ISSN 068-620, Russian Journal of Bioorganic Chemistry, 203, Vol. 39, No. 4, pp. 406 46. Pleiades Publishing, Ltd., 203. Original Russian Text A.I. Kuzmich, A.V. Vvedenskii, E.P. Kopantzev, T.V. Vinogradova, 203, published in Bioorganicheskaya Khimiya, 203, Vol. 39, No. 4, pp. 454 465. Quantitative Comparison of Gene Co-Expression in a Bicistronic Vector Harboring IRES or Coding Sequence of Porcine Teschovirus Peptide A. I. Kuzmich, A. V. Vvedenskii, E. P. Kopantzev, and T. V. Vinogradova Shemyakin Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow, 7997 Russia Received January 5, 203; in final form, January 29, 203 Abstract In biotechnology, simultaneous expression of more than one target gene is often required. Multicistronic vectors encoding several proteins are being actively developed for this purpose. Most often, the commercially available vectors utilize various types of internal ribosomal entry site of the encephalomyocarditis virus (IRES EMCV). However, many researchers consider bicistronic vectors on the basis of sequences that encode self-cleaving peptides more promising. In the work, we compare the efficiency of gene expression in cells transfected with bicistronic constructs bearing either IRES EMCV or the P nucleotide sequence corresponding to the porcine teschovirus- peptide. Efficiency of gene expression was determined in three mammalian cell lines by measurement of co-expression levels of genes coding for RFP and EGFP proteins linked by IRES or P sequence. A higher level of the transgene expression was detected in cells transfected with P sequence-based genetic constructs. Keywords: bicistronic vector, IRES EMCV, peptide, porcine teschovirus DOI: 0.34/S068620304022 Bi- and multicistronic vectors are often used in various biological studies and practical applications []. These vectors ensure rather constant stoichiometric gene expression []. There are multiple ways to create multicistronic vectors, each with its own advantages and limitations []. Today, bicistronic vectors harboring the internal ribosomal entry site of the encephalomyocarditis virus (IRES EMCV), as depicted in Fig., are the most popular. This is ascribed to the high efficiency of internal translation initiation by IRES EMCV, as well as the fact that the element has been discovered a while ago and thus is rather well studied [2]. In laboratory routine, various types of IRES EMCV constructs are used. Initially, it has been demonstrated that for internal translation initiation, IRES corresponding to the 230 834 bp region of the EMCV genomic RNA is sufficient [3, 4]. In genetic vectors 430 600 bp long IRES variants are used [5]. Modifications of the IRES EMCV nucleotide sequence may lead to considerable suppression of internal translation initiation [5, 6]. Typically, terminal fragments of Abbreviations: UTR, untranslated region; RF, reading frame; EPR, endoplasmic reticulum;, cytomegalovirus promoter; EGFP, green fluorescent protein; IRES, internal ribosomal entry site; NMD, non-sense mediated decay; P and P, porcine peptide and the coding sequence; RFP, red fluorescent protein. Corresponding author: phone: +7 (495) 0-69-92; fax: +7 (495) 0-46-54-38; e-mail: akrubik@gmail.com. IRES are modified in the process of bicistronic vector construction. Shortening of IRES sequence at its 5' end by 00 200 bp causes practically no effect on its activity [7]. Often, changes in the nucleotide sequence affect the IRES 3' end. The level of translation initiation drops sharply upon deletion of the initiation codon where the precursor protein synthesis is initiated in the virus: simple deletion of the initiation codon or its replacement with nucleotide sequence of HindIII restriction site results in several dozen times lower IRES-dependent cistron expression [5, 6]. Insertion of three EMCV genome codons after the initiation codon improve the IRES performance. The modification allows for a decreased influence of the protein-coding sequence on internal translation initi- Promoter cistron IRES cistron 2 Promoter cistron cistron 2 P Fig.. Scheme of bicistronic vectors on the basis of IRES (a) and P sequence., polyadenylation signal. 406
QUANTITATIVE COMPARISON OF GENE CO-EXPRESSION 407 ation, but the resulting protein carries four additional amino acid residues at its N-terminus [8]. Vectors based on IRES have a number of disadvantages. In most cases, internal initiation of translation via IRES occurs less efficiently than cap-dependent initiation, which leads to differences in the expression levels of proteins encoded in the first and second reading frames (RF) [9]. Bicistronic mrna is subject to accelerated degradation due to the fact that the first RF translation termination occurs at a considerable distance from the 3' untranslated region (UTR). A termination codon in the middle of a molecule may trigger mrna degradation via the nonsense-mediated decay (NMD) mechanism [0]. Another promising approach to the development of multicistronic vectors employs peptides or cis-acting hydroplase elements (CHYSEL) in the hybrid proteins []. These peptides, about 20 a.a. residues long, are encoded by sequences separating structural and nonstructural genes in many picornaviruses [2]. Their N-terminal fragments differ considerably between various representatives of picornaviruses, however, they all contain a conserved Asn-Pro-Gly-Pro fragment at their C-terminus, which is required for peptide processing [3]. The co-translational processing of peptide prevents formation of a peptide bond between the Gly and Pro residues at the C-terminus [3]. As a result, two protein products are generated from a single RF at the approximate ratio of : [4]; the first protein carries about 9 additional amino acid residues at its C-terminus and the second one, an additional Pro residue at its N-terminus. The high level of transgene co-expression, the possibility to co-express three or more cistrons, and the small size of sequences open wide horizons for the -based vectors in biotechnology []. However, -based vectors are not free from some faults. The efficiency of peptide processing is less than 00%, so that a small amount of uncleaved protein is generated in cells [5]; besides, a considerable increase in the fraction of uncleaved proteins has been reported in some cases upon introduction of an EPR-localization signal into the protein sequence [6, 7]. Introduction of linker sequences Gly-Ser-Gly or Ser-Gly-Ser-Gly at the N-terminus of peptide attenuates the influence of the preceding protein sequence on peptide processing [4, 8] and thus increases the efficiency of cleavage. Currently, several works comparing vectors on the basis of IRES EMCV and sequences have been published. For example, a vector encoding the Flp and Cre recombinases concatenated with sequence of the Thosea asigna virus (T) provided more efficient site-specific recombination, in comparison to the vector on the basis of IRES EMCV [9]. In [20], it was demonstrated that a vector based on the sequence of the foot-and-mouth disease virus (F) provided a higher level of expression than the vector based on the IRES EMCV, however, a low efficiency of F cleavage was observed. The cited works employed suboptimal peptide variants, which may have led to the low efficiency of cleavage and decrease in the protein production level. The aim of the study was to compare the expression of both cistrons upon the utilization of bicistronic vectors constructed with variants of IRES EMCV and P sequence, that is, to evaluate which of the vectors provides for the highest yield of both encoded proteins. Using two variants of IRES EMCV and P sequence, we constructed bicistronic vectors encoding the EGFP and RFP fluorescent proteins. The levels of reporter protein expression were compared upon transient transfection of three different mammalian cell lines. The level of transgene expression was evaluated using fluorescence microscopy, fluorimetry, and Western blotting. In all cell lines, the P sequence-based vector ensured a higher level of expression of and genes upon efficient peptide cleavage. RESULTS AND DISCUSSION Design of bicistronic constructs bearing IRES and P sequence. To evaluate the efficiency of co-expression of transgenes, three bicistronic constructs containing genes of the reporter fluorescent proteins RFP and EGFP (Fig. 2a) were designed. All vectors were constructed on the basis of the pgl3 vector and contained the cytomegalovirus early promoter () and SV40 polyadenylation signal (). Gene expression was controlled by the promoter. The gene was located closer to the promoter region, while the gene followed the linker. Two different variants of the IRES EMCV were used to link the cistrons: the IRES2 sequence, similar to that of the wild-type IRES, and the shortened IRESatt sequence. The P, coding sequence for the porcine teschovirus peptide, was used as a linker in the third construct. Monocistronic constructs containing the and genes were also created. IRES EMCV possesses a complex secondary structure (Fig. 2b). Sequences of the 3' ends of the studied IRES (IRESatt and IRES2), together with the sequence of the wild-type IRES, are presented in Fig. 2c. The shortened variant of IRES was 494 bp long, devoid of the native initiation codon, and linked to the sequence encoding EGFP with a 22-bp sequence which differed from the sequence in IRES EMCV. Deletion of the native initiation codon, as well as the presence of additional nucleotides between the RF and IRES, is known to suppress IRES activity [5, 6], therefore, IRESatt was expected to exhibit low translation initiation activity. The 585-bp long IRES2 was identical to the wild-type IRES, except for the presence of an additional adenosine in the A6 loop (a small structural element located close to the 3'-terminal region of IRES). The modification insignificantly
408 KUZMICH et al. R E I I2 IRESatt IRES2 5' PPT 834 AUG 3' P PPT (c) IRES EMCV IRES2 IRESatt P w.t. P (d) Fig. 2. Particular features of the genetic constructs used in the work. (a) Scheme of the constructs: R, p-rfp; E, p- EGFP; I, p-rfp-iresatt-egfp; I2, p-rfp-ires2-egfp;, p-rfp-p-egfp., cytomegalovirus promoter;, RFP-coding sequence;, EGFP-coding sequence; IRES2, IRES variant close to the wild type; P, P peptide-coding sequence;, polyadenylation sequence. Secondary structure of IRES EMCV. AUG, initiation codon, PPT, polypyrimidine tract. (c) Variants of nucleotide sequence of the IRES 3'-terminal fragment and the adjacent sequence. IRES EMCV, 3'-terminal sequence of wild-type IRES; IRES2 and IRESatt, 3'-terminal sequences used in the work. Bold type face denotes nucleotides of the IRES. Initiation codon position is indicated with a rectangle; the first codon of is underlined. (d) Variants of P sequences. P w.t., nucleotide sequence encoding the wild-type P peptide; P, nucleotide sequence used in the work. Amino acid sequence of P peptide is presented in the lower part of the figure. S(P) is the introduced aminoacid substitution. The arrow indicates P peptide cleavage site. attenuates the ability of IRES to initiate translation [5]. IRES2 contained the native initiation codon followed by three additional codons taken from the virus sequence, which has been shown [8] to increase the IRES activity. Therefore, the latter variant was expected to exhibit higher initiation activity than IRESatt. The sequence coding for P peptide corresponded to that from the porcine teschovirus serotype genome [2], however, it was subjected to some modifications (Fig. 2d). Firstly, some codons were replaced with synonymous to reduce the structuring of the nucleotide sequence. Secondly, the N-terminal Pro triplet was replaced with the Ser triplet to form the Gly-Ser-Gly linker sequence, which increases cleavage efficiency [4, 8]. Besides, a Thr triplet was added at the N-terminus, which resulted in the emergence of an AgeI restriction site. The length of the P peptide used in the work was 23 a.a. Assessment of the efficiency of the constructs in mammalian cells. The activity of the genetic constructs obtained was studied under conditions of transient transfection of various mammalian cell lines. The activity of IRES and P sequences may vary in various types of cells, thus the experiments were performed in three well-studied cell lines of different origins: HEK293 (human embryonic kidney), M3 (mouse melanoma), and HT080 (human fibrosarcoma). The reporter gene expression in cells was analyzed through detection of RFP and EGFP proteins by means of fluorescence microscopy, fluorimetry, and Western blotting using antibodies against RFP and EGFP. Western blotting also allowed the evaluation of the level of co-translational cleavage of the RFP-P- EGFP. The data on the three cell lines are shown in Figs. 3 5 and Table. According to the fluorescence microscopy data, all transfected cells accumulated fluorescent proteins. In cells transfected with vectors on the basis of IRES2 and the P sequence, comparable levels of both fluorescent proteins were observed, while in cells transfected
QUANTITATIVE COMPARISON OF GENE CO-EXPRESSION 409 Table. RFP and EGFP fluorescence intensity values in HEK293, M3, and HT080 cell lines* Cell line HEK293 M3 HT080 Bicistronic vector RFP EGFP RFP EGFP RFP EGFP I.2+/ 6.6 0.8+/ 0.4 3.4+/ 3.3 0.2+/ 0. 36.+/ 4.7 0.5+/ 0. I2 44.7+/.4 20.3+/ 2.3 36.7+/ 2.8 3.5+/.6 38.5+/ 5.3 7.2+/ 0.6 56.5+/ 5.8 62+/ 0.8 55.8+/.7.5+/.8 34.9+/ 3.5 30.7+/ 3. * Fluorescence intensity values are presented as a percentage of those of cells transfected with relevant monocistronic constructs. Designations: RFP and EGFP, fluorescence intensity values of the proteins; I, p-rfp-iresatt-egfp; I2, p-rfp-ires2- EGFP;, p-rfp-p-egfp. The values are presented as (means +/ SEM, %). with the IRESatt vector, EGFP fluorescence was practically absent (Figs. 3a, 4a, and 5a). Fluorimetry allows quantitative evaluation of RFP and EGFP reporter proteins through fluorescence intensity measurement. Fluorescence intensity values in cells transfected with the bicistronic constructs were expressed as a percentage of the fluorescence levels in cells transfected with the relevant monocistronic constructs. In the latter ones, fluorescence intensity was considered 00%. Average values of fluorescence intensity are presented in Table and in Figs. 3c, 4c, and 5c. In HEK293 and M3 cells, the P sequence-based vector provided for a slightly higher expression level of the first cistron and the IRESatt-based vector, the lowest expression level. The differences were particularly pronounced in M3 cells where the IRESatt vector provided the lowest relative level of RFP production of all cell lines. The IRES2 vector provided RFP fluorescence level comparable to that of RFP fluorescence in cells transfected with the P sequence-based vector. In HT080 cells, the first cistron expression level differed insignificantly between different bicistronic vectors used and was approximately 35% of the gene expression level in cells transfected with a monocistronic construct. In all cell lines, expression of, the second cistron, was detected at a higher level upon utilization of the P-based vector, as compared with vectors based on IRES. Thus, in all cell lines, EGFP fluorescence was approximately 3 times higher in cells transfected with the P-based vector than in cells transfected with IRES2. The IRESatt vector provided a very low level of the second cistron expression; the difference between the levels of EGFP fluorescence upon cell transfection with vectors based on IRES2 and IRESatt was 70 70-fold. Therefore, the bicistronic vector based on the sequence coding for P peptide ensured the most efficient expression of the second cistron, in comparison with vectors based on IRES. It should also be noted that in all cells transfected with bicistronic constructs the level of reporter gene expression was lower than in cells transfected with monocistronic vectors. Western blotting analysis confirmed the fluorimetry data (Figs. 3b, 4b, and 5b). In the case of the IRE- Satt-based vector, EGFP could not be detected with Western blotting: apparently, its content was below the detection limit of the method. Calculated molecular weights of EGFP and RFP are kda. In lysates of cells transfected with the Pbased vector stained with antibodies to RFP, a shift of the main band was observed due to the additional 22 a.a. at the C-terminus of the hybrid protein that increased the protein weight to 29 kda. Apart from the main band of the RFP at kda, additional bands corresponding to proteins of about 20 and 40 kda were observed in Western blotting. It is well known that many fluorescent proteins are able to form homodimers, especially in concentrated solutions; therefore, a product of RFP dimerization or the product of its cleavage fragment dimerization may correspond to the 40-kDa band. The emergence of a 20-kDa band may be ascribed to RFP cleavage at the chromophore fragment when cell lysates were boiled prior to electrophoresis. Cleavage of the protein chain upon boiling has been described for the DsRed fluorescent protein; the authors suggested that only fluorescent proteins containing an acylimino group in their fluorophore are subjected to the cleavage [22]. As learned from crystal structure analysis, the Tag-RFP red fluorophore also contains an acylimino group [23]. To normalize the protein quantity in samples, Western blotting of the same samples was performed with antibodies against housekeeping proteins GAPDH or actin. Uncleaved RFP-P-EGFP protein was estimated in lysates by the intensity of a 56-kDa luminescent band. Luminescence values were calculated relative to the total luminescence of all bands corresponding to RFP in the P peptide lane. In all cell lines, high efficiency of P peptide cleavage was observed (Table 2). The maximum yield of chimeric protein was observed in HEK293 cells, where it reached.6% of the total RFP. In M3 cells no uncleaved protein could be detected. The data evidence that the bicistronic vector based on the P sequence is more efficient than the IRES-
40 KUZMICH et al. E R I RFP EGFP RFP + EGFP Phase contrast 59 20 Anti RFP C R E I I2 M 0 7 Anti GFP CRE I I2 M 0 I2 7 3 Anti GAPDH 60 40 20 0 Relative fluorescence, %80 (c) I I2 2 Fig. 3. Analysis of bicistronic construct efficiency in HEK293 cell line. (a) HEK293 cell microscopy (20 ). In the upper part of the figure, modes of image acquisition are denoted: RFP and EGFP, micrographs obtained via RFP and EGFP fluorescence detection; RFP+EGFP, merged image; phase contrast, phase contrast micrographs obtained under usual lighting. On the left, vectors used for transfection are denoted (see Figure 2 caption for designations). Western blotting of HEK293 lysates. Anti- RFP and AntiGFP, staining with antibodies against RFP and GFP. On the top, the vectors used for transfection are denoted (see Figure 2 caption for designations), C, lysate of untransfected cells, M, molecular weight marker (7 0 kda). (c) Fluorimetry of HEK293 cell line: fluorescence intensity values in the RFP () and EGFP (2) detection channels are presented. Under the bars, vectors used for transfection are indicated. Error bars indicate standard error of the mean for three independent experiments. based vectors since it provided for the highest level of total expression of both cistrons. In cells transfected with the P sequence-based vector, accumulation of the fraction of uncleaved proteins linked with the peptide was observed, but the amount of the uncleaved proteins (below 2%) was insignificant and can not be a considerable limitation for utilization of this type of vector. The results obtained upon evaluation of the level of P peptide cleavage in HT080 cells contradict the data of [5]. In the cited work, the level of P peptide cleavage in HT080 cells was 80 85% while in our work the value was equal to 99%. The contradiction may be in connection with the differences in protein context of P peptide which may influence the efficiency of its cleavage. In our work, P linked the sequences of RFP and EGFP (RFP-P-EGFP) while in work [5] P peptide linked the sequences of EGFP and mcherry (EGFP-P-mCherry). Besides, the variant of P used in our work differed
QUANTITATIVE COMPARISON OF GENE CO-EXPRESSION 4 E RFP EGFP RFP + EGFP Phase contrast 0 Anti RFP M R E I I2 C R I 56 7 Anti GFP C R E I I2 M 0 I2 7 50 42 Anti Actin K R E I I2 80 (c) Relative fluorescence, % 60 40 20 2 0 I I2 Fig. 4. Analysis of bicistronic construct efficiency in M3 cell line. See Fig. 3 for designations. by the presence of a Thr at its N-terminus. In our case, nucleotide sequence encoding P also differed from the sequence used in the work [5] by codon composition, which could also contribute to the differences revealed. Increased level of cistron expression upon utilization of a P-based vector may be explained by both a higher rate of the reporter protein synthesis and a decreased rate of mrna and protein degradation. In the course of -P- mrna translation both target proteins result from a cap-dependent initiation; in the case of the IRES-containing mrna, the product of the second cistron results from an internal translation initiation which may be less efficient than capdependent initiation, especially when attenuated IRES variants are utilized [9]. The detected differences may also be explained by accelerated degradation of mrna containing IRES since such mrna molecules are subjected to recognition with the NMD system [0]. Besides, the Pro residue at the N-terminus of EGFP remaining upon P processing may decrease the rate of the protein degradation [24] which leads to an increased amount of the protein in the cell. Comparison of the cistron expression efficiency in cells transfected with IRESatt and IRES2-based vectors presents an interesting issue. In the cell lines under study, expression of both cistrons was lower upon transfection with the p-rfp-iresatt-
42 KUZMICH et al. RFP EGFP RFP + EGFP Phase contrast 0 M Anti RFP C R E I I2 E R 7 56 I 0 M Anti GFP C R E I I2 I2 7 3 Anti GAPDH 60 (c) Relative fluorescence, % 40 20 2 0 I I2 Fig. 5. Analysis of bicistronic construct efficiency in HT080 cell line. See Fig. 3 for designations. EGFP vector. IRESatt initiated translation of the cistron much less efficiently than IRES2. Thus, levels of the second cistron expression upon cells transfection with vectors on the basis of IRES2 and IRESatt differed by more than an order of magnitude. The difference in the expression was not that pronounced. The greatest (three-fold) difference between the levels of the first cistron expression upon cell transfection with bicistronic vectors on the basis of IRES2 and IRESatt was observed in M3 cell line. The result may be attributed to the increased degradation rate of mrna containing IRESatt. Probably, active translation of the second cistron prevents mrna with IRES2 form degradation caused by the presence of a termination codon in the middle of the molecule, which can be recognized by the NMD degradation system as a premature termination codon [0, 25]. According to the latest data, in order for mrna with a premature stop codon to degrade, the Up-frameshift suppressor homolog (UPF) protein should interact with terminating ribosomes and move toward the 3' end of the mrna []. One may assume that ribosomes per-
QUANTITATIVE COMPARISON OF GENE CO-EXPRESSION 43 Table 2. Relative content of uncleaved RFP-P-EGFP protein in cell lysates transfected with the P-peptid-based vector Cell line HEK293 M3 HT080 Uncleaved fraction, % to RFP.6 not detected.3 forming the second cistron translation prevent UPF movement to the mrna 3' end. Since utilization of the IRESatt-based vector weakened considerably the second cistron translation, mrna containing the element may degrade faster than mrna containing the active IRES2. CONCLUSIONS Today, IRES EMCV is frequently employed in genetic vector design. However, researchers often use IRES of suboptimal structure, which leads to a decrease in the target protein production. In our study, the attenuated variant of IRES in bicistronic vectors led to a decrease in the level of synthesis of both cistron products. For efficient expression of both cistrons, IRES EMCV closely related to the wild-type IRES should be used. Particularly, attention should be paid to the 3'-terminal sequence of the IRES: the PPT- AUG sequence of the viral IRES should be retained to achieve maximum expression. Cell transfection with the vector based on the P peptide-coding sequence yielded a high total expression of both cistrons in comparison with vectors based on IRES, and the peptide processing efficiency was extremely high; therefore, vectors based on the P sequence are preferable for biotechnology applications where a high level of transgene expression is required and terminal modifications of proteins are not essential. MATERIALS AND METHODS Cell cultures and tissues. In the work, the following cell lines were used: HEK293 (human embryonic kidney cells, CRL-573, ATCC), M3 (mouse melanoma cells, CCL-53., ATCC), and HT080 (human fibrosarcoma cells, CCL-2, ATCC). Cells were cultured on the DMEM/F2 ( : ) medium supplemented with 0% fetal calf serum, 00 un/ml penicillin, 00 μg/ml streptomycin, and 0.25 μg/ml amphotericin (Invitrogen, United States) at 37 C in the atmosphere of 5% CO 2. Genetic constructs design. All constructs studied in the work were designed on the basis of the pgl3 vector (Clontech, United States) with the promoter cloned in instead of the excised firefly luciferase promoter. To construct p-rfp and p-egfp vectors, cistrons of the fluorescent proteins were obtained from pegfp-n (Clontech, United States) and ptag-rfp-n (Evrogen, Russia) plasmids through cleavage at XbaI/HindIII restriction sites (for p-egfp) and XbaI/XhoI sites (for p- RFP). Ligation of the obtained cistrons into the pgl3 vector was performed at the same sites. The p-rfp-iresatt-egfp vector was created in several steps. First, the IRES sequence of the pfb-neo (Stratagene, United States) plasmid was amplified using the IRES for and IRES rev primers (Table 3). Then, the amplified fragment was ligated into the pal-ta vector (Evrogen). At the second stage, the IRESatt-coding sequence was excised of the pal-ta-iresatt plasmid at the BcuI restriction site with 3' ends filled in and at the EcoRI sites (Fig. 6a, ); then it was cloned into the p-egfp vector which has been hydrolyzed beforehand at the BshT site with 3' ends filled in and at the EcoRI sites (Fig. 6a, ). This yielded the p-iresatt-egfp plasmid (Fig. 6a, 2). Then the cistron was excised from the ptag- RFP-N plasmid through hydrolysis at the XbaI site with further fill-in of 3' ends and at the XhoI site (Fig. 6a, 2) and cloned into the p-iresatt-egfp vector which has been hydrolyzed at the EcoRI site with the 3' ends filled in and at the XhoI site. Thus, the p- RFP-IRESatt-EGFP plasmid was obtained (Fig. 6a, 3). To create the p-rfp-ires2-egfp vector, the IRES2- cassette was excised of the pires2- EGFP vector (Clontech, United States) via hydrolysis at the XbaI and PstI sites (Fig. 6b, ) and then cloned into the p-rfp-iresatt-egfp vector from which the -IRESatt- fragment had been excised via hydrolysis at the XbaI and PstI sites. Thus, the p-ires2-egfp plasmid was obtained (Fig. 6b, 2). At the next stage, the cistron was excised of the ptag-rfp-n plasmid via hydrolysis at the XbaI site with 3' ends filled in and at the XhoI site (Fig. 6b, 2); then the cistron was cloned into the p-ires2- EGFP vector which had been hydrolyzed at EcoRI site with 3' ends filled in and at the XhoI site. Thus, the p-rfp-ires2-egfp was obtained (Fig. 6b, 3). The -P- sequence was obtained using PCR in two steps (Fig. 7). First, the pegfp-n template was used to amplify the sequence with the EGFP for/egfp rev primers and ptag-rfp-n template, to amplify the sequence with the RFP for/rfp rev primers. The RFP rev and EGFP for primers carried the P sequences. The Encyclo mixture of DNA polymerases (Evrogen) was used for amplification. After PCR termination, the product was purified using the Wizard SV Gel and PCR Clean- Up System (Promega, United States). At the second stage of amplification, RFP for/ rev and
44 KUZMICH et al. Table 3. Sequences of primers used in the work Primer RFP for RFP rev EGFP for EGFP rev for rev IRES for IRES rev Nucleotide sequence, 5' 3' GAATTCTGCAGTCGACGGTAC AGAGAAGTTCGTGGCTCCGGAACCGGTATTAAGTTTGTGCCCCAG AGACGTGGAGGAGAATCCCGGGCCTATGGTGAGCAAGGGCGAG ATATCTAGATTACTTGTACAGCTCGTCCATG AGCAGGAGACGTGGAGGAGAATCCCG TGCTTCAGCAGAGAGAAGTTCGTGGCTCCG GTTATTTTCCACCATATTGCCGTC GATCGTGTTTTTCAAAGGAAAACC for/egfp rev primer pairs were used. The rev and for primers were complementary to the nucleotide sequence introduced at the first stage of PCR. The rev and for primers were phosphorylated by T4- polynucleotide kinase (Fermentas, Lithuania) beforehand. The Pfu DNA polymerase (Fermentas) was used for amplification; in contrast to the Encyclo mixture, Pfu does not attach an extending adenine residue at the 3' end of the chain being synthesized. The reaction products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega). At the third stage, the PCR products were hydrolyzed at the PstI and XbaI sites of the RFP for and EGFP rev primer sequences and cloned into the p-rfp-ires2- EGFP vector which has been hydrolyzed beforehand at PstI and XbaI sites (allowing for excision of the - IRES2- fragment). This yielded the p-rfp- P-EGFP construct. The plasmids were propagated in E. coli strain DH5α and 00 50 μg plasmids were isolated with the QIAGEN Plasmid Midi Kit (QIAGEN, Germany). Cell transfection was performed in 6-well plates, using Lipofectamine 2000 (Invitrogen, United States) following the manufacturer s recommendations; 4 μg plasmid DNA per well was applied. After transfection, cells were cultured at 37 C for 24 h on DMEM/F2 ( : ) medium without antibiotics containing 0% fetal calf serum, then the medium was replaced with fresh medium containing antibiotics and incubated at 37 C for 24 h. Cell fluorescence microscopy was performed 48 h after transfection using the Nikon Eclipse TE2000-U EcoRI BcuI EcoRI BshTI PstI XbaI PstI XbaI IRESatt IRES2 IRESatt pal-ta-iresatt p-egfp pires2-egfp p-rfp-iresatt-egfp XhoI XbaI 2 XhoI EcoRI IRESatt 2 XhoI XbaI XhoI EcoRI IRES2 ptag-rfp-n p-iresatt-egfp ptag-rfp-n p-ires2-egfp 3 IRESatt 3 IRES2 p-rfp-iresatt-egfp p-rfp-ires2-egfp Fig. 6. Scheme of vector design on the basis of IRES: (a) p-rfp-iresatt-egfp and p-rfp-ires2-egfp. Below the schemes, vector names are indicated, the elements comprising the vectors are denoted in the schemes, as well as restriction sites used for hydrolysis., cytomegalovirus promoter;, RFP-coding sequence;, EGFP-coding sequence; IRE- Satt, attenuated IRES variant; IRES2, IRES variant close to the wild type. Figures 3 on the left indicate stages of cloning.
QUANTITATIVE COMPARISON OF GENE CO-EXPRESSION 45 RFP for PstI RFP rev RFP rev rev EGFP for EGFP rev PCR using Encyclo for EGFP rev XbaI PCR using Pfu IRES2 PstI XbaI PstI XbaI P Fig. 7. Scheme of the p-rfp-p-egfp vector design. See Figs. 2 6 for designations. Primers and restriction nucleases used are also indicated in the scheme. (Nikon, Netherlands) phase-contrast microscope. EGFP fluorescence was excited using the B- filter, and that of RFP, with G2-A filter. Also, phase-contrast micrographs were obtained. Adobe Photoshop CS3 was used to merge the fluorescence images. All micrographs were obtained using the 20-fold magnification lens. Red and green fluorescence measurement in cells. 48 h after transfection, a suspension of a total of 250000 cells was transferred to a 96-well plate and the volume of each well was adjusted to 200 μl with PBS (cell concentration was assessed using the Cell Counter TC 0; Bio-Rad Laboratories, United States). Fluorescence of two proteins, EGFP and RFP, was measured in the work. The measurements were performed on the GENios Pro (Tecan, Austria) microplate fluorometer. The 485 (±20) nm filter was used for EGFP excitation and 535 nm (±25)/590 nm (±0) nm filter, for RFP. Fluorescence was measured twice for each series of transfected cells. Each cell line was transfected at least three times. The average fluorescence intensity for each protein was calculated; the standard error of the mean was calculated for each cell line. Western blotting. Collected cell pellets were dissolved in deionized water, lysed with equal volume of 2 sample buffer (Tris-glycine SDS Sample Buffer Novex by Invitrogen with 4% β-mercaptoethanol) to achieve final cell concentration of 000 cells per μl. Lysate proteins were separated with PAGE in 2% PAA gel in the presence of sodium dodecyl sulfate and transferred to the Immobilone-P (Millipore, United States) PVDF membrane. After blocking with 5% dry milk, the membrane was treated with primary antibodies against the reporter proteins EGFP and RFP, as well as house keeping proteins GAPDH or actin. In the work, the following antibody titers were used: rabbit anti-rfp antibodies (Evrogen), : 3, and mouse anti-egfp, : 000, anti-gapdh, : 5000, and anti-actin antibodies (Santa Cruz Biotechnology, United States), : 400. The membrane was washed 4 times for 5 min with PBS-T solution, then incubated with the secondary HRP-conjugated anti-mouse or anti-rabbit antibodies at : 000 dilution (Santa Cruz Biotechnology), and washed again with PBS-T buffer. The membrane was developed using the Immun-Star HRP Chemiluminescent (Bio-Rad) reagents. Luminescence was registered with the VersaDoc Mp4000 (Bio-Rad) documenting system; the data were treated using the Quantity One software. For each membrane, two images were recorded: one with luminescence visualized, and the other one, in visible light, to detect molecular weight markers. Then, the merged image was obtained using the Adobe Photoshop CS3 software. ACKNOWLEDGMENTS The work was supported by the program of the Presidium of the Russian Academy of Sciences Molecular and Cellular Biology and the program Leading Scientific Schools of the Russian Federation (project no. Nsh 45638.202.4). REFERENCES. de Felipe, P., Curr. Gene Ther., 2002, vol. 2, pp. 355 378. 2. Pestova, T.V., Kolupaeva, V.G., Lomakin, I.B., Pilipenko, E.V., Shatsky, I.N., Agol, V.I., and Hellen, C.U., Proc. Natl. Acad. Sci. USA, 200, vol. 98, pp. 7029 7036.
46 KUZMICH et al. 3. Jang, S.K., Kräusslich, H.G., Nicklin, M.J., Duke, G.M., Palmenberg, A.C., and Wimmer, E., J. Virol., 988, vol. 62, pp. 36 43. 4. Kaminski, A., Howell, M.T., and Jackson, R.J., EMBO J., 990, vol. 9, pp. 3753 3759. 5. Bochkov, Y.A. and Palmenberg, A.C., BioTechniques, 2006, vol. 4, pp. 283 288. 6. Martin, P., Albagli, O., Poggi, M.C., Boulukos, K.E., and Pognonec, P., BMC Biotechnol., 2006, vol. 6. doi:0.86/4-6750-6-4 7. Jang, S.K. and Wimmer, E., Genes Dev., 990, vol. 4, pp. 560 5. 8. Qiao, J., Roy, V., Girard, M.H., and Caruso, M., Hum. Gene Ther., 2002, vol. 3, pp. 88 887. 9. Mizuguchi, H., Xu, Z., Ishii-Watabe, A., Uchida, E., and Hayakawa, T., Mol. Ther., 2000, vol., pp. 376 382. 0. Shikama, Y., Hu, H., Ohno, M., Matsuoka, I., Shichishima, T., and Kimura, J., BMC Mol. Biol., 200, vol.. doi:0.86/-299--42. de Felipe, P., Luke, G.A., Hughes, L.E., Gani, D., Halpin, C., and Ryan, M.D., Trends Biotechnol., 2006, vol. 24, pp. 68 75. 2. Agol, V.I. and Gmyl, A.P., Nat. Rev. Microbiol., 200, vol. 8, pp. 867 878. 3. Donnelly, M.L., Hughes, L.E., Luke, G., Mendoza, H., Dam, E., Gani, D., and Ryan, M.D., J. Gen. Virol., 200, vol. 82, pp. 0 04. 4. Szymczak, A.L., Workman, C.J., Wang, Y., Vignali, K.M., Dilioglou, S., Vanin, E.F., and Vignali, D.A., Nat. Biotechnol., 2004, vol. 22, pp. 589 594. 5. Kim, J.H., Lee, S.R., Li, L.H., Park, H.J., Park, J.H., Lee, K.Y., Kim, M.K., Shin, B.A., and Choi, S.Y., PLoS ONE, 20, vol. 6, p. e8556. 6. de Felipe, P., Luke, G.A., Brown, J.D., and Ryan, M.D., Biotechnol. J., 200, vol. 5, pp. 23 223. 7. Rothwell, D.G., Crossley, R., Bridgeman, J.S., Sheard, V., Zhang, Y., Sharp, T.V., Hawkins, R.E., Gilham, D.E., and McKay, T.R., Hum. Gene Ther., 200, vol. 2, pp. 63 637. 8. Yang, S., Cohen, C.J., Peng, P.D., Zhao, Y., Cassard, L., Yu, Z., Zheng, Z., Jones, S., Restifo, N.P., Rosenberg, S.A., and Morgan, R.A., Gene Ther., 2008, vol. 5, pp. 4 423. 9. Anderson, R.P., Voziyanova, E., and Voziyanov, Y., Nucleic Acids Res., 202, vol. 40, pp. 9. 20. Chan, H.Y., V.S., Xing, X., Kraus, P., Yap, S.P., Ng, P., Lim, S.L., and Lufkin, T., PLoS ONE, 20, vol. 6, p. e28885. 2. Doherty, M., Todd, D., McFerran, N., and Hoey, E.M., J. Gen. Virol., 999, vol. 80, pp. 929 94. 22. Gross, L.A., Baird, G.S., Hoffman, R.C., Baldridge, K.K., and Tsien, R.Y., Proc. Natl. Acad. Sci. U.S.A., 2000, vol. 97, pp. 990 995. 23. Subach, O.M., Malashkevich, V.N., Zencheck, W.D., Morozova, K.S., Piatkevich, K.D., Almo, S.C., and Verkhusha, V.V., Chem. Biol., 200, vol. 7, pp. 3 34. 24. Varshavsky, A., Protein Sci., 20, pp. 298 345. 25. Schwartz, A.M., Komarova, T.V., Skulachev, M.V., Zvereva, A.S., Dorokhov, I.L., and Atabekov, J.G., Biochemistry (Mosc.), 2006, vol. 7, pp. 377 384.. Shigeoka, T., Kato, S., Kawaichi, M., and Ishida, Y., Nucleic Acids Res., 202, vol. 40, pp. 6887 6897. Translated by N. Kuznetsova