PrimePCR Assay Validation Report

Similar documents
PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report

Successful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015

Quantitative Real Time PCR USING SYBR GREEN

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Real Time PCR (qpcr) Dott. Finetti Luca

Sequence Annotation & Designing Gene-specific qpcr Primers (computational)

A Systematic Approach to Optimize Real-Time Quantitative RT-qPCR Experiments with the Agilent 2200 TapeStation System

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Technical Review. Real time PCR

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

Human TNF qpcr primer pair

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Optimizing real-time quantitative PCR experiments with the Agilent 2100 bioanalyzer. Application Note. Steffen Mueller. Abstract

Introduction to Real-Time PCR: Basic Principles and Chemistries

PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time)

GeneQuery Human SMUG1-SMUG1P1 Pseudogene Transcription Analysis qpcr Kit (GQP-SMUG1P1) Catalog #GK811

Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.

How to do successful gene expression analysis

Guidelines for Developing Robust and Reliable PCR Assays

Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR

REAL TIME PCR USING SYBR GREEN

Assay Design Considerations, Optimization and Validation

Simple, Complete Workflows for Gene Expression Analysis without RNA Purification

Amplicon size (bp) E ± SD

Reference gene detection assay. Instructions for detection and quantification of a reference gene using SYBR Green detection chemistry

SideStep Lysis and Stabilization Buffer

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Relative Quantification: Data Management & Analysis Settings

Student Learning Outcomes (SLOS)

PrimeScript RT Master Mix (Perfect Real Time)

Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting

PrimeScript RT reagent Kit (Perfect Real Time)

SYBR Green Realtime PCR Master Mix -Plus-

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

lncrna Gene Expression Simplified Long Noncoding RNA Discovery

SYBR Green Realtime PCR Master Mix

THUNDERBIRD SYBR qpcr Mix

SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus

Percent survival. Supplementary fig. S3 A.

Premix Ex Taq (Probe qpcr)

PrimeScript RT Master Mix (Perfect Real Time)

Supplementary Data: Fig. 1S Detailed description of In vivo experimental design

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

Nature Methods: doi: /nmeth Supplementary Figure 1

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist

TB Green Premix Ex Taq (Tli RNaseH Plus)

GT-rich promoters can drive RNA pol II transcription and deposition of H2A.Z in African trypanosomes

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...

SunScript TM One Step RT-qPCR Kit

DEFY THE LAW OF AVERAGES. Single-Cell Targeted Gene Expression Analysis

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

scgem Workflow Experimental Design Single cell DNA methylation primer design

Roche Molecular Biochemicals Technical Note No. LC 12/2000

Real-time PCR Product Selection Guide

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Gene Expression on the Fluidigm BioMark HD

EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide

Transcription:

Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha collagen chain of basement membranes. Like the other members of the type IV collagen gene family this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. arresten NC_000013.10, NG_011544.1, NT_009952.14 Hs.17441 ENSG00000187498 Entrez Gene ID 1282 Assay Information Unique Assay ID Assay Type Detected Coding Transcript(s) Amplicon Context Sequence qhsacid0010223 SYBR Green ENST00000375820, ENST00000397198, ENST00000375815 TAGCACCATGTTGTGACATTAGCTGAGTCAGGCTTCATTATGTTCTTCTCATACA GACTTGGCAGCGGCTGACGTGCGTGCGCAGCTCCCCTGCCTTCAAGGTGGACG GCGTAGGCTTCTTGAACATCTCGCTCCTCTCTATGGTGGCGA Amplicon Length (bp) 120 Chromosome Location 13:110802673-110804711 Assay Design Purification Intron-spanning Desalted Validation Results Efficiency (%) 98 R 2 0.9994 cdna Cq 20.86 cdna Tm (Celsius) 87 gdna Cq 42.33 Page 1/5

Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5

COL4A1, Human Amplification Plot Amplification of cdna generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5

Products used to generate validation data Real-Time PCR Instrument Reverse Transcription Reagent Real-Time PCR Supermix Experimental Sample CFX384 Real-Time PCR Detection System iscript Advanced cdna Synthesis Kit for RT-qPCR SsoAdvanced SYBR Green Supermix qpcr Human Reference Total RNA Data Interpretation Unique Assay ID Detected Coding Transcript(s) Amplicon Context Sequence Chromosome Location Assay Design This is a unique identifier that can be used to identify the assay in the literature and online. This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. This is the amplicon sequence with additional base pairs added to the beginning and/or end of the sequence. This is in accordance with the minimum information for the publication of real-time quantitative PCR experiments (MIQE) guidelines. For details, please refer to the following publication, "Primer Sequence Disclosure: A Clarification of the MIQE Guidelines" (Bustin et al 2011). This is the chromosomal location of the amplicon context sequence within the genome. Exonic: Primers sit within the same exon in the mrna transcript and can potentially co-amplify genomic DNA. If performing gene expression analysis, it is suggested that the samples be treated with a DNase to eliminate potential unwanted signal from contaminating genomic DNA. Exon-exon junction: One primer sits on an exon-exon junction in mrna. When performing gene expression analysis, this design approach will prevent unwanted signal from contaminating genomic DNA. Intron-spanning: Primers sit within different exons while spanning a large intron in the mrna (intron is greater than 750bp). When performing gene expression analysis, this design approach should limit potential unwanted signal from contaminating genomic DNA. Small intron-spanning: Primers sit within different exons with a short intron in between (intron is smaller than 750bp). Small introns may not prevent unwanted signal from contaminating genomic DNA. Efficiency R 2 Assay efficiency was determined using a seven-point standard curve from 20 copies to 20 million copies. While an efficiency of 100% represents a perfect doubling of template at every cycle and is ideal, typical ranges of good assay efficiency are between 90-110%. For difficult targets, assay efficiency outside of this range are accepted and reported accordingly. The R 2 represents the linearity of the standard curve and how well the standard curve data points fit the linear regression line. Acceptable values are >0.98. Page 4/5

cdna Cq Cq value obtained from 25ng of cdna transcribed from universal RNA when performing wet-lab validation of the assay. Note: Not all genes will be expressed at a detectable level in the universal RNA sample. cdna Tm gdna Cq Melting temperature of the amplicon when running a melt curve analysis. Cq value obtained when running the assay with 2.5ng of genomic DNA. This is more than a moderate level of genomic DNA contamination. Intron-spanning and exon-exon junction assay designs can minimize or eliminate genomic DNA detection. Note: Genomic DNA contamination is often present at variable levels. If concerned about genomic DNA contamination, the genomic DNA contamination control assay is recommended to run with your sample to determine if genomic DNA levels are sufficient to negatively impact results. Specificity This value is the percent of specific amplicon reads as measured by next generation sequencing (NGS). While 100% specificity is desirable, small decreases in specificity (<1%) can be due to NGS read errors. More significant reductions are likely due to co-amplification of homologous regions. Note: Since gene expression can be cell type and condition specific, the exact level and impact of co-amplification in a given sample is impossible to predict. If co-amplification is detected, it should be taken into consideration and reported when analyzing gene expression results. Page 5/5