Supplementary Online Material. An Expanded Eukaryotic Genetic Code 2QH, UK. * To whom correspondence should be addressed.

Size: px
Start display at page:

Download "Supplementary Online Material. An Expanded Eukaryotic Genetic Code 2QH, UK. * To whom correspondence should be addressed."

Transcription

1 Supplementary Online Material An Expanded Eukaryotic Genetic Code Jason W. Chin 1, T. Ashton Cropp, J. Christopher Anderson, Mridul Mukherji, Zhiwen Zhang and Peter G. Schultz* Department of Chemistry and the Skaggs Institute for Chemical Biology, The Scripps Research Institute North Torrey Pines Road La Jolla CA 92037, USA 1 Current address: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK * To whom correspondence should be addressed. Schultz@scripps.edu

2 Materials and Methods EcTyrRS library construction To create the EcTyrRS library of mutants the five positions targeted for mutation were first converted to alanine codons to produce the A5RS gene. This was split between two plasmids at a unique Pst I site in the gene. The library was created essentially as described(1). One plasmid contains the 5 half of the A5RS gene, the other plasmid contains the 3 half of the A5RS gene. Mutagenesis was performed on each fragment by PCR with oligonucleotide primers for the amplification of the whole plasmid. The primers are doped, containing NNK (N = A + G + T + C and K = G + T) and Bsa I restriction endonuclease recognition sites. Digestion with Bsa I and ligation yielded two circular plasmids, each containing mutant copies of one half of the EcTyrRS gene. The two plasmids were then digested with Pst I and assembled into a single plasmid by ligation, leading to assembly of the full-length mutant genes. The mutant EcTyrRS genes were excised from this plasmid and ligated into pa5rs/trnacua between EcoR I and Not I sites. The library was transformed into S. cerevisiae Mav203: pgadgal4 (2TAG) using the PEG-lithium acetate method yielding ~ 10 8 independent transformants. Selection and screening of mutant synthetases To select mutant synthetases, cells (10 9 ) were grown for 4h in liquid SD -leu, -trp + 1 mm amino acid. Cells were then harvested by centrifugation, resuspended in 0.9 % NaCl, and plated on SD -leu, -trp, -his + 20 mm 3-AT, + 1 mm unnatural amino acid or SD -leu, -trp, -ura, + 1 mm unnatural amino acid. After 48 to 60 hours at 30 C the cells were scraped from the plates into liquid SD -leu, -trp and grown for 15 h at 30 C. Cells were harvested by centrifugation, resuspended in 0.9 % NaCl and plated on SD -leu, -trp % 5-FOA. After 48 h at 30 C cells were scraped into liquid SD -leu, -trp + 1 mm unnatural amino acid and grown for 15 h. Cells were then harvested by centrifugation, resuspended in 0.9 % NaCl, and plated on SD -leu, -trp, -his + 20 mm 3-AT, + 1 mm unnatural amino acid or SD -leu, -trp, -ura, + 1 mm unnatural amino acid. To screen phenotypes of selected cells, colonies (192) from each selection were transferred to wells of 96 well blocks containing 0.5 ml of SD -leu, -trp and grown at 30 C for 24hrs. Glycerol (50 % v/v; 0.5 ml) was added to each well, and the cells replica plated onto agar (SD -leu, -trp; SD -leu, -trp, -his, + 20 mm 3-AT; SD -leu, -trp, - ura) in the presence or absence of 1 mm unnatural amino acid. X-GAL assays were performed on SD -leu, -trp plates using the agarose overlay method.

3 Expression of mutant SOD containing unnatural amino acids and characterization by mass spectrometry The addition of DNA encoding a C-terminal hexahistidine tag, and mutation of the codon for Trp 33 to an amber codon in the human superoxide dismutase gene was performed by overlap PCR using PS356 (ATCC) as a template. hsod(trp 33 TAG) HIS was cloned between the GAL1 promoter and CYC1 terminator from pyes2.1 (Invitrogen, Carlsbad, CA USA). Mutant synthetase and trna genes on pectyrrs/trnacua derived plasmids were co-transformed with pyes2.1 hsod(trp 33 TAG) HIS into the strain InvSc (Invitrogen). For protein expression cells were grown in SD -trp, -ura + raffinose and expression induced at an OD 660 of 0.5 by the addition of galactose. HSOD mutants were purified by Ni-NTA chromatography (Qiagen, Valencia, CA, USA). For mass spectrometry protein bands were visualized by colloidal Coomassie stain. Gel bands corresponding to wild-type and mutant SOD were excised from polyacrylamide gels, sliced into 1.5-mm cubes, reduced and alkylated, then subjected to trypsin hydrolysis essentially as described(2). Tryptic peptides containing the unnatural amino acid were analyzed by nanoflow reversed-phase HPLC/µESI/MS with an LCQ ion trap mass spectrometer. Liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis was performed on a Finnigan LCQ Deca ion trap mass spectrometer (Thermo Finnigan) fitted with a Nanospray HPLC (Agilent 1100 series). 1. W. P. Stemmer, S. K. Morris, B. S. Wilson, Biotechniques 14, (1993). 2. A. Shevchenko, M. Wilm, O. Vorm, M. Mann, Analytical Chemistry 68, (1996).

4 Supplementary Data Table S1- Sequences of Selected aminoacyl-trna synthetases. Residue # # clones Ec TyrRS Tyr Asn Asp Phe Leu p-iodophers-1 Val Asn Ser Tyr Leu 1/8 p-iodophers-2 Iso Asn Ser Met Leu 1/8 p-iodophers-3 Val Asn Ser Met Ala 6/8 p-ometyrrs-1 Val Asn Ser Met Leu 5/13 p-ometyrrs-2 Thr Asn Thr Met Leu 1/13 p-ometyrrs-3 Thr Asn Thr Tyr Leu 1/13 p-ometyrrs-4 Leu Asn Ser Met Ser 1/13 p-ometyrrs-5 Leu Asn Ser Met Ala 1/13 p-ometyrrs-6 Thr Asn Arg Met Leu 4/13 p-acetylphers-1 a Iso Asn Gly Met Ala 10/10 p-benzoylphers-1 Gly Asn Gly Phe Ala 1/2 p-benzoylphers-2 Gly Asn Gly Tyr Met 1/2 p-azidophers-1 Leu Asn Ser Met Ala 1/6 p-azidophers-2 Val Asn Ser Ala Ala 1/6 p-azidophers-3 Leu Asn Ser Ala Ala 1/6 p-azidophers-4 Val Asn Ser Ala Val 1/6 p-azidophers-5 Ile Asp Asn Phe Val 1/6 p-azidophers-6 Thr Asn Ser Ala Leu 1/6 a These clones also contain a Asp165Gly mutation.

5 Fig. S1. Tandem mass spectrum of the tryptic peptide VY*GSIK containing the unnatural amino acids (denoted Y*) are shown with their expected fragment ion masses. Arrow indicates observed b (blue) and y (red) ions series for each peptide. Unnatural amino acids are denoted by a number (as described in the legend to Figure 1b) in A-E. Control spectra for Y*=W, Y, L are shown in F, G and H respectively. A B

6 C D

7 E F

8 G H

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

More information

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005 Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 9 September 005 Focus concept Purification of a novel seed storage protein allows sequence analysis and

More information

7.014 Quiz II Handout

7.014 Quiz II Handout 7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,

More information

Algorithm for Matching Additional Spectra

Algorithm for Matching Additional Spectra Improved Methods for Comprehensive Sample Analysis Using Protein Prospector Peter R. Baker 1, Katalin F. Medzihradszky 1 and Alma L. Burlingame 1 1 Mass Spectrometry Facility, Dept. of Pharmaceutical Chemistry,

More information

7.013 Problem Set 3 FRIDAY October 8th, 2004

7.013 Problem Set 3 FRIDAY October 8th, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem

More information

Site-directed Mutagenesis

Site-directed Mutagenesis Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences

More information

Supplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across

Supplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across Structure, Volume 23 Supplemental Information OprG Harnesses the Dynamics of its Extracellular Loops to Transport Small Amino Acids across the Outer Membrane of Pseudomonas aeruginosa Iga Kucharska, Patrick

More information

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided. 7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION A human XRCC4-XLF complex bridges DNA ends. Sara N. Andres 1, Alexandra Vergnes 2, Dejan Ristic 3, Claire Wyman 3, Mauro Modesti 2,4, and Murray Junop 2,4 1 Department of Biochemistry

More information

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late. MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

Mutating Asn-666 to Glu in the O-helix region of the taq DNA polymerase gene

Mutating Asn-666 to Glu in the O-helix region of the taq DNA polymerase gene Research in Pharmaceutical Sciences, April 2010; 5(1): 15-19 Received: Oct 2009 Accepted: Jan 2010 School of Pharmacy & Pharmaceutical Sciences 15 Isfahan University of Medical Sciences Original Article

More information

11 questions for a total of 120 points

11 questions for a total of 120 points Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

466 Asn (N) to Ala (A) Generate beta dimer Interface

466 Asn (N) to Ala (A) Generate beta dimer Interface Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural

More information

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open! Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural

More information

BIO303, Genetics Study Guide II for Spring 2007 Semester

BIO303, Genetics Study Guide II for Spring 2007 Semester BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that

More information

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

More information

Zool 3200: Cell Biology Exam 3 3/6/15

Zool 3200: Cell Biology Exam 3 3/6/15 Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either

More information

MBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer

MBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer MBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer 1. In a double stranded molecule of DNA, the ratio of purines : pyrimidines is (a) variable (b) determined by the base

More information

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One

More information

1. DNA replication. (a) Why is DNA replication an essential process?

1. DNA replication. (a) Why is DNA replication an essential process? ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

Mirror-image polymerase chain reaction

Mirror-image polymerase chain reaction Supplementary Information Mirror-image polymerase chain reaction Wenjun Jiang 1,4, Baochang Zhang 2,4, Chuyao Fan 1,4, Min Wang 1,4, Jiaxing Wang 2, Qiang Deng 1, Xianyu Liu 1, Ji Chen 1, Jishen Zheng

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Yeastmaker Yeast Transformation System 2 User Manual

Yeastmaker Yeast Transformation System 2 User Manual Yeastmaker Yeast Transformation System 2 User Manual Cat. No. 630439 PT1172-1 (PR48710) Published 18 August 2004 Table of Contents I. Introduction 3 II. List of Components 4 III. Additional Materials Required

More information

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic

More information

DNA.notebook March 08, DNA Overview

DNA.notebook March 08, DNA Overview DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Thr Gly Tyr. Gly Lys Asn

Thr Gly Tyr. Gly Lys Asn Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human

More information

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify

More information

Restriction Site Mapping:

Restriction Site Mapping: Restriction Site Mapping: In making genomic library the DNA is cut with rare cutting enzymes and large fragments of the size of 100,000 to 1000, 000bp. They are ligated to vectors such as Pacmid or YAC

More information

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity. Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

Supplementary Material

Supplementary Material Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS 1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of

More information

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos

Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary

More information

ENZYMES AND METABOLIC PATHWAYS

ENZYMES AND METABOLIC PATHWAYS ENZYMES AND METABOLIC PATHWAYS This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. Enzymes build

More information

Intragenic suppressors: true revertants

Intragenic suppressors: true revertants Suppressor Genetics: intragenic and informational suppressors We have covered one approach used in genetics to study gene function: classical forward genetics where an investigator selects or screens for

More information

psg5 Vector INSTRUCTION MANUAL Catalog # Revision A For In Vitro Use Only

psg5 Vector INSTRUCTION MANUAL Catalog # Revision A For In Vitro Use Only psg5 Vector INSTRUCTION MANUAL Catalog #216201 Revision A For In Vitro Use Only 216201-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties

More information

Chapter 11. Restriction mapping. Objectives

Chapter 11. Restriction mapping. Objectives Restriction mapping Restriction endonucleases (REs) are part of bacterial defense systems. REs recognize and cleave specific sites in DNA molecules. REs are an indispensable tool in molecular biology for

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting

More information

Gene Expression Translation U C A G A G

Gene Expression Translation U C A G A G Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Level 2 Biology, 2017

Level 2 Biology, 2017 91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with

More information

Building with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at

Building with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at Building with DNA 2 Andrew Tolonen Genoscope et l'université d'évry 08 october 2014 atolonen at genoscope.cns.fr @andrew_tolonen www.tolonenlab.org Yesterday we talked about ways to assemble DNA building

More information

Using DNA sequence, distinguish species in the same genus from one another.

Using DNA sequence, distinguish species in the same genus from one another. Species Identification: Penguins 7. It s Not All Black and White! Name: Objective Using DNA sequence, distinguish species in the same genus from one another. Background In this activity, we will observe

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Zwitterion Chromatography ZIC

Zwitterion Chromatography ZIC Zwitterion Chromatography ZIC A novel technique, with unique selectivity, suitable for preparative scale separations? PhD Einar Pontén What is Zwitterion Chromatography? Our definition: Liquid chromatography

More information

N-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition

N-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry -terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Rinske P. Temming, a Loek Eggermont,

More information

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR S. Thomas, C. S. Fernando, J. Roach, U. DeSilva and C. A. Mireles DeWitt The objective

More information

Cassette denotes the ORFs expressed by the expression cassette targeted by the PCR primers used to

Cassette denotes the ORFs expressed by the expression cassette targeted by the PCR primers used to Stanyon, C.A., Limjindaporn, T., and Finley, Jr., R.L. Simultaneous transfer of open reading frames into several different expression vectors. Biotechniques, 35, 520-536, 2003. http://www.biotechniques.com

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

pdual Expression Vector

pdual Expression Vector pdual Expression Vector INSTRUCTION MANUAL Catalog #214501 and #214502 Revision A For In Vitro Use Only 214501-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product.

More information

Welcome to Genome 371!

Welcome to Genome 371! Genome 371, 4 Jan 2010, Lecture 1 Welcome to Genome 371! If you are not registered - please don t take a seat! (class is full) - see Anne Paul (outside) to get on the wait list If you are registered and

More information

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1 Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

More information

HOUR EXAM II BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam.

HOUR EXAM II BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. Name First Last (Please Print) PID Number - HOUR EXAM II BIOLOGY 422 FALL, 2010 In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. 1 Signature 2 3 4 5 6

More information

Integrated reactor feeding system amino acid feedback control via online HPLC for productivity gains

Integrated reactor feeding system amino acid feedback control via online HPLC for productivity gains Integrated reactor feeding system amino acid feedback control via online HPLC for productivity gains Application Note Biopharmaceuticals Author George Barringer, PhD David Lau, PhD Groton Biosystems Boxborough,

More information

Efficient Multi-site-directed Mutagenesis directly from Genomic Template.

Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

AOCS/SQT Amino Acid Round Robin Study

AOCS/SQT Amino Acid Round Robin Study AOCS/SQT Amino Acid Round Robin Study J. V. Simpson and Y. Zhang National Corn-to-Ethanol Research Center Edwardsville, IL Richard Cantrill Technical Director AOCS, Urbana, IL Amy Johnson Soybean Quality

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Table of contents. I. Description...2. X. Related Products...11

Table of contents. I. Description...2. X. Related Products...11 Cold Shock Expression System pcold TM TF DNA Cat.# 3365 Table of contents I. Description...2 II. Components...2 III. Vector map...3 IV. Storage...3 V. Protocols...3 VI. Multiple cloning site...4 VII. Application...4

More information

Examining the components of your peptide sample with AccuPep QC. Lauren Lu, Ph.D. October 29, 2015, 9:00-10:00 AM EST

Examining the components of your peptide sample with AccuPep QC. Lauren Lu, Ph.D. October 29, 2015, 9:00-10:00 AM EST Examining the components of your peptide sample with AccuPep QC Lauren Lu, Ph.D. October 29, 2015, 9:00-10:00 AM EST When do I need custom peptides? Custom peptides play an important role in many research

More information

Cloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)

Cloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.) Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier

More information

Green Fluorescent Protein. Avinash Bayya Varun Maturi Nikhileswar Reddy Mukkamala Aravindh Subhramani

Green Fluorescent Protein. Avinash Bayya Varun Maturi Nikhileswar Reddy Mukkamala Aravindh Subhramani Green Fluorescent Protein Avinash Bayya Varun Maturi Nikhileswar Reddy Mukkamala Aravindh Subhramani Introduction The Green fluorescent protein (GFP) was first isolated from the Jellyfish Aequorea victoria,

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words). 1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds

More information

ZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube.

ZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube. 1 ZYMOLYASE PROTOCOLS Smash and Grab Zymolyase PROVIDED BY: DAVID AMBERG 1. Grow cells in 3mls selective media o/n 2. Pellet cells by 2 quick spins in a microfuge 3. Re-suspend cells in 200 u1 of the following

More information

Site-directed mutagenesis of proteins

Site-directed mutagenesis of proteins IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction

More information

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints

More information

Principles of Proteomic Methods

Principles of Proteomic Methods Principles of Proteomic Methods Marc Wilkins School of Biotechnology and Biomolecular Sciences What is Proteomics? - proteomics is the study of proteomes - proteomics aims to: separate, identify and characterise

More information