Structure of nucleic acids II Biochemistry 302. January 20, 2006

Size: px
Start display at page:

Download "Structure of nucleic acids II Biochemistry 302. January 20, 2006"

Transcription

1 Structure of nucleic acids II Biochemistry 302 January 20, 2006

2 Intrinsic structural flexibility of RNA antiparallel A-form Fig High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds In vivo conditions Intra-strand base pairing

3 Structure of transfer RNA (trna) and the concept of self-complementarity Self-complementary regions form A-type antiparallel helices or hairpins. Triple-base H-bonding & non-canonical bp Folding of helices produces a tertiary structure necessary for function. Fig Theoretical cloverleaf or cruciform structure Fig Yeast trna Phe 76 bases

4 Ribose conformation (sugar pucker) differs in double-stranded RNA helices 2 3 H DNA is C2 endo 3 2 OH RNA is C3 endo 2 OH restricts C3 to endo

5 DNA structures dictated by sequence: hairpins & cruciforms inverted repeat w/ twofold symmetry with potential to form hairpin or cruciform Intrastrand bp single strand only symmetric sequence in each strand but cannot form hairpin or cruciform Palindrome = segments of complementary strands that are the reverse of one another Stability of extended DNA vs cruciform? Intrastrand bp both stands involved

6 Triple helical or H-DNA (regions of high Pur/Pyr asymmetry) Note how the third strand runs in a parallel direction to its complement. C + = protonated C N7, O 6, N 6 of purines known as Hoogsteen positions H-DNA formation produces a sharp bend (mutagenic, hotspot for DSBs) Fig Fig RNA can also form triple helices: polyu:polya:polyu This atom should be a purple nitrogen.

7 Stability of DNA ds structure DNA does not fall apart under physiological conditions of ph and ionic strength. but some inherent instability is built in. Why? Phosphate backbones of opposing DNA strands electrostatically repulsive (an effect reduced by dissolved counterions Na +, K +, Mg 2+ ). Random coil has a entropy. helix random coil ΔG = ΔH TΔS So, ΔS > 0 & ΔH elrep < 0 favors transition to random coil but ΔH total > 0 because of H- bonding and van der Waals interactions between bps Lehninger Principles of Biochemistry, 4th ed., Ch 8

8 Concept of DNA thermal stability (practical perspective, DNA melting ) anneal Note the sharp T m transition point which is indicative of a highly cooperative transition. Fig Hypochromism: Pur and Pyr rings of stacked bases absorb light less efficiently than unstacked bases or free nucleotides.

9 T m depends on base-pair composition AT-rich regions melt (i.e. denature) more easily than GC-rich regions. Why? At T m, ΔG denat = 0 so 0 = ΔH T m ΔS and T m = ΔH/ΔS ΔS is the same for most polynucleotides on a per bp basis. ΔH is higher for G C base pairs. Thermal stability of hybrids: RNA-RNA > RNA-DNA > DNA-DNA Fig. 4.32

10 Structural features of DNA molecules in living organisms Single or double-stranded Linear or circular Small or large 5243 bp for SV40 genome (circular, DS) 6407 b for bacteriophage M13 genome (circular, SS) 4.6 x 10 6 for E. coli genome (circular, DS) 6.5 x 10 7 bp for 1 fruit fly chromosome (linear, DS) 3.2 x 10 9 bp for 23 human chromosomes (linear, DS) B-form except where sequence dictates otherwise Relaxed or supercoiled E. coli cell (2 μm) chromosome (1.7 mm)

11 Tertiary structure of DNA (supercoiling of the helix) Higher-order folding of regular secondary structural elements Supercoiling Twist of DNA strands around one another Extra twists in the helix itself Normal state of closed circular DNA molecules (to relieve strain of being underwound)

12 Utility of superhelical density (σ) ΔG sc, free energy stored in supercoiling is proportional to superhelical density, ΔG sc = Kσ 2 (σ = ΔL/L 0 ) where ΔL = # turns removed or added relative to # in relaxed DNA. When DNA is relaxed..σ = 0 so ΔG sc = 0. Decreasing σ (local unwinding) reduces stored energy ΔG sc. Imposing superhelical stress on DNA may thus promote Localized melting (AT-rich DNA) Formation of short stretches of Z-DNA (alternating CG n tract) Cruciform extension (palindromic sequences) H-DNA formation (asymmetric poly Pur/Pyr tract)

13 Characteristics of naturally occurring circular DNA (e.g. plasmids, mito DNA) Underwound (common) Right-handed superhelical twist, negative supercoiling σ = 0.05 to 0.07 (5-7% of helical turns removed) Overwound (rare) Left-handed superhelical twist, positive supercoiling Processive enzyme movement Exist as topoisomers Relaxed Supercoiled Topoisomerases Cut and reseal DNA Type I or II change L by increments of 1 or 2 Plasmid DNA treated with type I topoisomerase for different times

14 Tertiary structure of DNA in vitro and in vivo: importance of compaction Plectonemic ( twisted thread ) supercoiling protein Solenoidal supercoiling (greater compaction)

15 Metazoans have major size and biological issues to contend with. Super-sized genome Fit 2 meters worth of DNA (~6 x 10 9 bp) into a nucleus ~8 μm in diameter Compaction solenoid Exquisite control of Gene Expression Maintain and regulate genetic programs essential to cell growth and differentiation Structure must accommodate chromosomal organization where only 5-10% of DNA is actually transcribed

16 The Solution. Use special proteins to form chromatin Histones Small (~11-23 kda), basic, & highly conserved Building blocks of chromatin Subject to posttranslational modification Five types core & linker Non-histone chromosomal proteins SMC (structural maintenance of chromosomes) proteins Cohesins link sister chromatids after replication Condensins mediate chromosome condensation as cells enter mitosis Polymerases and other nuclear enzymes plus gene regulatory proteins (e.g. transcription & remodeling factors, 1000 different proteins)

17 Structure of the nucleosome core particle (histone octamer plus DNA) H3 H4 H2A H2B Octamer acts like a helical ramp K. Luger et al. (1997) Nature 389:251 Fig bp of DNA/octamer; 1.7 left-hand superhelical turns

18 Other features of nucleosome structure (2 nd level of organization) Histone core-dna binding is not random (positioned near clusters of A=T bp). Nucleosomes separated by 20 to 100 bp (but linker distance varies among organisms and cell types. Linker DNA is occupied by H1-type histones and other non-histone proteins. H1 plays important role in higher order organization (one H1/nucleosome core). Gene-specific nucleosomes occupy defined positions. Subject to remodeling. beads-on-a-string (3 rd level of organization)

19 30 nm fiber ~100-fold DNA compaction (need 10 4 fold) Heterochromatin (condensed) Euchromatin (open) MARs (sites of topoisomerase action and gene activation) Fig

Types of nucleic acid

Types of nucleic acid RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-

More information

Chromatin. Structure and modification of chromatin. Chromatin domains

Chromatin. Structure and modification of chromatin. Chromatin domains Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life

BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY

CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic

More information

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning

More information

DNA: The Genetic Material. Chapter 10

DNA: The Genetic Material. Chapter 10 DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel

Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber

More information

Molecular Biology I. The Chemical Nature of DNA. Dr. Obaidur rahman

Molecular Biology I. The Chemical Nature of DNA. Dr. Obaidur rahman Molecular Biology I The Chemical Nature of DNA Dr. Obaidur rahman Characteristics of Genetic Material The coding instructions of all living organisms are written in the same genetic language that of nucleic

More information

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS

More information

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Chemical organization of cells

Chemical organization of cells The most frequent chemical elements of living cells are H, C, N, O, P, S that represent 99% of cell mass. This elements form the organic molecules: nucleic s, proteins, carbohydrates, and lipids. Organic

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

Chapter 9: DNA: The Molecule of Heredity

Chapter 9: DNA: The Molecule of Heredity Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm

Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

The DNA Molecule: The Molecular Basis of Inheritance

The DNA Molecule: The Molecular Basis of Inheritance Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION

14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION 14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION Chapter Outline 14.1 ESTABLISHING DNA AS THE HEREDITARY MOLECULE Experiments began when Griffith found a substance that could genetically transform pneumonia

More information

The Molecular Basis of Inheritance

The Molecular Basis of Inheritance The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;

More information

The replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide

More information

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0 GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Genome Architecture Structural Subdivisons

Genome Architecture Structural Subdivisons Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,

More information

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for

More information

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic

More information

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e. 1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.

More information

Understanding DNA Structure

Understanding DNA Structure Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

1. Mitosis = growth, repair, asexual reproduc4on

1. Mitosis = growth, repair, asexual reproduc4on Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

DNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment

DNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment DNA Chapter 12 DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B.1.27 To truly understand genetics, biologists after Mendel had to discover the chemical nature of the gene. In 1928, Frederick Griffith was trying

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1

Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Topics : 2 hrs - Nucleic acid ----------------------------- Nucleic acid structure

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand. DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose

More information

Replication. Obaidur Rahman

Replication. Obaidur Rahman Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what

More information

DNA STRUCTURE AND REPLICATION

DNA STRUCTURE AND REPLICATION AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 2 Chapter 16 Activity #2 BUILDING BLOCKS OF DNA: Nucleotides: NAME DATE PERIOD DNA STRUCTURE AND REPLICATION 1. 5 carbon sugar (deoxyribose) 2. Nitrogenous

More information

The structure, type and functions of a cell are all determined by chromosomes:

The structure, type and functions of a cell are all determined by chromosomes: DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

5. Structure and Replication of DNA

5. Structure and Replication of DNA BIO2310 General and Molecular Genetics 5. Structure and Replication of DNA Key questions: How was DNA shown to be the genetic material? How about RNA? How was the structure of DNA determined to be the

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Chapter 13 Active Reading Guide The Molecular Basis of Inheritance

Chapter 13 Active Reading Guide The Molecular Basis of Inheritance Name: AP Biology Mr. Croft Chapter 13 Active Reading Guide The Molecular Basis of Inheritance Section 1 1. What are the two chemical components of chromosomes? 2. Why did researchers originally think that

More information

Biology Lecture 2 Genes

Biology Lecture 2 Genes Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes

More information

Nucleic Acids, Proteins, and Enzymes

Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Genetic Information: DNA Structure and Function

Genetic Information: DNA Structure and Function Genetic Information: DA tructure and Function Umut Fahrioglu, hd Mc Genetic material There must be information stored in our cells such that when it is passed to new generation it influences the characteristic

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov

More information

Chapter 8 Nucleotides & Nucleic Acids

Chapter 8 Nucleotides & Nucleic Acids Chapter 8 Nucleotides & Nucleic Acids We Need Nucleic Acids! RNA rrna DNA RNA mrna Protein Protein Trait Pol trna DNA contains genes, the information needed to synthesize functional proteins and RNAs DNA

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Review of ORGANIC CHEMISTRY

Review of ORGANIC CHEMISTRY Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large

More information

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)

More information

DNA- THE MOLECULE OF LIFE. Link

DNA- THE MOLECULE OF LIFE. Link DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

THE COMPONENTS & STRUCTURE OF DNA

THE COMPONENTS & STRUCTURE OF DNA THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made

More information

Answers to the multiple choice questions are at the bottom of the last page of this document.

Answers to the multiple choice questions are at the bottom of the last page of this document. Review for Unit Test #2: Cell Parts, Functions and Protein Synthesis, Answers Answers to the multiple choice questions are at the bottom of the last page of this document. 1. Know all of the material on

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Section DNA: The Molecule of Heredity

Section DNA: The Molecule of Heredity Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls

More information

* What are the nucleic acids?

* What are the nucleic acids? Nucleic Acids This lecture is meant to be a refreshment, it s a brief introduction to nucleic acids since we ll be given a full course about it next year in molecular biology. One last lecture and you

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

Molecular Genetics I DNA

Molecular Genetics I DNA Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule

More information

CHAPTER 11 LECTURE SLIDES

CHAPTER 11 LECTURE SLIDES CHAPTER 11 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

DNA Replication. The Organization of DNA. Recall:

DNA Replication. The Organization of DNA. Recall: Recall: The Organization of DNA DNA Replication Chromosomal form appears only during mitosis, and is used in karyotypes. folded back upon itself (chromosomes) coiled around itself (chromatin) wrapped around

More information

DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA?

DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? By the late 1800s, scientists knew that genetic information existed as distinct units called genes. hapter 11 By the

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information