Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Similar documents
RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

Supplemental data. Supplemental Materials and Methods

SANTA CRUZ BIOTECHNOLOGY, INC.

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

Sarker et al. Supplementary Material. Subcellular Fractionation

Supplementary Material

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Data Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500

SUPPLEMENTARY INFORMATION

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Supplemental Methods Cell lines and culture

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method

Bioimaging of microrna-294 expression-dependent color change. in cells by a dual fluorophore-based molecular beacon

Supplemental material

Nature Biotechnology: doi: /nbt.4166

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

supplementary information

Percent survival. Supplementary fig. S3 A.

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

SUPPLEMENTARY INFORMATION

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Supplementary Figure 1

Lullaby sirna Transfection Reagent - Results

Supplemental Information

M X 500 µl. M X 1000 µl

Supplemental Materials and Methods

A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Whole Mount IHC Protocol

Supplementary Methods

Supplementary Figure 1. Isolation of GFPHigh cells.

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Supporting Information

Confocal immunofluorescence microscopy

Nature Medicine: doi: /nm.2171

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Firefly luciferase mutants as sensors of proteome stress

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

0.9 5 H M L E R -C tr l in T w is t1 C M

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Supplemental Materials

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM

Supplementary Figure S1

Chemically defined conditions for human ipsc derivation and culture

Supporting Information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

NTM486-04, NTM174-04,

Supplemental Table 1 Primers used in study. Human. Mouse

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells

TOOLS sirna and mirna. User guide

Supplementary Data. Supplementary Materials and Methods Quantification of delivered sirnas. Fluorescence microscopy analysis

Product: Arrest-In TM Transfection Reagent for RNAi

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Eric J. Wagner, Brandon D. Burch, Ashley C. Godfrey, Harmony R. Salzler, Robert J. Duronio, and William F. Marzluff

Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications

TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells

Nemo like kinase regulates the expression of vascular endothelial growth factor (VEGF) in alveolar epithelial cells

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Material - Methods

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Otefin, a Nuclear Membrane Protein, Determines

Regulation of hepcidin expression by inflammation-induced activin B

Transcription:

Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin Smith Inventory of supplementary information Supplementary figures: 2 Figure S1. Transient and stable knockdown of LEF1. Related to Figure 4 Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Supplementary Tables: 4 Table S1. Summary of injections of DA rat ES cells into SD host blastocysts. Related to Figure 3 Table S2. Primers and probes for real-time PCR. Related to Figure 1-4 Table S3. Primary antibodies for immunofluorescence staining. Related to Figure 1-4 Table S4. Short hairpin RNA sequence of shlef1-1 and shlef1-2. Related to Figure 4 Supplementary experimental procedures

Supplementary Figure 1 Figure S1. Transient and stable knockdown of LEF1. (A) qrt-pcr analysis of Tcf3 and Lef1 expression after Tcf3 and Lef1 knock down. Gene expression was first normalized to Gapdh, and then relative to values in sigfp transfected cells cultured in 2iL. (B) The design of PiggyBac vector for expression of Lef1 shrna. (C) qrt-pcr analysis of Lef1 expression in

shlef1 transfected cells versus control. Error bars represent standard deviation of three technical replicates. Supplementary Figure 2 Figure S2. Response of mouse ES cells to GSK3 inhibition. qrt-pcr analysis of gene expression of Cdx1, Cdx2, T, and Axin2 in mouse (dashed line) and rat (solid line) ES cells cultured on feeders with different concentrations of CH. Values are normalised to Gapdh. Error bars represent standard deviation of three technical replicates. Table S1. Summary of injections of DA rat ES cells into Sprague-Dawley (SD) host blastocysts. Related to Figure 3 Cell line Sex Genetic Passage Blastocysts Pups Chimaeras Germline modification number transferred born Transmission 16g2 F GFP 35+13 25 16 10 0/4 DAK31 M None 10+13 12 6 1 0/1 16g2.cl9 F GFP 35+12 30 14 9 1/2 16g2.cl13 F GFP 35+12 30 12 7 1/1 Passages in titrated 2i are labelled in bold. Table S2. Primers and probes for real-time PCR. Gene Forward primer sequence Reverse primer sequence Gapdh* CAGTGATGGCATGGACTGTG CAATGCATCCTGCACCAC Esrrb GGCGTTCTTCAAGAGAACCA CCCACTTTGAGGCATTTCAT Nanog* TACCTCAGCCTCCAGCAGAT GCAATGGATGCTGGGATACT Klf2 GGTAGTGGCGGGTAAGCTC AACTGCGGCAAGACCTACAC Oct4* CAGGGTCTCCGATTTGCAT GCAGCTCAGCCTTAAGAACA Lef1* CTGCTGTACATGTCACTGAAC GATGGTGGCCTCTGTGTATG Cdx2* AAGACAAATACCGGGTGGTG CTGCGGTTCTGAAACCAAAT Axin2(mouse) GCAGGAGCCTCACCCTTC TGCCAGTTTCTTTGGCTCTT Cdx1(mouse) ACGCCCTACGAATGGATG CTTGGTTCGGGTCTTACCG T(mouse) CAGCCCACCTACTGGCTCTA GAGCCTGGGGTGATGGTA

Gene Company Cat. No. T(Rat) Appliedbiosystem Rn01527349_m1 (Cat#:4331182) Axin2(Rat) Appliedbiosystem Rn00577441_m1 (Cat#:4331182) Cdx1(Rat) Appliedbiosystem Rn01759334_m1 (Cat#:4331182) Cdx2(Rat) Appliedbiosystem Rn00576694_m1 (Cat#:4331182) Tcf1(Hnf1a) (Rat) Appliedbiosystem Rn00562020_m1 (Cat#:4331182) Tcf3(Tcf7l1) (Rat) Appliedbiosystem Rn00483453_g1 (Cat#:4331182) Tcf4(Rat) Appliedbiosystem Rn01411019_m1 (Cat#:4331182) Lef1(Rat) Appliedbiosystem Rn01522501_m1 (Cat#:4331182) Eomes(Rat) Appliedbiosystem Rn01746545_m1 (Cat. 4448892) Elf5(Rat) Appliedbiosystem Rn01514160_m1(Cat. 4448892) Fgfr2(Rat) Appliedbiosystem Rn01269940_m1(Cat. 4448892) * Sequence is conserved between mouse and rat. Table S3. Primary antibodies for immunofluorescence staining. Antigen Species Dilution Company Cat.No. CDX2 Rabbit 1:200 Cell signaling 3977S OCT4(C-10) Mouse 1:200 Santa Cruz Sc-5279 T Goat 1:200 R&D Systems AF2085 CTNNB1 (β-catenin) Mouse 1:400 BD Transduction Laboratories 610154 GATA4 Goat 1:100 Santa Cruz sc-1237 Table S4. Short hairpin RNA sequence of shlef1-1 and shlef1-2. Related to Figure 4 shlef1-1 shlef1-2 GACTTGATGTCTGCTAAGTCGCGTTTTGGCCACTGACTGACGCGA CTTAAGACATCAAGT GTAATTGTCTCTCGCTGACCAGGTTTTGGCCACTGACTGACCTGGT CAGAGAGACAATTA Supplementary experimental procedures Immunofluorescence Cells were fixed with 4% paraformaldehyde in PBS (ph 7.0) for 30 minutes at room temperature. Subsequently, cells were washed twice with PBST (0.1% Triton X-100 (Sigma) in 1XPBS) and then with blocking solution (4% donkey serum in PBST). Primary antibody solution was prepared by diluting antibody in blocking solution at the concentration listed in Table S3. Cells were incubated with the primary antibody at room temperature for 2 hours or at 4 C overnight, followed by three washes with Tris-buffered saline (TBS) containing 0.1% Tween 20 prior to incubation with the secondary antibodies at room temperature for 1 hour.

After nuclear staining with DAPI (Invitrogen), stained cells were detected by fluorescence microscopy or confocal-laser microscopy. TOPFlash assay 10 6 cells per well were transfected with 4μg TOPFlash or FOPFlash (Upstate) and 0.2μg Renilla luciferase plasmids using lipofectamine 2000 (Invitrogen) in 6-well plates. Cells were passaged 24hrs later and replated on feeders in a 24 well plate in triplicates in PL, T2iL and 2iL respectively. 48hrs after transfection, cells were lysed and analysed using the dual luciferase kit (Promega) according to the manufacturer s protocol.

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback