Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon Materials and Methods Bacterial strain, culture condition and genetic procedure. Micromonospora echinospora ATCC 15835 strains were maintained on NZY agar (1.5% Bacto agar) and cultivated in NZY liquid medium for chromosomal DNA isolation. NZY medium contained 0.2% MgSO 4 6H 2 O, 0.5% NaCl, 0.5% yeast extract, and 1% NZ-amine A. The medium ph was adjusted to 7.0 before autoclave. Thiostrepton was added at the final concentration of 50 µg/ml when necessary. For the production of gentamicins, M. echinospora strains were cultured in GSS medium, which contained 1% soluble starch, 2% glucose, 2.5% soybean meal, 0.1% beef extract, 0.4% yeast extract, 0.2% NaCl, 0.025% KH 2 PO 4, and 0.2% CaCO 3. The medium ph was adjusted to 7.2 before autoclave. The production medium culture was initiated with the NZY liquid culture at the inoculums size of 10% (v/v). The production medium culture was maintained at 30 with a shaking speed of 200 rpm for 6 days.
Intergeneric conjugal transfer was conducted by using E. coli ET12567/pUZ8002 as the donor strain (Paget et al., 1999). M. echinospora strain was cultured in ATCC 172 liquid medium for preparation of the recipient mycelium. The conjugal transfer was performed on AS-1 agar as previously described (Kim et al., 2008). The primer pair used for the polymerase chain reaction (PCR) confirmation of gntk mutants consisted of 5 -TCCGCGGATGCATGGTGGAA-3 (complementary to a range of nt 28,544 to 28,563) and 5 -TGACCGCTGTACAGCGCGAT-3 (nt 26,898 to 26,917) (Fig. 2b) and 5 -ATTTCTAGAAATTAGTCCAGTATGGAGGCC-5 (complementary to a range of nt 28,713 to 28,733; the engineered XbaI site is underlined) and 5 - ATTAAGCTTACTTTCCCGCCAGCTTCCCGG (nt 26,656 to 26,676; the engineered HindIII site is underlined) (Fig. S1). The nt numbers are based on AY524043, where gntk is located in the range of nt 26,720 to 28,636. The PCR was performed with annealing temperature at 50 by using Taq polymerase. Plasmid construction. A gntk inactivation plasmid pgnt-1-35b was constructed by inserting thiostrepton resistance gene (tsr) between DNA fragments flanking gntk, and the DNA fragments that were prepared by PCR amplification from M. echinospora chromosomal DNA. The 3 kb downstream region was amplified with the primer pair of 5 -CAGCACTAGTATGTAGGTCAGCTTGTGCTG-3 (the engineered SpeI site is
underlined) and 5 -GTTCGAATTCTTCGCCGGTGACATGATCGC-3 (the engineered EcoRI site is underlined). The 3-kb upstream region was amplified with the primer pair of 5 -GTAGAAGCTTCCGATCGGAACGTGACGTCC-3 (the engineered HindIII site is underlined) and 5 -CTCATCTAGAACACCGACACGGTCTGGCTC-3 (the engineered XbaI site is underlined). The upstream and downstream fragments were sequentially cloned into phjk-3-14c at the cognate restriction site (Kim et al., 2008). A 7.0-kb XbaI-SpeI fragment was rescued from the resulting plasmid and ligated into the XbaI sites of poj260 to generate pmj-hjk-1-35b, where the 1.5 kb internal fragment of gntk (nt 26,945 to nt 28,520) is eliminated and replaced with the 1.2 kb tsr cassette. Extraction and purification of gentamicins from M. echinospora cultures. The ph of the whole culture broth was adjusted to 2.0 with H 2 SO 4. The acidified broth was agitated for 30 min and then centrifuged. The resulting supernatant was neutralized with NH 4 OH to be used for antibacterial activity assay against Bacillus subtilis ATCC 6633. For HPLC-MS analysis, the ph of the whole broth was adjusted to 5.0 with oxalic acid. This pre-treated culture broth was centrifuged, and the supernatant was recovered after being passed through Advantec filter paper no. 2. The supernatant was applied onto Amberlite IRC-50 (H + ), and bound substances were eluted with 2.0 N NH 4 OH. The antibacterial activity was monitored to collect active fractions.
Analytical procedures. An Agilent 1100 series LC system was used for the HPLC-MS analysis. The separation was performed on a Gemini C-18 column (150 mm 2 mm, 3.0 µm; Phenomenex, USA). A mobile phase consists of 10 mm heptafluorobutyric acid and 5% acetonitrile in water (B) and 10 mm heptafluorobutyric acid and 5% water in acetonitrile (A). The flow rate was kept at 0.2 ml/min. The system was run with the following gradient program: from 5% A to 45% A for 30 min; and then kept at 45% A for 5 min. The sample injection volume was 5 µl. The column temperature was kept at 25. A Bruker HCT 3000 ion trap mass spectrometer was coupled with the HPLC column, and mass spectra were collected in a positive electrospray ionization mode. The dry temperature was 350, the nebulizer gas was 40 psi, and the dry gas was 9 L/min. The mass scan range was m/z 100 to 600, the target mass was m/z 450, and the other parameters were set according to the Smart parameter setting in the positive auto MS/MS mode.
Fig. S1
Fig. S1. Gene inactivation of gntk by double crossover-mediated gene replacement. (A) Genetic maps of M. echinospora ATCC 15835 wild-type (WT) and gntk::tsr ( gntk) in the gntk region showing PCR primers used in the construction of gntk::tsr. (B) Restriction maps of WT and gntk::tsr in the gntk region showing the predicted sizes of PCR products and the restriction digestion fragments. The primer sequences were provided. (C) Electrophoretic analysis of the PCR product obtained with the chromosomes of WT (1) and gntk (2). (D) Electrophoretic analysis of the WT-PCR product with SmaI (1) or SalI (2), and the gntk-pcr with SalI (3) or EcoRV (4). The relevant fragments are indicated with asterisks. Arrow indicates undigested PCR product in Lanes 3 and 4. M indicates the DNA molecular weight marker with the size indication on the left in kb.
References Kim JY, Suh JW, Kang SH, Phan TH, Park SH, and Kwon HJ (2008) Gene inactivation study of gnte reveals its role in the first step of pseudotrisaccharide modifications in gentamicin biosynthesis. Biochem Biophys Res Commun 372, 730 4. Paget MS, Chamberlin L, Atrih A, Foster SJ, and Buttner MJ (1999) Evidence that the extracytoplasmic function sigma factor sigmae is required for normal cell wall structure in Streptomyces coelicolor A3, J Bacteriol 181, 204 11.