Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel

Similar documents
1.1 Chemical structure and conformational flexibility of single-stranded DNA

Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.

Introduction to DNA. Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris

MBMB,BCHM, or CHEM 451A

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB

Chapter 5: Nucleic Acids, etc.

Structural Bioinformatics (C3210) DNA and RNA Structure

Hmwk 6. Nucleic Acids

Structural Bioinformatics GENOME 541 Spring 2018

DNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA

Nucleotides and Nucleic Acids

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl

Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I

Gene and DNA structure. Dr Saeb Aliwaini

Paper 4: Biomolecules and Their Interactions Module 14: Chargaff's rule, DNA polymorphism

Assembly and Characteristics of Nucleic Acid Double Helices

Structure of nucleic acids II Biochemistry 302. January 20, 2006

Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005

Understanding DNA Structure

Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No

Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology

(Due Sept 9 th ) Problem Set 2

Molecular biology (1)

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

10BT43 Structural Biology

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids

CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY

MOLECULAR STRUCTURE OF DNA

Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1

Molecular Biology (1)

CHAPTER 8 Nucleotides and Nucleic Acids

DNA & DNA : Protein Interactions BIBC 100

Molecular biology (1)

Syllabus for GUTS Lecture on DNA and Nucleotides

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids

Drug DNA interaction. Modeling DNA ligand interaction of intercalating ligands

BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10

Road to the Double Helix

BASIC MOLECULAR GENETIC MECHANISMS Introduction:

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

Nucleic Acid Triplexes and Quadruplexes

}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose

Molecular Biology (1)

Gene Expression - Transcription

Chapter 9: DNA: The Molecule of Heredity

Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam I October 11, Secondary Structure and Thermodynamics (25 pts):

Lecture 16 Nucleic acid polymers

Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell

Nucleotides and nucleic acid

By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?

Chapter 11 Structure of Nucleic Acids

Introduction to Bioinformatics. Lecture 20: Sequencing genomes

BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison

Structure of DNA [pln39]

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

38. Inter-basepair Hydrogen Bonds in DNA

Nucleic Acids. Information specifying protein structure

Nucleic Acids and the RNA World. Pages Chapter 4

What Are the Chemical Structures and Functions of Nucleic Acids?

Paper 4: Biomolecules and Their Interactions Module 12: Bases, Sugars, Nucleosides and Nucleotides Introduction Nucleic acids are involved in storage

Review of ORGANIC CHEMISTRY

Concept 5.5: Nucleic acids store and transmit hereditary information

UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.

A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids

DNA Structure, Function, and Engineering Page /14/2018 Dr. Amjid Iqbal 1

Chapter 5: Introduction to the Nucleic Acids

Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage

Super Models. Nucleotides Molecular Model Kit Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10 - adult

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Structure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond

Appendix A DNA and PCR in detail DNA: A Detailed Look

Lecture #17 10/12/01 Dr. Wormington

Structure and Function of Nucleic Acids

Nucleic acids AP Biology

Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background:

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information

Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids

DNA Replication I Biochemistry 302. Bob Kelm January 24, 2005

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Fundamentals of Biochemistry

Multiple choice questions (numbers in brackets indicate the number of correct answers)

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome

DNA, Replication and RNA

Structure Factor Calculations of Various DNA Duplexes

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

Chapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein

DNA STRUCTURE & REPLICATION

Hydrogen bonding in yeast phenylalanine transfer RNA (electron density map/base stacking/base pairing/ion interactions)

DNA Replication AP Biology

Transcription:

DNA

Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC

Canonical B DNA First determined experimentally by fiber diffraction (Arnott) C2 -endo sugar puckers High anti glycosidic angles Right handed 10 base pairs per turn Bases perpendicular to the helix axis and stacked over the axis Overall bending as much as 15 degrees Over 230 structures 25 with base mis-pairing only cause local perturbations

A and B DNA allomorphs 5 3 3 5 Hydration Antiparallel strands B A

Review of DNA Structure

DNA Structures: A, B and Z

Review of DNA Structure

DNA Structures: A, B and Z Property A-DNA B-DNA Z-DNA Helix Right-handed Right-handed Left-handed Sugar C2 -endo C3 -endo C2 endo (C) C3 endo (G) Base pairs /turn 11 10 12 Pitch 28 Å 34 Å 44.6 Å Tilt 20 deg 0-7 deg Rise /bp 2.3 Å 3.4 Å 3.7 Å Diameter 23 Å 20 Å 17 Å

DNA grooves MAJOR MINOR Important for recognition and binding

Spine of Hydration

B-DNA (longitudinal view)

R.H. helix B-DNA (lateral view)

DNA Structures: B-DNA d(cgcgaattcgcg) d(cgcgaattcgcg)

A-DNA (longitudinal view)

R.H. helix A-DNA (lateral view)

DNA Structures: A-DNA d(agcttgccttgag) d(ctcaaggcaagct)

Canonical A DNA C3 -endo sugar puckers brings consecutive phosphates closer together 5.9A rather than 7.0 Glycosidic angle from high anti to anti Base pairs twisted and nearly 5A from helix axis Helix rise 2.56A rather than 3.4A Helix wider and 11 base pairs per repeat Major groove now deep and narrow Minor grove wide and very shallow

Z-DNA (longitudinal view)

L.H. helix Z-DNA (lateral view)

DNA Structures: Z-DNA d(cgcgcgcgcgcg) d(cgcgcgcgcgcg)

Base pairs are rotated in Z-DNA

Z-DNA Helix has left-handed sense Can be formed in vivo, given proper sequence and superhelical tension, but function remains obscure. Narrower, more elongated helix than A or B. Major "groove" not really groove Narrow minor groove Conformation favored by high salt concentrations, some base substitutions, but requires alternating purine-pyrimidine sequence. N2-amino of G H-bonds to 5' PO: explains slow exchange of proton, need for G purine. Base pairs nearly perpendicular to helix axis GpC repeat, not single base-pair P-P distances: vary for GpC and CpG GpC stack: good base overlap CpG: less overlap. Zigzag backbone due to C sugar conformation compensating for G glycosidic bond conformation Conformations: G; syn, C2'-endo C; anti, C3'-endo

Drug complexes to DNA Bound to the base pair double helix can accommodate this Bound in the minor grove show base specificity Cis-platinum drugs

Nucleotide triphosphates - O NH 2 N N N N O O O P O P O P O CH 5' 2 O H H O - O - O - 1' 4' 2'-deoxyadenosine 5' triphosphate H 3' 2' H OH H O HN N H 2 N N N O O O - O P O P O P O CH 5' 2 O 2'-deoxyguanosine 5' triphosphate O - O - O - 4' H H 1' H 3' 2' H OH H 2'-deoxycytidine 5' triphosphate O O O - O P O P O P O CH 5' 2 NH 2 N O N O H H O - O - O - 4' 1' H H 3' 2' OH H - O O H N O N O O O P O P O P O CH 5' 2 O O - O - O - 4' H H 1' thymidine 5' triphosphate H H 3' 2' OH H CH 3

Unusual DNA structures

Alternative base pairs Reversed Watson-Crick Watson-Crick Hoogsteen Reversed Hoogsteen

- note C(N3) protonation Watson-Crick + Hoogsteen = Base triplet

Triple helix DNA

Guanine Hoogsteen pairing Base tetraplex

Quadruplex DNA

Inverted repeat can lead to loop formation

Holliday junction DNA cruciform

PNA versus DNA

Achiral, peptide-like backbone Backbone is uncharged High thermal stability High-specificity hybridization with DNA Resistant to enzymatic degradation Can displace DNA strand of duplex Pyrimidine PNA strands can form 2:1 triplexes with ssdna Biotechnological applications Peptide Nucleic acid(pna)

Parallel-stranded DNA

I-DNA: intercalated parallel-stranded duplexes

α and β nucleotide anomers

H OH is not the only change in passing from DNA to RNA...

Books on DNA Principles of Nucleic Acid Structure, W. Saenger, 1984 Springer-Verlag Nucleic Acid Structure, Ed. S. Neidle, 1999 Oxford University Press DNA Structure and Function, R.R. Sinden, 1994 Academic Press Biochemistry, D. Voet and J.G. Voet, 1998 DeBoeck The Eighth Day of Creation, H.F. Judson, 1996 Cold Spring Harbour Press

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback