : ** : ** : * : * ** FU hrspo1 hrspo2 hrspo3 hrspo4 131 E G S S A A N G T ME 130 D G F A P L E E T ME 131 E G L E A N N H T ME 124 P G T L A H Q N T R E *. : * * Figure S1.
6 WT R66A/Q71A F106A/F110A ZNRF3 ECD-TM LGR4 EV Figure S2.
7 Response (RU) Flow through RSPO1-Fc Immobilized SOMAmer-S1 ka: 1.63E+05 1/Ms kd:1.98e-04 1/s KD:1.22E-09M 80nM 40nM 20nM 10nM 5nM Time (s) Response (RU) Flow through RSPO1-Fc Immobilized SOMAmer-Ctr ka: 6.95E+01 1/Ms kd:2.20e-01 1/s KD:3.17E-03M 80nM 40nM 20nM 10nM 5nM Time (s) Response (RU) Flow through RSPO3-Fc Immobilized SOMAmer-S1 80nM 40nM 20nM 10nM 5nM Time Time (s) (s) Time (s) Figure S3.
8 Supplementary Table Binding of RSPO1-GFP mutants to LGR4 and ZNRF3 ECD-TM in cell-based binding assay RSPO1-GFP LGR4 ZNRF3 ECD-TM WT G43A ++ + S48A ++ + N51A G52A ++ + L60A F61A ++ + R66A ++ - Q71A ++ - G73A L76A P80A - - G82A Y83A - - R87A N92A F106A - ++ F110A - ++ Y119A L120A G123A G132A T139A E141A ++ ++
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationfrom Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and
upporting Material Experimental Procedures: Cell culture and antibodies All cell lines were maintained in RPMI 164 medium with 1% fetal calf serum at 37 C in 5% CO 2 (v/v). For HCC 1937-BRCA1 cells and
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationprotein interaction analysis
protein interaction analysis protocol guide 5821 Guide to Ligand Immobilization on the ProteOn XPR36 System Laura Moriarty, Bio-Rad Laboratories, Inc., 2000 Alfred Nobel Drive, Hercules, CA 94547 USA.
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationSURFACE PLASMON RESONANCE-BASED SYSTEMS
SURFACE PLASMON RESONANCE-BASED SYSTEMS ADVANCED METHODS IN BIOENGINEERING LABORATORY 3/1/2011 1 Schedule Week 1: Introduction Reagents preparation Ligand immobilization of Protocol 1 Week 2: Kinetics
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationGE Biacore T Check that the waste bottle is empty.
GE Biacore T200 General Care and Maintenance The instrument should be left ON at all times, and in Standby Mode. Report problems immediately in the booking system: https://ppms.us/hms-cmi. Refer to the
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationHiChIP Protocol Mumbach et al. (CHANG), p. 1 Chang Lab, Stanford University. HiChIP Protocol
HiChIP Protocol Mumbach et al. (CHANG), p. 1 HiChIP Protocol Citation: Mumbach et. al., HiChIP: Efficient and sensitive analysis of protein-directed genome architecture. Nature Methods (2016). Cell Crosslinking
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationStrep-Spin Protein Miniprep Kit Catalog No. P2004, P2005
INSTRUCTION MANUAL Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005 Highlights Fast protocol to purify Strep-tagged proteins from cell-free extracts Screen your recombinant colonies directly for
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationSupplementary Figures. Figure S1. Design and operation of the microfluidic cartridge.
Supplementary Figures Figure S1. Design and operation of the microfluidic cartridge. (a) The device has three inlets for DNA and capture beads, MNP probes and washing buffer. Each inlet is gated by the
More informationQualification of a DELFIA Assay for the Detection of Anti-mouse IgG Antibodies in Human Serum
application Note DELFIA Technology for Immunogenicity Testing Authors Martin Boissonneault Anja Rodenbrock Chantal Illy Gregory Cosentino PerkinElmer, Inc. Montréal, Québec, Canada Qualification of a DELFIA
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationGST Fusion Protein Purification Kit
Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationFab Streptamer Microbeads Manual, human
Fab Streptamer Microbeads Manual, human Isolation of functional target cells with reversible Fab-Streps and Strep-Tactin Magnetic Microbeads Last date of revision August 2016 Version PR32-0018 www.streptamer.com
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationRen Lab ENCODE in situ HiC Protocol for Tissue
Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar
More informationSUPPLEMENTARY ONLINE MATERIAL
SUPPLEMENTARY ONLINE MATERIAL The SUMO protease SENP7 is a critical component to ensure HP1 enrichment at pericentric heterochromatin Christèle Maison*, Kelly Romeo*, Delphine Bailly, Marion Dubarry, Jean-Pierre
More informationFor the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.
DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF
More informationCharacterization of Aptamer Binding using SensíQ SPR Platforms
Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationLabel-free interaction analysis in realtime using surface plasmon resonance
GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what
More informationPROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of
More informationIMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationAntibody Purification Guide
Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to
More informationRapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationprotein interaction analysis tech note 5367
protein interaction analysis tech note 5367 Rapid Optimization of Immobilization and Binding Conditions for Kinetic Analysis of Protein-Protein Interactions Using the ProteOn XPR36 Protein Interaction
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationSupplementary Material - Methods
Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationCharacterization of a human recombinant antibody fragment to be used in a diagnostic test
LABORATORY EXERCISE 1 Characterization of a human recombinant antibody fragment to be used in a diagnostic test Evaluation by SDS-PAGE, NanoDrop, ELISA, Biacore and Antibody microarray. Supervisors: Elin
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More informationHuman CNTF ELISA Kit
Human CNTF ELISA Kit Catalog No. K0331254 Lot No. 31202 Quantity 96 tests Storage 4 C Standard Range 31.25 2000 pg/ml [Important Notice] Please read this User Manual carefully prior to performing the assay.
More informationNEW! CHOgro Expression System
NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with
More informationJan 25, 05 His Bind Kit (Novagen)
Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,
More informationHuman Insulin-like Growth Factor 1 (IGF1) Kit
TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human Insulin-like Growth Factor 1 (IGF1) Kit Product No.: AL236 C/F Lot No.:
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationChIP-chip Using Affymetrix GeneChip S. cerevisiae Tiling 1.0R Arrays Rebekka Sprouse
ChIP-chip Using Affymetrix GeneChip S. cerevisiae Tiling 1.0R Arrays Rebekka Sprouse Making the WCE: 1. Grow 100 ml culture in YPD overnight at 30 o C to an OD600 ~1.0. (If working with ts alleles, add
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationImmunoaffinity Chromatography
PR120 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immunoaffinity Chromatography Teacher s Guidebook (Cat. # BE 507) think proteins! think
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationA Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples
application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSERVA Ni-NTA Magnetic Beads
INSTRUCTION MANUAL SERVA Ni-NTA Magnetic Beads Magnetic beads for Affinity Purification of His-Tag Fusion Proteins (Cat. No. 42179) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationPD-1 Pathway Recombinant Protein Collection
Pathway Recombinant Protein Collection www.acrobiosystems.com Content I. Introduction II. Biotinylated Pathway Proteins IIa. ELISA IIb. FAC Sorting IIc. Biopanning III. HPLC-verified Proteins IV. Full-length
More informationHuman IL10RB ELISA Pair Set ( CRFB4 )
Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationDrug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels
Drug Discovery Research Clinical Screening FLAG Expression Measurement Application Note Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels ALPHASCREEN APPLICATION
More informationGeneric DELFIA Reagents
AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationCHOgro Expression System
CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with robust
More informationBiochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A
APPLICATION NOTE AlphaLISA Technology Authors: Daniel Cardillo Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationEasy-WESTERN-II Quick
Easy-WESTERN-II Quick Primary Antibody Detection Reagent for Western Blots User Manual for Quick Antigen Detection or Multi Antigen Detection Immediately after receiving the kit, read the section titled
More information2008, Gregersen et al., 2014, and Heyn et al., 2014, with modifications, such as extension to
DETAILED PROTOCOL s 4 U-RNA enrichment with MTS chemistry This protocol uses MTS chemistry and builds upon previous methods developed by Dölken et al. 2008, Gregersen et al., 2014, and Heyn et al., 2014,
More informationSUPPORTING INFORMATION
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein
More informationData Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions
Data Sheet PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L2 ligand attenuates immune responses
More informationKPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)
KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationBIA Experimental Designs
s What are the Basics? Immobilization Binding Interactions Regenerations Controls 1 BIA Terminologies Ligand : Bound component Analyte: Flow-through component BIA Terminologies Resonance Units: Units used
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationGoat Anti Rabbit IgG Antibodies
Goat Anti Rabbit IgG Antibodies Table 1. Contents and storage information. Material Amount Concentration Storage Upon Receipt Stability Whole antibodies 0.5 ml F(ab ) 2 fragments 250 µl 2 mg/ml in 0.1
More informationNi-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)
Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------
More informationA Bridging Immunogenicity Assay Using SPARCL TM Technology
A Bridging Immunogenicity Assay Using SPARCL TM Technology Wenhua F. Xie Lumigen Inc., a Beckman Coulter Company INTRODUCTION Evaluating the immune response in patients is an important aspect associated
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More information