RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
|
|
- Neal Wood
- 6 years ago
- Views:
Transcription
1 Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: OMe, 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, 5 CACGUUAAAACCAUACGCACUACGAAACCCC; let7-2 OMe, 5 CUAAAACUAUACAACCUACUACCUCAUCCCA; mir-122wt, 5 UGGAGUGUGACAAUGGUGUUUGU; mir-122p3, 5 UGCAGUGUGACAAUGGUGUUUGU; mir-122*, 5 AAACGCCAUUAUCACACUAAAUA. Duplexes were formed between the wt or p3 forms of mir-122 and mir-122*. The mir-122 sensor plasmid egfp-122 was constructed by PCR-mediated insertion of the sequence 5 ACAAACACCAUUGUCACACUCCA, which has exact complementarity to mir-122, at the Not I restriction site in the 3 noncoding region (NCR) of plasmid pd2egfp-n1 (Clontech). To construct the control vector egfp-124, the sequence 5 TTAAGGCACGCGGTGAATGCCA, which is complementary to the brain-specific mir-124, was inserted. Substitution mutations were introduced into the 3 and 5 NCRs of the H77c replicon vector (1) by overlap PCR using mutagenic primers, and subsequent ligation of the PCR products into the parent vector. The replicon used to measure secreted alkaline phosphatase was synthesized from plasmid Ntat2ANeo(SI), containing the hepatitis delta virus ribozyme sequence downstream of the viral cdna to allow 1
2 generation of replicon RNAs with authentic 3 end sequences. The p3 mutation in the 5 NCR was created by excision and ligation of a fragment spanning the 5 NCR from the H77c p3 mutant plasmid. Cell culture and transfection The Huh7, HeLa and HepG2 cell lines were cultured in Dulbecco s modified Eagle medium supplemented with 10% fetal bovine serum and 1% non-essential amino acids (Gibco, Carlsbad). The Huh7 cell line containing the dicistronic replicon NNeo/C-5B has been described previously (3) and was maintained in the presence of 1mg/ml G418. The cell line En5-3, which was isolated after stable transformation of Huh7 cells with plasmid pltr-seap (2) was maintained in 2µg/ml blasticidin. In vitro transcribed H77c genomic RNA was introduced into Huh7 cells by electroporation as described (1) and RNA was prepared and processed 5 days later. The same method was used to introduce Ntat2ANeo RNA into En5-3 cells. To observe protein synthesis from replication-deficient H77c RNA, we used Dmrie-C (Invitrogen, Carlsbad) to deliver RNA into Huh7 cells, and protein lysates were prepared and processed 20 hours later. This method was used because electroporated cells were not fully adherent at such early timepoints. DNA constructs and oligonucleotides were introduced into cells using lipofectamine 2000 (Invitrogen), according to the manufacturer s instructions. The 2 -O-methylated oligonucleotides and the mir-122 RNA duplexes were delivered at a concentration of 2
3 50nM into cells in 6-well plates. Transfected cells were cultured for 48 hours before harvesting. RNA isolation and Northern blotting Total RNA was extracted from cells using Trizol reagent (Invitrogen), according to the manufacturer s instructions. For detection of mirna expression, 10µg of total RNA was separated on 15% polyacrylamide gels containing 7M urea in 45mM Tris-HCl, 45mM boric acid, 1mM ethylenediaminetetraacetic acid (EDTA) ph 8, transferred to Hybond N+ membrane (Amersham), and hybridized to a 5 32 P-labelled oligonucleotide complementary to mir-122 with the sequence 5 ACAAACACCAUUGUCACACUCCA. For analysis of mrna levels, 2.5µg of RNA from the NNeo/C-5B replicon cells, or 10µg of RNA from cells transfected with H77c RNA, was separated in 1% agarose gels containing 20mM 3-(N-morpholino) propanesulfonic acid (MOPS) ph 7.0, 5mM sodium acetate, 1mM EDTA buffer and 2.2M formaldehyde, and transferred to Zeta-probe membrane (Bio-Rad). The membranes were hybridized in ExpressHyb (Clontech) to random-primed 32 P-labelled DNA probes corresponding to nucleotides of HCV, of egfp, and of γ-actin as indicated. Western blotting and metabolic labeling Protein samples were obtained by scraping cells into RIPA buffer, containing 50mM Tris-HCl ph 7.2, 0.1% sodium dodecylsulfate, 150mM NaCl, 0.5% deoxycholic acid, 1% 3
4 Triton X-100 and a complete protease inhibitor cocktail (Roche, Nutley). 10µg of protein was separated by 12% SDS-PAGE and transferred to Immobilon-P membrane (Millipore). Membranes were probed with the antibody 6G7 directed against the HCV core protein (a gift from Harry Greenberg, Stanford University), or antibodies directed against egfp (Roche) or actin (Sigma, St. Louis). For metabolic labeling, cells were incubated in methionine-free medium for 1 hour before incubation with 35 S-methionine for 1 hour and extraction of protein. 25µg of protein was precipitated using trichloroacetic acid and 35 S-methionine incorporation was quantitated by filter binding. Alkaline phosphatase assay SEAP activity was determined in the culture media of cells transfected with Ntat2ANeo replicons as described in (2). Measurements were made over the first 21 hours without change of medium, after which the culture medium was changed every 24 hours. Sequence data Sequences of 5 and 3 NCRs of different HCV genotypes were obtained from the HCV database ( and representative examples of each genotype are shown in Supplemental Table 1. The strains were: H77c (genotype 1a), GenBank accession no. AF011751; HCV-N (1b), AF139594; JFH-1 (2a), AB047639; NZL1 (3a), D17763; HEMA51 (4a), D45193 and D45194; FR741 (5a), D50466 and D50467; TH271 (6f), D37848 and D
5 References 1. M. Yi, S. M. Lemon, J. Virol. 78, 7904 (2004). 2. M. Yi, F. Bodola, S.M. Lemon, Virol. 304, 197 (2002). 3. M. Ikeda, M. Yi, K. Li, S. M. Lemon, J. Virol. 76, 2997 (2002). Supplementary figure legends Figure S1 Transfection with the OMe oligomer does not affect total protein synthesis in replicon cells. Cells were pulse-labeled with 35 S-methionine 48 hours post transfection, and 35 S-methionine incorporation into total cellular protein was determined by filter binding. Results represent an average of triplicate experiments performed on four separate occasions, with standard deviations. Figure S2 Addition of synthetic mir-122 duplex to NNeo/C-5B replicon cells results in an increase in replicon RNA abundance. The indicated egfp sensor plasmids and wild-type (mir- 122wt) or mutant (mir-122p3) mir-122 duplexes were introduced into cells by transfection using lipofectamine Total RNA was extracted 48 hours later and replicon, egfp and actin RNA levels determined by Northern blotting. Quantitation of 5
6 the HCV-actin mrnas ratios from three independent Northern blot experiments and the standard deviations is shown. Supplementary tables Table S1 Conservation of the predicted mir-122 binding sites among HCV genotypes. The 5 NCR and 3 NCR sequences in HCV containing predicted mir-122 binding sites are shown for each genotype. The hexameric seed matches are indicated in bold type. The 5 and 3 adenosines that flank the seed sequence are highlighted in purple and green, respectively. The stop codon of the viral polyprotein gene is highlighted in pink. 6
7
8
9 Table S1 Genotype 5 UTR 3 UTR 1a 1b UGAUGGGGGCGACACUCCACC UGAAGGUUGGGGUAACACUCCG -AUUGGGGGCGACACUCCACC -----UGAACGGGGAGCUAAACACUCCA 2 -AAUAGGGGCGACACUCCGCC UAGAGCGGCACACACUAGGUACACUCCA 3 --UACGAGGCGACACUCCACC -----UGAGCUGGUAAGAUAACACUCCA 4 -UAUGAGAGCAACACUCCACC UAGGCAGCUUAACACUCCG 5 -UAUUGGGGCGACACUCCACC -----UAGGCUGGGAGCUAAACACUCCA 6 --AAUGGGGCGACACUCCACC -UAGACAGGGAGCAUAAAUAACACUCCA
SUPPLEMENTARY INFORMATION
Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSupplemental Information
Supplemental Information ATP-dependent unwinding of U4/U6 snrnas by the Brr2 helicase requires the C-terminus of Prp8 Corina Maeder 1,3, Alan K. Kutach 1,2,3, and Christine Guthrie 1 1 Department of Biochemistry
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationMechanism of Induction and Suppression of Antiviral Immunity Directed by Virus-Derived Small RNAs in Drosophila
Cell Host & Microbe, Volume 4 Supplemental Data Mechanism of Induction and Suppression of Antiviral Immunity Directed by Virus-Derived Small RNAs in Drosophila Roghiyh Aliyari, Qingfa Wu, Hong-Wei Li,
More informationEric J. Wagner, Brandon D. Burch, Ashley C. Godfrey, Harmony R. Salzler, Robert J. Duronio, and William F. Marzluff
Molecular Cell, Volume 28 Supplemental Data A Genome-Wide RNA Interference Screen Reveals that Variant Histones Are Necessary for Replication-Dependent Histone Pre-mRNA Processing Eric J. Wagner, Brandon
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationModulation of microrna Function by Synthetic Ribozymes
Modulation of microrna Function by Synthetic Ribozymes Hemant Suryawanshi, Vinod Scaria and Souvik Maiti Supplementary Data Methods and Materials Design and modifications of the hammerhead ribozyme The
More information(Supplementary Methods online)
(Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial
More informationBlotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot)
Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Masheal Aljumaah SEP 2018 Learning Objectives: What is blotting? Blotting Techniques Types. Applications for each technique.
More informationCell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL)
Supplementary materials Detailed methods Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL) supplemented with 10% fetal bovine serum. To inhibit glucosidase Ι and ΙΙ, castanospermine
More informationONLINE DATA SUPPLEMENT
ONLINE DATA SUPPLEMENT mir-199a-5p silencing regulates the unfolded protein response in COPD and α1 antitrypsin deficiency Tidi Hassan, Tomás P. Carroll, Patrick G. Buckley, Robert Cummins, Shane J. O
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationSupplementary Information
Supplementary Information Generation of plasmid constructs The replicon-containing vector used to produce the constructs in this study, pfk5.1neo FAK (from which the [FA]neo replicon is produced), contains
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationSupplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes
Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationmicrorna-122 stimulates translation of Hepatitis C Virus RNA
Supplementary information for: microrna-122 stimulates translation of Hepatitis C Virus RNA Jura Inga Henke 1,5, Dagmar Goergen 1,5, Junfeng Zheng 3, Yutong Song 4, Christian G. Schüttler 2, Carmen Fehr
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationSUPPLEMENTARY METHODS. Pool synthesis. An Expedite Nucleic Acid Synthesis System was used to synthesize
SUPPLEMENTARY METHODS Pool synthesis. An Expedite Nucleic Acid Synthesis System was used to synthesize partially randomized DNA oligonucleotides used to construct the four pools used in these experiments.
More informationExperimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationChapter 4 Preparation and Analysis of RNA
Chapter 4 Preparation and Analysis of RNA Preparation purpose: to isolate full-length RNA. Problem: contamination of RNase. RNase is everywhere and difficult to inactivate. - Use freshly de-ionized H 2
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationCRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced
More informationTranscriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationa. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine
Fold change vs uninfeced MOI 0.1 MOI 1 MOI 0.1 MOI 1 MOI 0.001 MOI 0.01 Fold change vs uninfected a 6 4 2 50 kda HPSE * ** * * BHV PRV HSV-2 333 ** * 0 - + + - + + - + + b 50 kda HPSE 3 2 ** *** mock inf
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationTable 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
More informationFig. S1 Fig. S3 Fig. S4 Fig. S5 Fig. S9 Legend for supplementary figures Fig. S1. RFLP analysis of A7339G clones Platelets from the patient were isolated by centrifugation mixed with mtdna-less rho-0
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationNS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5
doi:10.1038/nature09489 Supplementary Figure 1. Methylation pattern of wild type and mutant WNV NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 (N-terminal 300 amino acids) were
More informationB. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationBioimaging of microrna-294 expression-dependent color change. in cells by a dual fluorophore-based molecular beacon
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information for Chemical Communications Bioimaging of microrna-294 expression-dependent
More informationFor gel-shift assays, 2 ul ivtt synthesized protein (Promega) was incubated at room temperature
Supplementary Material and Methods EMSA For gel-shift assays, 2 ul ivtt synthesized protein (Promega) was incubated at room temperature for 30 min in a 15 ul volume containing 15 mm Tris-HCl (ph 7.5),
More informationSupplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis
Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the mir-3b-zeb axis AUTHORS: Peixin Dong, Mihriban Karaayvaz, Nan Jia, Masanori
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationRegulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor
Regulation of ARE transcript 3 end processing by the yeast Cth2 mrna decay factor Manoël Prouteau, Marie-Claire Daugeron and Bertrand Séraphin Supplementary Information Material and Methods Plasmid construction
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationSupplementary Figures S1-S5. a b c
Supplementary Figures S1-S5 a b c Supplementary Figure S1. Generation of IL-17RD-deficient mice. (a) Schematic shows the murine il-17rd gene and the genetrap targeting vector, containing a promoter-less
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationof the Triphosphate of ATP
A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationMutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells
Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.
More information