Mutations and Disease

Mutations and Disease

Objectives and lecture plan Describe what are mutations Explain how do we identify mutations Explain how and why mutant proteins lead to disease Describe what kinds of DNA mutations lead to disease 2 CBS, Department of Systems Biology

WHAT ARE MUTATIONS? 3 CBS, Department of Systems biology Presentation name 17/04/2008

What is a mutation? A mutation is easily defined as a change in the nucleotide sequence of a DNA sequence. 4 CBS, Department of Systems Biology

What is a mutation? 5 CBS, Department of Systems Biology

What are the possible effects of a mutation? There are 4 main types of mutations: 1 Silent: there is no effect in the system due to the mutation 2 - Loss of function (LoF): the resulting protein will not be functional 3 - Gain of function (GoF): the resulting protein will show an altered function 4 Conditional: effects will be seen under specific conditions and not during normal life (for example, when a certain stress occurs) 6 CBS, Department of Systems Biology

7 CBS, Department of Systems Biology

What are the possible effects of a mutation? At the molecular level, a mutation can result in the following scenarios: Silent mutation: the codon resulting from the mutation encodes for the same amino acid as the wild type DNA Missense mutation: the codon resulting from the mutation encodes for a different amino acid Nonsense mutation: the codon resulting from the mutation encodes for a STOP codon, resulting in a truncated protein Frameshift mutation: the added/removed base will result in a shifted sequence of codons. 8 CBS, Department of Systems Biology

What are the possible effects of a mutation? 9 CBS, Department of Systems Biology

What are the possible effects of a mutation? 10 CBS, Department of Systems Biology

What are the possible effects of a mutation? 11 CBS, Department of Systems Biology

Genomic Mutations 12 CBS, Department of Systems Biology

Figure 15.4 Chromosomal Mutations (C,D) Genomic Mutations 13 CBS, Department of Systems Biology

APPENDIX 1 Word Game What are the possible effects of a mutation? Wild type: The fat cat ate the rat H U N T E R Point mutation The fat hat ate the rat H U R T E R Frame shift The fat caa tet her at H U M P S Any can lead to Deletion The fat XXX ate the rat The fat ate the rat H U T E R H U - Inversion The fat tar eht eta tac H U R E T N Insertion The fat red cat ate the rat 14 CBS, Department of Systems Biology H U I N T E R

What are the possible effects of a mutation? Wild type: The fat cat ate the rat H U N T E R Point mutation The fat hat ate the rat H U R T E R Frame shift The fat caa tet her at Any can lead to H U M P S Deletion The fat XXX ate the rat The fat ate the rat H U - H U T E R Inversion The fat tar eht eta tac H U R E T N Insertion The fat red cat ate the rat H U I N T E R 15 CBS, Department of Systems Biology

How do we get mutations? Mutations are caused in two ways: Spontaneous mutations occur with no outside influence, and are permanent Induced mutations are due to an outside agent, a mutagen Base Pairing rules: a refresher 16 CBS, Department of Systems Biology

How do we get mutations? 17 CBS, Department of Systems Biology

How do we get mutations? 18 CBS, Department of Systems Biology

How do we get mutations? 19 CBS, Department of Systems Biology

How do we get mutations? A very common scenario: C->T mutations - DNA sequencing revealed that mutations occur most often at certain base pairs. - If 5-methylcytosine loses an amino group, it becomes thymine, a natural base for DNA. - During mismatch repair it is repaired correctly only half of the time. 20 CBS, Department of Systems Biology

How do we get mutations? C->T Figure 15.6 5-Methylcytosine in DNA Is a Hot Spot for Mutations 21 CBS, Department of Systems Biology

How do we get mutations? Summary Mutations can be artificial or natural: Human-made chemicals (e.g., nitrites) or naturally occurring substances (e.g., molds) Radiation from nuclear reactions, bombs, or from the sun Mutations have benefits: Provide the raw material for evolution in the form of genetic diversity - Diversity may benefit the organism immediately if mutation is in somatic cells - Or may cause an advantageous change in offspring Possible costs of mutations: Some germ line and somatic cell mutations are harmful or lethal 22 CBS, Department of Systems Biology

HOW DO WE ANALYSE DNA AND MUTATIONS? 23 CBS, Department of Systems biology Presentation name 17/04/2008

How do we analyse DNA and mutations? Three crucial methods allow us to analyse DNA and identify mutations: Polymerase Chain Reaction (PCR will be described in depth during the last lecture of the course) Restriction enzymes Gel electrophoresis 24 CBS, Department of Systems Biology

Polymerase Chain Reaction - PCR Figure 13.22 The Polymerase Chain Reaction 25 CBS, Department of Systems biology Presentation name 17/04/2008

Restriction Enzymes 26 CBS, Department of Systems Biology

Restriction Enzymes However, bacteria are not dying without a fight. They have evolved a set of proteins, called restriction enzymes, which are able to defend the cell from these attacks. These enzymes are able to chop the viral DNA into smaller, harmless, sequences. Enzymes break bonds restriction digestion at a specific sequence called a recognition sequence or restriction site. To protect the host cell: Methylases add methyl groups to restriction sites on the cell s own DNA. The restriction enzyme passes over the methylated sequence but cuts the unmethylated viral DNA. 27 CBS, Department of Systems Biology

Restriction Enzymes - Restriction enzymes cut DNA at specific sequences, usually palindromic 6-8 mers - Bacterial restriction enzymes can be isolated from the cells that make them and are now widely used in most molecular biology applications 28 CBS, Department of Systems Biology

29 CBS, Department of Systems Biology

Gel electrophoresis - DNA fragments can be separated by gel electrophoresis. - A mixture of DNA fragments is placed in a well in a semisolid gel (agarose) and an electric field is applied across the gel. - Negatively charged DNA fragments move towards positive end. - Smaller fragments move faster than larger ones. 30 CBS, Department of Systems Biology

31 CBS, Department of Systems Biology

Figure 15.8 Separating Fragments of DNA by Gel Electrophoresis (Part 1) 32 CBS, Department of Systems Biology

Figure 15.8 Separating Fragments of DNA by Gel Electrophoresis (Part 2) 33 CBS, Department of Systems Biology

Gel electrophoresis DNA fragments separate and give three types of information: The number of fragments The sizes of the fragments The relative abundance of the fragments, indicated by the intensity of the band 34 CBS, Department of Systems Biology

What do we do next: Once the gel is run and we visualise the bands, we need to identify the various DNA sequences. There are many ways of doing that: We can cut out specific bands and purify the DNA. This purified DNA can be: Sequenced Checked by PCR We can perform a Southern blot 35 CBS, Department of Systems Biology

MstII MstII MstII MstII 36 CBS, Department of Systems Biology

ACCTGTATTAGCAGTGCATGATC! ACTGGTAGATGATCGCCCCTAGC! CTGGGTAGGGATCTCCAAAACTT! 37 CBS, Department of Systems Biology

MstII MstII MstII ACCTGTATTAGCAGTGCATGATC! ACTGGTAGATGATCGCCCCTAGC! CTGGGTAGGGATCTCCAAAACTT! 38 CBS, Department of Systems Biology

39 CBS, Department of Systems Biology

DNA Fingerprinting Let s go back to this image MstII MstII MstII 40 CBS, Department of Systems Biology

DNA Fingerprinting Let s say that in a couple, the mom has that middle MstII site and the father has a silent point mutation in there. MstII MstII MstII Mom MstII MstII MstII Dad MstII MstII MstII MstII MstII MstII Kid MstII MstII MstII 41 CBS, Department of Systems Biology

D M K 42 CBS, Department of Systems Biology

These differences are known as Polymorphisms Two types of polymorphisms: 1) Single nucleotide polymorphisms (SNPs): Inherited variations involving a single base point mutations 2) Short tandem repeats (STRs): Short repetitive sequences occurring side by side on chromosomes, usually in noncoding regions 43 CBS, Department of Systems Biology

Short tandem repeats (STRs) 44 CBS, Department of Systems Biology

HOW DO MUTATIONS IN PROTEINS LEAD TO DISEASE? 45 CBS, Department of Systems Biology

How Do Defective Proteins Lead to Diseases? - As we have been seeing, genetic mutations may make proteins dysfunctional. DNA mutation è Abnormal Protein è Disease Phenylketonuria (PKU) results from an abnormal enzyme phenylalanine hydroxylase normally catalyzes conversion of dietary phenylalanine to tyrosine. The abnormal enzyme has tryptophan instead of arginine in position 408. 46 CBS, Department of Systems Biology

Phenylketonuria Figure 15.12 One Gene, One Enzyme PHENYLALANINE HYDROXYLASE (PAH ENZYME) 47 CBS, Department of Systems Biology

How Do Defective Proteins Lead to Diseases? PAH aa#280 aa#408 WT: GAA (Glu) CGG (Arg) ACTIVE MUT1: MUT2: GAA (Glu) AAA (Lys) TGG (Trp) CGG (Arg) INACTIVE INACTIVE 48 CBS, Department of Systems Biology

How Do Defective Proteins Lead to Diseases? - The primary phenotypes of many inherited diseases are caused by specific mutations leading to protein abnormalities. - Mutations can be dominant, codominant, or recessive; some are sex-linked. 49 CBS, Department of Systems Biology

An interesting case - However, there is at least one disease where the DNA is not touched and yet the relevant protein is abnormal. - This disease is known as Creutzfeld-Jacobs disease (CJD) in humans, Bovine Spongiform Encephalopaty (BSE) in cows, or most commonly, Mad Cow Disease. - It is the most common form of Transmissible Spongiform Encephalopaties (TSE) found in humans. - Both viruses and proteins were suspected of causing TSEs. - The cause, however, was free of DNA or RNA called prions, or proteinaceous infective particles. - No genetic material involved a violation of the central dogma: DNA RNA protein 50 CBS, Department of Systems Biology

PnP c PnP Sc 51 CBS, Department of Systems Biology

52 CBS, Department of Systems Biology

53 CBS, Department of Systems Biology

Prion Proteins - PnP is known to be involved in many TSEs such as: - Chronic wasting disease (found in deer) - Kuru (seen in New Guinea women who ate the brains of dead relatives as part of a funeral ritual) - Scrapie (found in sheep) - Other rare human diseases, such as Gerstmann-Straussler-Scheinker disease and fatal familial insomnia - Kuru gave one of the first hints of disease propagation by ingestion of contaminated material. 54 CBS, Department of Systems Biology

WHAT DNA CHANGES LEAD TO GENETIC DISEASE? 55 CBS, Department of Systems Biology

Genetic markers Genetic markers are reference points for gene isolation A gene or (a fragment of) DNA sequence having a known location on a chromosome, has an easily identifiable phenotype and whose inheritance pattern can be followed. a DNA sequence such as a single nucleotide polymorphism whose presence is correlated with the presence of other linked genes on that chromosome. Genetic linkage: co-inheritance of a marker and a specific allele or, more generally, of 2 traits. For example: Red hair, fair skin and freckles are a common linkage in humans. (for more info http://en.wikipedia.org/wiki/red_hair) 56 CBS, Department of Systems Biology

Genetic Markers Some commonly used types of genetic markers are: RFLP (or Restriction fragment length polymorphism) SNP (or Single nucleotide polymorphism) STR (or Short tandem repeat) 57 CBS, Department of Systems Biology

Figure 15.15 RFLP Markers (Part 1) 58 CBS, Department of Systems Biology

Figure 15.15 RFLP Markers (Part 2) 59 CBS, Department of Systems Biology

Chromosomal Mutations - Genetic disease-causing mutations can involve just a single base pair (as for PKU or SCA), up to entire chromosomes. - Chromosomal abnormalities include the gain or loss of chromosomes (aneuploidy), deletions, and translocations. - Some are inherited, some result from meiotic events. 60 CBS, Department of Systems Biology

THE END 61 CBS, Department of Systems Biology