Supporting Information Wiley-VCH 26 69451 Weinheim, Germany
A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a Voyager-DE Pro Biospectrometry Workstation from PerSeptive Biosystems (Foster City, USA) mass spectrometer was used in linear und negative ion mode. Reversephase HPLC was carried out with a Gilson semi-preparative HPLC fitted with an analytical Polaris column from Varian Inc. (5µm, 2Å, 25mm x 4.6mm). Fluorescence measurements were done on a Varian Cary Eclipse fluorescence spectrophotometer or a BMG Labtech Fluorostar ptima plate reader. ptical analyses were performed on a Varian Cary 1 Bio-UV/VIS spectrophotometer. Recombinant human Dicer was supplied by Stratagene or Gene Therapy Systems (Genlantis). Formation of the 72-mer pre-mira sequence by ligation of the labeled 5 - and 3 -terminal partial strands. The following oligonucleotides were purchased from IBA GmbH, Göttingen, Germany: 1) 5 -FAM-36mer (FAM-EX-5- GGCAAAUUGAGGUAGUAGGUUGUAUAGUAGUAAUUA) 1 and 2) 3 -DABCYL-36mer with 5 -phosphate 2 (phosphate-cacaucauacuauacaaugugcuagcuuucuuugcu-dabcyl) H CH H S H H CH 2 P 5'-ligo 3 C 6 - CH 3 1 2 H 3'-ligo P - H H H Ligation of 5 - and 3 -terminal partial strands (T4 Ligase from ew England Biolabs): 1 nmol reaction: 5 -FAM-36mer 1 µl (.1 nmol/ µl) 3 -DABCYL-36mer 1µL (.1 nmol/ µl) T4 Ligase buffer (1x) 24 µl RAsin (4U/µL) 5 µl T4 RA ligase (2U/µL) 1 ml Total volume 239µL Reaction time: 18 hours at 37 C.
Analysis of ligation product: 2 % denaturing urea PAGE-gels as well as native PAGE-Gels in TBE buffer were used. Stain: SYBR GREE (Molecular Probes). 1 2 1 2 3 4 1 2 3 4 a b c Figure S1: a) Denaturing PAGE from ligation, Column 1: both partial strands mixed, Column 2: reaction mixture after 18 hours; b) native PAGE without SYBR Green staining, Column 1: 5 -FAM-36mer, Column 2: 3 -DABCYL-36mer, Column 3: both partial strands mixed, Column 4: ligation mixture; c) ative PAGE stained with SYBR Green (1:1 dilution in TBE buffer), labeled as in b). Purification of ligation product: The ligation product was first purified by phenol extraction and aac precipitation in isopropanol. The raw product was further purified by reverse-phase HPLC and lyophilized. MALDI-Massenspektrometrie: Calculated: [M-H]/z 24411, [M-2H]/2z 1225, [M-3H]/3z 8136. Found: [M-H]/z 24432, [M-2H]/2z 1221, [M-3H]/3z 8135. Voyager Spec #1 MC=>MC[BP = 24426.8, 957] 1 24432 957. 9 8 7 24294 24371 % Intensity 6 5 4 3 2 1 8135 1221 12235 12168 12188 1294 12369 24194 2415 23912 23785 23569 2342 4412. 8657.8 1293.6 17149.4 21395.2 25641. Mass (m/z) Figure S2: MALDI-TF spectrum of ligation product (pre-mira beacon).
In vitro Transcription A Promega T7 RiboMAX Express in vitro transcription kit was used. According to instructions the template containing the T7-primer was used. The DA template with underlined T7-promoter sequence is as follows: 5 -AGCAAAGAAAGCTAGCACATTGTATAGTATGATGTGTAATTACTACTATACAACCTACTACCTCAA TTTGCCTATAGTGAGTCGTATTA-3 The 5 -phosphates were then removed with alkaline phosphatase (ew England Biolabs) and rephosphorylated with polynucleotide kinase (ew England Biolabs). The final sequence was purified as described above using reverse-phase HPLC and analyzed by MALDI-TF. Fluorescence Assay Measurements on Varian Cary Eclipse fluorescence spectrophotometer: a) With human recombinant Dicer A total volume of 1mL contained 5nM RA beacon, 15mM acl, 2 mm Tris-HCl, 2.5mM MgCl 2, 1 mm DTT and either 25 U recombinant Dicer or heat denatured Dicer. The fluorescence was measured every 1 minutes over the course of 4-6 hours. b) With cell lysate from HEK 293 cells: A total volume of 1.1mL contained 14nM RA beacon, 15mM acl, 2mM Tris-HCl, 2.5mM MgCl 2 and either 2µL cell lysate or 2µL heat denatured cell lysate. The fluorescence was measured every 1 minutes over the course of 4 hours. 1 2 3 4 Figure S3: PAGE analysis after incubation with Dicer, Column 1: control with beacon, Column 2: beacon digest, Column 3: control with unlabeled pre-let7 transcript, Column 4: digest of unlabeled pre-let7 transcript. The black arrows show the mira bands (21-23mer), the green arrow shows the cleaved 5 -fluorescein end.
Incubation with potential inhibitors of mira maturation Measurement on BMG Labtech Fluorostar ptima plate reader: A total volume of 1µL contained 3nM RA-Sonde, 2 mm Tris-HCl, 2.5mM MgCl 2, 15mM acl, 1mM DTT, 1µM peptide/kanamycin and.5 U recombinant Dicer. 35 3 25 ormal Peptide S117 Peptide S186 Peptide S417 Kanamycin 2 F 15 1 5 5 1 15 2 25 t /min Figure S4: Dicer cleavage without inhibitor or in the presence of 1µM peptide or kanamycin, without preincubation of RA and recombinant Dicer. The initial rise in fluorescence in the presence of peptide S186 can be avoided by incubating for 3 minutes with the RA before adding Dicer to the reaction. Sequences of the added peptides: Peptide S117: Ac-H-SSIYALEPDQKG-CH 2 Peptide S186: Ac-H-AKPYSQRRKTSG-CH 2 Peptide S417: Ac-H-RYIKKEFEFG-CH 2 Please note: The peptides correspond to the dicer sequence, but the - and C- termini are exchanged. Cell lysate from HEK293 cells Cells were taken up in buffer containing 2mM Tris-HCl ph 7.6, 75mM acl, 5mM MgCl 2, 2mM DTT, 1% Glycerol and Roche protease inhibitor and lyophilized by ultrasound. The mixture was centrifuged first for 1 minutes at 43 g and 4 C. The supernatant was then centrifuged for 5 minutes at 12,1 g and room temperature. The protein concentration in the supernatant was determined by the Bradford assay [1] (typically between 1 und 25 µg/ml). The cell lysate was stored by -2 C. The cell lysate for control measurements was heated at 95 C for 2 minutes and also stored at -2 C. References: [1] M. M. Bradford, Anal Biochem 1976, 72, 248.