Nature Immunology: doi: /ni Supplementary Figure 1

Similar documents
Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Nature Immunology: doi: /ni.3694

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

Distribution of human ILCs during chronic lung disease.

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

Flowcytometry-based purity analysis of peritoneal macrophage culture.

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western

Nature Immunology: doi: /ni Supplementary Figure 1

neutrophils (CD11b+, the total Statistical multiple

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Revised: RG-RV2 by Fukuhara et al.

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Dierks Supplementary Fig. S1

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow


Supplementary Fig. 5

Supplementary Figures

Table S1. Oligonucleotide primer sequences

Supplemental Data Supplemental Figure 1.

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

percentage of Nature Immunology: doi: /ni.3728 Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Table S1. Primers used in the study

Supplementary Figure. S1

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

DRG Pituitary Cerebral Cortex

Mouse expression data were normalized using the robust multiarray algorithm (1) using

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

SUPPLEMENTARY INFORMATION

Supplemental Figures. B cell tolerance via GARP-TGF-β axis

Signatures of malaria-associated pathology revealed by high-resolution wholeblood transcriptomics in a rodent model of malaria

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations

Nature Immunology: doi: /ni.3101

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Supplementary Figure S1

Supplementary information

Supplementary Materials for

Hes6. PPARα. PPARγ HNF4 CD36

Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.

Supplementary Figure and Table Legends

Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

SUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1

Figure S1. Schematic of myeloid lineage reporter mouse model used in this study.

Rorα is essential for nuocyte development

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers

Supplementary Fig. 1 (Li et al.)

MLN8237 induces proliferation arrest, expression of differentiation markers and

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

Local proliferation dominates lesional macrophage accumulation in atherosclerosis

Supplementary Materials for

Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV-

Supplemental Table S1. RT-PCR primers used in this study

Supporting information. Supplementary figures.

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

SUPPLEMENTARY INFORMATION

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

TRIM31 is recruited to mitochondria after infection with SeV.

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Nature Biotechnology: doi: /nbt.4086

Supplementary Figure 1

Harvesting pre-polarized macrophages using thermo-responsive substrates

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41

Supplementary Figure 1

Supplementary Figures

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Nature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs.

Supplemental Figure 1

The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes

Supplementary Methods

Percent survival. Supplementary fig. S3 A.

Supplemental Information

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Supplementary Figure 1

Transcription:

Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or F4/80 and CD11c (b) among CD45 + cells in the indicated organs (LP, lamina propria). Bar graphs display the percentage of cells gated as shown in flow cytometry plots. Data are from one experiment representative of two independent experiments (mean and s.d. of three mice per group).

Supplementary Figure 2 Cd11c-CrePparg fl/fl mice with functionally impaired AMs accumulate apoptotic cells in the bronchoalveolar space. (a) CD11c hi CD11b lo autofluorescence hi Siglec-F + Pparg fl/fl AM and CD11c hi CD11b hi autofluorescence hi Siglec-F + arrested immature AM from Cd11c Cre Pparg fl/fl mice were sorted by flow cytometry followed by cytospin and Oil Red O staining. Micrographs were taken at 20 magnification. Scale bar = 50 µm. (b) BAL of Pparg fl/fl, Lysm Cre Pparg fl/fl and Cd11c Cre Pparg fl/fl mice was analyzed by flow cytometry for the presence of dead efluor780 + cells. Representative pictures and plots of three to four mice per group are shown.

Supplementary Figure 3 Cell-autonomous requirement for PPAR-γ during AM development. Mixed BM chimeras (1:4 mixture of CD45.1 + WT:CD45.2 + Cd11c Cre Pparg fl/fl or CD45.1 + WT:CD45.2 + Pparg fl/fl ) were analyzed as in Fig. 3. (a) Reconstitution ratio in peripheral blood leukocyte populations shown as CD45.2 + fold over CD45.1 + cells. (b-d) Histograms show the levels of CD11b and Siglec-F in CD45.1 + WT and CD45.2 + Pparg fl/fl or CD45.2 + Cd11c Cre Pparg fl/fl AM in the BAL of the same mouse (b) and the degree of CD11c expression and autofluorescence in the BAL (c) and lung (d). (e) Bar graphs display the frequencies of ef780 + apoptotic AM among CD45.2 + Pparg fl/fl and CD45.2 + Cd11c Cre Pparg fl/fl cells and their CD45.1 + WT counterparts. Data are from one experiment representative of two independent experiments (mean and s.d. of four chimeras per group, dot plots from one mouse representative of the group).

Supplementary Figure 4 PPAR-γ is required for the maintenance of AM identity. Transcriptomes of Pparg fl/fl AM and arrested immature Cd11c Cre Pparg fl/fl AM sorted from adult mouse lungs by flow cytometry were analysed by microarray. (a,b) Heat maps representing mrna levels in Pparg fl/fl and Cd11c Cre Pparg fl/fl AM of peritoneal macrophage signature-up-genes (a) and transcription factors (b). (c,d) Heat maps representing mrna levels in Pparg fl/fl and Cd11c Cre Pparg fl/fl AM of microglia signature-up-genes (c) and transcription factors (d). The list of signature transcripts was obtained from Reference.

Supplementary Figure 5 PPAR-γ is required for the induction of an AM-specific gene-expression profile and maintenance of AM identity. Transcriptomes of Pparg fl/fl AM and immature arrested Cd11c Cre Pparg fl/fl AM sorted from 11 days old and adult mice and of pre-am from DAB2 were analysed by microarray. Bar graphs show relative expression levels plotted as log 2 -fold change in Cd11c Cre Pparg fl/fl cells compared to Pparg fl/fl. Effects of Pparg-deficiency on genes involved in phagocytosis of apoptotic cells (a), cytokines and modulators of inflammation (b), chemokines and chemokine receptors (c) and tissue remodeling factors (d).

Supplementary Figure 6 PPAR-γ is dispensable for the development and maintenance of most tissue macrophages. (a) Fetal monocytes were sorted from lungs of the indicated strains on E17.5 and recombination of the Pparg fl/fl alleles was assessed by quantitative realtime PCR on genomic DNA. (b,c) E17.5 WT and Vav1 Cre Pparg fl/fl fetuses were analyzed for the presence of fetal monocytes in the blood (b) and the liver (c). (d) Adult WT and Vav1 Cre Pparg fl/fl mice were analyzed for the presence of macrophages in the indicated organs. Numbers represent the frequencies among total cells (blood), CD11b + CD19 (peritoneum), ef780 CD45 + (brain, liver, perigonadal white adipose tissue (WAT)), ef780 CD45 + CD64 + (kidney), ef780 CD45 + CD64 + autofluorescence + (heart) or ef780 CD45 + CD11b + cells (small intestine lamina propria (LP)). (e) Macrophages were sorted as gated in (d), from the indicated organs of adult WT and Vav1 Cre Pparg fl/fl mice and recombination of the Pparg fl/fl alleles was assessed by quantitative real-time PCR on genomic DNA. Subsets of blood monocytes and peritoneal Mø subsets were pooled, respectively. NS, not significant (Student's t-test). Data are from one experiment (a; mean and s.d. of three to five mice per group), from one experiment representative of two

independent experiments (b,c; dot plots of one mouse per group representative of three mice per group), from one experiment representative of two independent experiments (d; dot plots of one mouse per group representative of five mice per group) or from one experiment (e; mean and s.d. of four mice per group).

PrimerBank ID Baz1a fw: 5'-TCCGCCACTACGATGACTTTT-3' 3236353a1 rev: 5'-GCTTCCTGATACGTCAGTCCA-3' C1qc fw: 5'-GGACGGGCATGATGGACTC-3' 113680119c1 rev: 5'-TTCTGTTTGTATCGGCCCTCC-3' Cidec fw: 5'-ATGGACTACGCCATGAAGTCT-3' 30410022a1 rev: 5'-CGGTGCTAACACGACAGGG-3' Csf2 fw: 5'-ACA TGA CAG CCA GCT ACT AC-3' rev: 5'-TCA AAG GGG ATA TCA GTC AG-3' Csf2ra fw: 5'-CTGCTCTTCTCCACGCTACTG-3' rev: 5'-GAGACTCGCCGGTGTATCC-3' 6753534a1 Csf2rb fw: 5'-GTGGAGCGAAGAGTACACTTG-3' rev: 5'-CCAAAGCGAAGGATCAGGAG-3' 165972512c2 Eef1a1 fw: 5 -TCCACTTGGTCGCTTTGCT-3 G6pdx rev: 5 -CTTCTTGTCCACAGCTTTGATGA-3 fw: 5 -CTACAGGTTCAGATGATGTC-3 rev: 5 -CAGCTTCTCCTTCTCCATTG-3 Krt19 fw: 5'-GACCTAGCCAAGATCCTGAGT-3' 55741635c2 rev: 5'-TCAGCTCCTCAATCCGAGCA-3' Lima fw: 5'-GCTGAAAACCAGTGAAAGCAAA-3' 165905584c3 rev: 5'-GGGCCACTAGACTATTCTCAGT-3' Lmo fw: 5'-TTATTTGGGAATAGCGGTGCTT-3' 239937455c2 rev: 5'-TGTAGTGAAACCGATCTCCCG-3' Lsr fw: 5'-CTCAGGTGTGCCAAGCATCTA-3' 255958260c3 rev: 5'-CTTCTGAAGATACGCTCCCATC-3' Ncoa4 fw: 5'-GAAAAGAGGCTATATCCAGGTGC-3' 77404403c1 rev: 5'-AAGAAGCCACTCACTCAGAGA-3' Pparg Supplementary Table 1 Tubb1 Quantitative PCR primer sequences. fw: 5 -GTGATGGAAGACCACTCGCATT-3 rev: 5 -CCATGAGGGAGTTAGAAGGTTC-3 fw: 5 -GCAGTGCGGCAACCAGAT-3 rev: 5 -AGTGGGATCAATGCCATGCT-3 Wwtr1 fw: 5 -GAAGGTGATGAATCAGCCTCTG-3 270265872c2 rev: 5 -GTTCTGAGTCGGGTGGTTCTG-3 Primers used for quantitative real-time RT-PCR are listed. Sequences obtained from the PrimerBank (Center for Computational and Integrative Biology, Harvard Medical School) are accompanied by the PrimerBank IDs.

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback