Supplementary Online Material. An Expanded Eukaryotic Genetic Code 2QH, UK. * To whom correspondence should be addressed.
|
|
- Alexander Kelley
- 6 years ago
- Views:
Transcription
1 Supplementary Online Material An Expanded Eukaryotic Genetic Code Jason W. Chin 1, T. Ashton Cropp, J. Christopher Anderson, Mridul Mukherji, Zhiwen Zhang and Peter G. Schultz* Department of Chemistry and the Skaggs Institute for Chemical Biology, The Scripps Research Institute North Torrey Pines Road La Jolla CA 92037, USA 1 Current address: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK * To whom correspondence should be addressed. Schultz@scripps.edu
2 Materials and Methods EcTyrRS library construction To create the EcTyrRS library of mutants the five positions targeted for mutation were first converted to alanine codons to produce the A5RS gene. This was split between two plasmids at a unique Pst I site in the gene. The library was created essentially as described(1). One plasmid contains the 5 half of the A5RS gene, the other plasmid contains the 3 half of the A5RS gene. Mutagenesis was performed on each fragment by PCR with oligonucleotide primers for the amplification of the whole plasmid. The primers are doped, containing NNK (N = A + G + T + C and K = G + T) and Bsa I restriction endonuclease recognition sites. Digestion with Bsa I and ligation yielded two circular plasmids, each containing mutant copies of one half of the EcTyrRS gene. The two plasmids were then digested with Pst I and assembled into a single plasmid by ligation, leading to assembly of the full-length mutant genes. The mutant EcTyrRS genes were excised from this plasmid and ligated into pa5rs/trnacua between EcoR I and Not I sites. The library was transformed into S. cerevisiae Mav203: pgadgal4 (2TAG) using the PEG-lithium acetate method yielding ~ 10 8 independent transformants. Selection and screening of mutant synthetases To select mutant synthetases, cells (10 9 ) were grown for 4h in liquid SD -leu, -trp + 1 mm amino acid. Cells were then harvested by centrifugation, resuspended in 0.9 % NaCl, and plated on SD -leu, -trp, -his + 20 mm 3-AT, + 1 mm unnatural amino acid or SD -leu, -trp, -ura, + 1 mm unnatural amino acid. After 48 to 60 hours at 30 C the cells were scraped from the plates into liquid SD -leu, -trp and grown for 15 h at 30 C. Cells were harvested by centrifugation, resuspended in 0.9 % NaCl and plated on SD -leu, -trp % 5-FOA. After 48 h at 30 C cells were scraped into liquid SD -leu, -trp + 1 mm unnatural amino acid and grown for 15 h. Cells were then harvested by centrifugation, resuspended in 0.9 % NaCl, and plated on SD -leu, -trp, -his + 20 mm 3-AT, + 1 mm unnatural amino acid or SD -leu, -trp, -ura, + 1 mm unnatural amino acid. To screen phenotypes of selected cells, colonies (192) from each selection were transferred to wells of 96 well blocks containing 0.5 ml of SD -leu, -trp and grown at 30 C for 24hrs. Glycerol (50 % v/v; 0.5 ml) was added to each well, and the cells replica plated onto agar (SD -leu, -trp; SD -leu, -trp, -his, + 20 mm 3-AT; SD -leu, -trp, - ura) in the presence or absence of 1 mm unnatural amino acid. X-GAL assays were performed on SD -leu, -trp plates using the agarose overlay method.
3 Expression of mutant SOD containing unnatural amino acids and characterization by mass spectrometry The addition of DNA encoding a C-terminal hexahistidine tag, and mutation of the codon for Trp 33 to an amber codon in the human superoxide dismutase gene was performed by overlap PCR using PS356 (ATCC) as a template. hsod(trp 33 TAG) HIS was cloned between the GAL1 promoter and CYC1 terminator from pyes2.1 (Invitrogen, Carlsbad, CA USA). Mutant synthetase and trna genes on pectyrrs/trnacua derived plasmids were co-transformed with pyes2.1 hsod(trp 33 TAG) HIS into the strain InvSc (Invitrogen). For protein expression cells were grown in SD -trp, -ura + raffinose and expression induced at an OD 660 of 0.5 by the addition of galactose. HSOD mutants were purified by Ni-NTA chromatography (Qiagen, Valencia, CA, USA). For mass spectrometry protein bands were visualized by colloidal Coomassie stain. Gel bands corresponding to wild-type and mutant SOD were excised from polyacrylamide gels, sliced into 1.5-mm cubes, reduced and alkylated, then subjected to trypsin hydrolysis essentially as described(2). Tryptic peptides containing the unnatural amino acid were analyzed by nanoflow reversed-phase HPLC/µESI/MS with an LCQ ion trap mass spectrometer. Liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis was performed on a Finnigan LCQ Deca ion trap mass spectrometer (Thermo Finnigan) fitted with a Nanospray HPLC (Agilent 1100 series). 1. W. P. Stemmer, S. K. Morris, B. S. Wilson, Biotechniques 14, (1993). 2. A. Shevchenko, M. Wilm, O. Vorm, M. Mann, Analytical Chemistry 68, (1996).
4 Supplementary Data Table S1- Sequences of Selected aminoacyl-trna synthetases. Residue # # clones Ec TyrRS Tyr Asn Asp Phe Leu p-iodophers-1 Val Asn Ser Tyr Leu 1/8 p-iodophers-2 Iso Asn Ser Met Leu 1/8 p-iodophers-3 Val Asn Ser Met Ala 6/8 p-ometyrrs-1 Val Asn Ser Met Leu 5/13 p-ometyrrs-2 Thr Asn Thr Met Leu 1/13 p-ometyrrs-3 Thr Asn Thr Tyr Leu 1/13 p-ometyrrs-4 Leu Asn Ser Met Ser 1/13 p-ometyrrs-5 Leu Asn Ser Met Ala 1/13 p-ometyrrs-6 Thr Asn Arg Met Leu 4/13 p-acetylphers-1 a Iso Asn Gly Met Ala 10/10 p-benzoylphers-1 Gly Asn Gly Phe Ala 1/2 p-benzoylphers-2 Gly Asn Gly Tyr Met 1/2 p-azidophers-1 Leu Asn Ser Met Ala 1/6 p-azidophers-2 Val Asn Ser Ala Ala 1/6 p-azidophers-3 Leu Asn Ser Ala Ala 1/6 p-azidophers-4 Val Asn Ser Ala Val 1/6 p-azidophers-5 Ile Asp Asn Phe Val 1/6 p-azidophers-6 Thr Asn Ser Ala Leu 1/6 a These clones also contain a Asp165Gly mutation.
5 Fig. S1. Tandem mass spectrum of the tryptic peptide VY*GSIK containing the unnatural amino acids (denoted Y*) are shown with their expected fragment ion masses. Arrow indicates observed b (blue) and y (red) ions series for each peptide. Unnatural amino acids are denoted by a number (as described in the legend to Figure 1b) in A-E. Control spectra for Y*=W, Y, L are shown in F, G and H respectively. A B
6 C D
7 E F
8 G H
Some types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationCase 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005
Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 9 September 005 Focus concept Purification of a novel seed storage protein allows sequence analysis and
More information7.014 Quiz II Handout
7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,
More informationAlgorithm for Matching Additional Spectra
Improved Methods for Comprehensive Sample Analysis Using Protein Prospector Peter R. Baker 1, Katalin F. Medzihradszky 1 and Alma L. Burlingame 1 1 Mass Spectrometry Facility, Dept. of Pharmaceutical Chemistry,
More information7.013 Problem Set 3 FRIDAY October 8th, 2004
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem
More informationSite-directed Mutagenesis
Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences
More informationSupplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across
Structure, Volume 23 Supplemental Information OprG Harnesses the Dynamics of its Extracellular Loops to Transport Small Amino Acids across the Outer Membrane of Pseudomonas aeruginosa Iga Kucharska, Patrick
More information7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.
7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION A human XRCC4-XLF complex bridges DNA ends. Sara N. Andres 1, Alexandra Vergnes 2, Dejan Ristic 3, Claire Wyman 3, Mauro Modesti 2,4, and Murray Junop 2,4 1 Department of Biochemistry
More informationNAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.
MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationMutating Asn-666 to Glu in the O-helix region of the taq DNA polymerase gene
Research in Pharmaceutical Sciences, April 2010; 5(1): 15-19 Received: Oct 2009 Accepted: Jan 2010 School of Pharmacy & Pharmaceutical Sciences 15 Isfahan University of Medical Sciences Original Article
More information11 questions for a total of 120 points
Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive
More informationIdentification of Microprotein-Protein Interactions via APEX Tagging
Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian
More information466 Asn (N) to Ala (A) Generate beta dimer Interface
Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationPurification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract
Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural
More informationPurification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!
Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationBioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
More informationZool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
More informationMBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer
MBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer 1. In a double stranded molecule of DNA, the ratio of purines : pyrimidines is (a) variable (b) determined by the base
More informationIn other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.
In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One
More information1. DNA replication. (a) Why is DNA replication an essential process?
ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationKOD -Plus- Mutagenesis Kit
Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.
More informationMirror-image polymerase chain reaction
Supplementary Information Mirror-image polymerase chain reaction Wenjun Jiang 1,4, Baochang Zhang 2,4, Chuyao Fan 1,4, Min Wang 1,4, Jiaxing Wang 2, Qiang Deng 1, Xianyu Liu 1, Ji Chen 1, Jishen Zheng
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationYeastmaker Yeast Transformation System 2 User Manual
Yeastmaker Yeast Transformation System 2 User Manual Cat. No. 630439 PT1172-1 (PR48710) Published 18 August 2004 Table of Contents I. Introduction 3 II. List of Components 4 III. Additional Materials Required
More information36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-
36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic
More informationDNA.notebook March 08, DNA Overview
DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationDegenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
More informationRestriction Site Mapping:
Restriction Site Mapping: In making genomic library the DNA is cut with rare cutting enzymes and large fragments of the size of 100,000 to 1000, 000bp. They are ligated to vectors such as Pacmid or YAC
More informationMutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More information(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
More informationSupplementary Material
Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDesigning and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive
Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationCS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of
More informationProteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
More informationDaily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
More informationENZYMES AND METABOLIC PATHWAYS
ENZYMES AND METABOLIC PATHWAYS This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. Enzymes build
More informationIntragenic suppressors: true revertants
Suppressor Genetics: intragenic and informational suppressors We have covered one approach used in genetics to study gene function: classical forward genetics where an investigator selects or screens for
More informationpsg5 Vector INSTRUCTION MANUAL Catalog # Revision A For In Vitro Use Only
psg5 Vector INSTRUCTION MANUAL Catalog #216201 Revision A For In Vitro Use Only 216201-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties
More informationChapter 11. Restriction mapping. Objectives
Restriction mapping Restriction endonucleases (REs) are part of bacterial defense systems. REs recognize and cleave specific sites in DNA molecules. REs are an indispensable tool in molecular biology for
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More informationSupplementary Table 1: List of CH3 domain interface residues in the first chain (A) and
Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting
More informationGene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationLevel 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
More informationBuilding with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at
Building with DNA 2 Andrew Tolonen Genoscope et l'université d'évry 08 october 2014 atolonen at genoscope.cns.fr @andrew_tolonen www.tolonenlab.org Yesterday we talked about ways to assemble DNA building
More informationUsing DNA sequence, distinguish species in the same genus from one another.
Species Identification: Penguins 7. It s Not All Black and White! Name: Objective Using DNA sequence, distinguish species in the same genus from one another. Background In this activity, we will observe
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationZwitterion Chromatography ZIC
Zwitterion Chromatography ZIC A novel technique, with unique selectivity, suitable for preparative scale separations? PhD Einar Pontén What is Zwitterion Chromatography? Our definition: Liquid chromatography
More informationN-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry -terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Rinske P. Temming, a Loek Eggermont,
More informationThe Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR
The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR S. Thomas, C. S. Fernando, J. Roach, U. DeSilva and C. A. Mireles DeWitt The objective
More informationCassette denotes the ORFs expressed by the expression cassette targeted by the PCR primers used to
Stanyon, C.A., Limjindaporn, T., and Finley, Jr., R.L. Simultaneous transfer of open reading frames into several different expression vectors. Biotechniques, 35, 520-536, 2003. http://www.biotechniques.com
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationpdual Expression Vector
pdual Expression Vector INSTRUCTION MANUAL Catalog #214501 and #214502 Revision A For In Vitro Use Only 214501-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product.
More informationWelcome to Genome 371!
Genome 371, 4 Jan 2010, Lecture 1 Welcome to Genome 371! If you are not registered - please don t take a seat! (class is full) - see Anne Paul (outside) to get on the wait list If you are registered and
More informationR1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1
Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe
More informationHOUR EXAM II BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam.
Name First Last (Please Print) PID Number - HOUR EXAM II BIOLOGY 422 FALL, 2010 In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. 1 Signature 2 3 4 5 6
More informationIntegrated reactor feeding system amino acid feedback control via online HPLC for productivity gains
Integrated reactor feeding system amino acid feedback control via online HPLC for productivity gains Application Note Biopharmaceuticals Author George Barringer, PhD David Lau, PhD Groton Biosystems Boxborough,
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationName_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
More informationAOCS/SQT Amino Acid Round Robin Study
AOCS/SQT Amino Acid Round Robin Study J. V. Simpson and Y. Zhang National Corn-to-Ethanol Research Center Edwardsville, IL Richard Cantrill Technical Director AOCS, Urbana, IL Amy Johnson Soybean Quality
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationTable of contents. I. Description...2. X. Related Products...11
Cold Shock Expression System pcold TM TF DNA Cat.# 3365 Table of contents I. Description...2 II. Components...2 III. Vector map...3 IV. Storage...3 V. Protocols...3 VI. Multiple cloning site...4 VII. Application...4
More informationExamining the components of your peptide sample with AccuPep QC. Lauren Lu, Ph.D. October 29, 2015, 9:00-10:00 AM EST
Examining the components of your peptide sample with AccuPep QC Lauren Lu, Ph.D. October 29, 2015, 9:00-10:00 AM EST When do I need custom peptides? Custom peptides play an important role in many research
More informationCloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)
Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier
More informationGreen Fluorescent Protein. Avinash Bayya Varun Maturi Nikhileswar Reddy Mukkamala Aravindh Subhramani
Green Fluorescent Protein Avinash Bayya Varun Maturi Nikhileswar Reddy Mukkamala Aravindh Subhramani Introduction The Green fluorescent protein (GFP) was first isolated from the Jellyfish Aequorea victoria,
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationAlpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).
1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds
More informationZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube.
1 ZYMOLYASE PROTOCOLS Smash and Grab Zymolyase PROVIDED BY: DAVID AMBERG 1. Grow cells in 3mls selective media o/n 2. Pellet cells by 2 quick spins in a microfuge 3. Re-suspend cells in 200 u1 of the following
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationPrinciples of Proteomic Methods
Principles of Proteomic Methods Marc Wilkins School of Biotechnology and Biomolecular Sciences What is Proteomics? - proteomics is the study of proteomes - proteomics aims to: separate, identify and characterise
More information