CHAPTER THREE RESULTS

Similar documents
CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract

Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory

DERMATOPHYTE PCR KIT. SSI Diagnostica

PlantDirect TM Multiplex PCR System

Chapter 10 (Part II) Gene Isolation and Manipulation

Supplementary Figure S1: Initial PrimerDimer primer pairs analysed using bisulfite PCR

Genome Sequence Assembly

Factors affecting PCR

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

DEC PCR KIT. SSI Diagnostica

Quant One Step RT-PCR Kit

Polymerase Chain Reaction PCR

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

BIOFOOD Kits Kits for vertebrate species detection and identification in food using genetic markers (Ref )

Puro. Knockout Detection (KOD) Kit

HiPer Real-Time PCR Teaching Kit

Lab Book igem Stockholm Sortase A. Week 5

Multiplex PCR Assay Kit Ver.2

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose

FMF NIRCA PROTOCOL STEP 1.

Supporting Information

Application Notes

Thermal cycler amplification robustness: a comparison of several models

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

Bootcamp: Molecular Biology Techniques and Interpretation

SuperiorScript III cdna Synthesis Kit Instruction Manual

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Note Name Sequence F1-DCL1 AAAAACTAGTCTGGGCCCGT Dcl1 KO F1-DCL1-

Positive control kit for enzymatic mismatch cleavage and agarose gel visualization (version 2.4)

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Testing GM crops. Mitesh Shrestha

Petra, Tamannae. Made new 1:10 dilutions of P001 and P ul primer to 18 ul water

Report on the Testing of a PCR-based Detection Method for Identification of Florigene Moonaqua GM Carnation

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR

DETERMINATION OF THE Rh FACTOR BY PCR

Polymerase Chain Reaction

Polymerase chain reaction: advantages and drawbacks

General Product Insert. End-Point PCR/RT-PCR Kit Product# EPxxxxx

3. How can you test a food to find out if it contains materials derived from a GMO?

Short Tandam Repeat (D1S58) Detection Kit (for Academic Instructions) Product # 54600

Electronic Supplementary Information. Target-induced Intermolecular Hybridization

Meng-Shiou Lee 1*, Ting-Ying Su 2, Yi-Yang Lien 3, Shyang-Chwen Sheu 2*

DNA Amplification RNA Amplification Real-Time PCR Customized PCR

Polymerase Chain Reaction-361 BCH

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS

CLONING AND EXPRESSION OF PSEUDOMONAS AERUGINOSA PA01 GENES IN E.COLI DH5Α FOR THE DETECTION OF ARSENIC IN CONTAMINATED WATER SAMPLE

Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability

BRCA MAQ USER GUIDE Version 1.0

Table of contents. I. Description...2. Kit Components...2. Storage...2. Required reagents and equipment...2. V. Protocol...3. Example Experiment...

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

7.012 Problem Set 5. Question 1

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

Puritan Report for Batch PC Lot# 3127, Blue Pink and Yellow. Swabs were received for testing on May 22, 2012

Page 1 of 10 MIDTERM EXAM OF BIO

Protocol Version 2. M. Mazzara, N. Foti, M. Maretti, C. Savini and G. Van den Eede. Method development: Syngenta Crop Protection AG

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio

A comparative performance evaluation of illustra Ready-To-Go GenomiPhi V3 and illustra GenomiPhi V2 DNA amplification kits

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

GenScript TissueDirect TM Multiplex PCR System

Rapid amplification of cdna ends (RACE)

This Product Description is only valid for Lot No. 36V.

Dirofilaria immitis PCR Detection Kit Product # 44500

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)

Executive Summary. clinical supply services

Intended Use Norgen s Giardia intestinalis End-Point RT-PCR Kit is designed for the detection of Giardia

Application Note Detecting low copy numbers. Introduction. Methods A08-005B

Taq + dntps #EZ U

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

Next Generation Polymerase Chain Reaction

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

Biotechnology Chapter 20

Product# EP Product Description

Technical Review. Real time PCR

Polymerase Chain Reaction

AdnaTest EMT-2/StemCell Add-on ProstateDetect

Roche Molecular Biochemicals Technical Note No. LC 12/2000

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

The Polymerase Chain Reaction. Chapter 6: Background

TECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY)

Mycobacterium paratuberculosis

Aims of this case study

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Real Time PCR (qpcr) Dott. Finetti Luca

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only

Aspergillus niger End-Point PCR Kit Product# EP32900

PCR Results: CTSA T741, T742, T743 (Mt-12-85)

Agenda (Monday-Wednesday)

BIOFOOD Kits Kits for vertebrate species detection and identification in food using genetic markers

..C C C T C A T T C A T T C A T T C A T T C A..

AccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81

Erwinia amylovora End-Point PCR Kit Product# EP35100

Transcription:

CHAPTER THREE RESULTS 3.1 PCR-SSP In this study, the PCR SSP technique was used to amplify the GYP hybrid gene from the genomic DNA samples and detect GP.Mur, GP.Bun, GP.Hop (148 bp), GP.HF and GP.Hut (151 bp). Presence of the GYP hybrid was indicated by an amplicon size between 100 bp and 200 bp; as the primer can amplify both a 148 bp DNA fragment (GP.Mur, GP.Bun, GP.Hop) and a 151 bp DNA fragment (GP.HF and GP.Hut). However, the two amplicons could not be separated by using 1.7% agarose gel electrophoresis. The band patterns from the PCR-SSP products of amplified GYP (B-A-B) genes were detected. For the positive control samples (HGH) the size of the product is 434 bp. In addition, when non-specific amplicons were detected, the test was repeated. The negative control (NTC) should not contain an amplified product; therefore, PCR-SPP was repeated also when product was detected in the NTC. In the PCR-SSP, for the total of 77 samples which included in the study, the GYP hybrid gene was amplified in 15 out of 34 samples in Malays, 24 out of 34 in Chinese, and none was detected in 6 samples of Indians and the 3 samples of foreigners (Table 3.1). 28

Table 3.1: Result of PCR-SSP of Malays, Chinese and Indians. Race umber of samples PCR-SSP (+ve) Malays 34 15 Chinese 34 24 Indians 6 0 Foreigners 3 0 (A) (B) Fig. 3.1 Gel electrophoresis result of PCR-SSP products from different samples: (A) represents positive and negative results for GYP hybrid gene, the expected fragment sizes are 148 bp and 151 bp. Lanes 10-19: positive samples, Lanes 2-9: negative samples, Lane 20: negative control and Lane 1: 100-bp DNA Ladder Plus. (B) represents the control sample (HGH) which is 434 bp. 29

Fig. 3.2 Gel electrophoresis result of PCR-SSP products from different samples, the correct PCR product sizes are 148 bp and 151 bp, Ladder (L) is 100 bp and negative control is NTC (non template control). 30

Table 3.2: Amplification results of PCR products as in Fig. 3.2, including the different ethnic groups; M: Malays, C: Chinese, I: Indians and N: Non- Malaysian. From lane 1 20; lane 1: 100 bp DNA ladder, lanes (2 19): positive (+) and negative (-) sample and lane 20: negative control (NTC). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Lane o. L 50 49 48 46 43 44 42 41 40 27 26 25 24 23 22 5 4 3 NTC Sample o. C C C I C C C C C C C C C C C N C C Race - + + - + - + + + - - - - + + - + - - Results L 78 77 76 75 70 69 68 64 63 62 61 60 59 58 57 56 55 54 53 Sample o. C C C C C N N C C C C C C C C C C C C Race - + + + + - - + + + + + + + + - + - + Results 31

Fig. 3.3 Gel electrophoresis result of PCR-SSP products of different samples. 32

Table 3.3: Amplification results of PCR products as in Fig. 3.3, including the different ethnic groups; M: Malays, C: Chinese and I: Indians.. From lane 1 20; lane 1: 100 bp ladder, lanes (2 19): positive (+) and negative (-) sample and lane 20: negative control (NTC). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Lane o. L 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 2 1 NTC Sample o. M M M M M I M I M M M M M M M M M M Race - - + + - - + - - + - + - - - - + + - Results L 66 65 52 47 45 43 42 39 38 37 36 35 34 33 32 31 30 29 28 Sample o. I M C M M C C M M M M M M M M I M M M Race - + + + - + + + + + - - - - + - - - - Results 33

3.2 Optimization of PCR-SSP Although the PCR-SSP technique was performed in this study as monoplex PCR, it was initially started as a multiplex by using two sets of primers including the internal control (IC) primers. However, the amplified products were only for the IC (434 bp) even various dilutions from the stock or concentrated solution of the IC primers were done; for instance, 1:10 and 1:20. Fig.3.4 is an example for 1:10 dilution of IC primers. Fig. 3.4 The amplification results of the PCR-SSP products, gel electrophoresis image represents results of amplification products for different samples using PCR-SSP as a Muliplex. The bands explain that the ampilification results were for the IC (434 bp); lanes 2 19 (A) and 6 19 (B): different samples, lane 1(A), lane 5(B) and lane 20(B): 100 bp DNA ladder. 34

3.3 Comparison of PCR-SSP Results In Different Ethnic Populations The PCR-SSP technique which was used in this study detected and confirmed the presence of one of the GYP hybrid gene (GYP B-A-B) in different ethnic group of Malaysian populations (Malays, Chinese and Indians) and showed difference in prevalence rates between them. It was detected more commonly in Chinese compared to Malays.Whereas not detected in Indian ethnic group (Table 3.4) and (Fig. 3.4). Table 3.4: Result of PCR-SSP for Malays, Chinese and Indians as a percentage (%); compared to the total number of each ethnic group. Race umber of samples PCR-SSP (+ve) % Malays 34 15 44.1 % Chinese 34 24 70.6 % Indians 6 0 0 % 35

Fig. 3.5 Percentage of GYP hybrid genes for different ethnic groups; Malays, Chinese and Indians. Overall, the results of this study identified the presence of the GYP hybrid gene in Chinese and Malays but not in Indians. 36