Protocol for induction of expression and cell lysate production

Similar documents
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

Arf6 Activation Assay Kit

Immunoprecipitation Protocol

ChIP protocol Chromatin fragmentation using the Covaris S2 sonicator by Ethan Ford (version 12/1/11) X- link Cells

Cdc42 Activation Assay Kit

Rab5 Activation Assay Kit

For Research Use Only. Not for use in diagnostic procedures.

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

RheB Activation Assay Kit

Protocol Immunprecipitation

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *

A General Protocol for GST Pull-down Lili Jing *

Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *

Gα 13 Activation Assay Kit

Cross Linking Immunoprecipitation

Gα i Activation Assay Kit

Chromatin Immunoprecipitation (ChIP)

VDL102.3 Production of Adenovirus in 293 Cells

IMMUNOPRECIPITATION (IP)

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D

OPPF-UK Standard Protocols: Mammalian Expression

ExKine Total Protein Extraction Kit

Immunoprecipitation (IP)

Human ipsc-derived Renal Proximal Tubular Cells. Protocol version 1.0

SUPPLEMENTARY INFORMATION

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;

Modified Rapid MAIPA Protocol

Western Blot Tool Box

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Reagents Description Storage

1. Cross-linking and cell harvesting

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Cat. No. MG17PG-1ml XPRESSAFFINITY PROTEIN G- MAGNETIC NANOPARTICLES (MNP) FOR RESEARCH APPLICATIONS

LHCN-M2 cell culture, differentiation treatment, and cross-linking protocol.

SDS-PAGE GEL. Bio-Rad EDU Cell scraper TPP PBS Life Technologies Protein Standard Ladder Bio-Rad

Supporting Information

VDL602.2 RAPID ASSAY FOR DETERMINING ADENOVIRAL VECTOR TITER

SUPPLEMENTARY MATERIALS AND METHODS

Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by

TOOLS Cytoplasmic and Nuclear Protein Extraction Kit

Low-cost DNA extraction for use in TILLING and Ecotilling assays

Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533

Supplementary Material

Nascent Chromatin Capture. The NCC protocol is designed for SILAC-based massspectrometry

Supplemental Information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No

Supporting Information

Chromatin Immunoprecipitation (ChIP) Assay*

Assay ID Assay name Description Components of the assay SYS-A044 ERBB2-3/ SH2(GRB2) receptor. readout

Product Datasheet. Histone H3 [Trimethyl Lys4] Antibody NB SS. Unit Size: mg

Protein A Agarose Immunoprecipitation Kit

Antibody Array User s Guide

Product Datasheet. Histone H3 [ac Lys4] Antibody NB SS. Unit Size: mg

Chemicals Ordering Information

Yeast Nuclei Isolation Kit

GST Fusion Protein Purification Kit

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

For the development of sandwich ELISAs to measure phosphorylated Erythropoietin Receptor (Epo R) in cell lysates.

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

HOOK 6X His Protein Spin Purification (Bacteria)

3T3-L1 Differentiation Protocol

Minute TM Total Protein Extraction Kit for Animal Cultured Cells and Tissues User Manual v5

Protocol(Research use only)

MAP Kinase (ERK1/2) Activity Assay Kit

TITLE: Chromatin shearing with SDS detergent buffers

Strep-Spin Protein Miniprep Kit Catalog No. P2004 & P2005

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng

VDL300.3 PRODUCTION OF RETROVIRAL VECTOR BY TRANSIENT TRANSFECTION

Whole Mount IHC Protocol

Anti-HB-EGF (Human) mab

Plasmid Midiprep Purification Kit

Long-lived protein degradation assay

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406

Assay ID Assay name Description Components of the assay. 1. SYS-V441, phtr2a-v2r-ntev-tevs-gv. Cells 1. SYS-C10, PC12 (only SYS-A102C10)

Assay ID Assay name Description Components of the assay SYS-A115 DRD5/ARRB2 targetscreener

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

USER GUIDE. HiYield TM Total RNA Extraction Kit

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536

Note that steps 1-16 are identical to steps 1-16 in the immunostaining protocol, except 0.5X PBtween is used in this protocol rather than 0.5X PBT.

Cell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)

This Document Contains:

ab Ran Activation Assay Kit

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit

PathProfiler MCM2 ELISA. Cat. No E {Includes choice of two (2) Detection Antibody Modules}

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

T H E J O U R N A L O F C E L L B I O L O G Y

VDL106.3 LARGE-SCALE AMPLIFICATION AND PURIFICATION OF ADENOVIRAL VECTOR

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Protocol. GoClone Reporter Constructs: Sample Protocol for Adherent Cells. Tech support: Luciferase Assay System

Tissue & Cell Genomic DNA Purification Kit. Cat. #:DP021/ DP Size:50/150 reactions Store at RT For research use only

Purification of GST-tagged proteins using PureCube Glutathione Agarose

HOOK 6X His Protein Purification (Bacteria)

Zebrafish ChIP-array protocol: version 1 August 5 th 2005

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System

Assay ID Assay name Description Components of the assay SYS-A124 ADRB2/ARRB2 targetscreener

Transcription:

Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected Tet-ON HeLa cells with 3 different concentrations of doxycycline: - 0 ng/ml: to analyze the recognition of the protein of interest by the antibodies to be validated at endogenous levels of the protein of interest (if the protein of interest is expressed in HeLa cells). This treatment also provides the baseline for the doxycycline inducible expression of the protein of interest from HuEV-A plasmid. - 50ng/ml: to analyze the IP effciency of the antibody to be validated at a low expression level of the protein of interest. - 1µg/ml: to analyze the IP effciency of the antibody to be validated at maximum expression level of the protein of interest. Also, overexpression of the protein enables to use an anti-flag antibody. After treatment, cells are lysed to produce enough cell lysate to be used for IP assays with 3 different antibodies. 2.0 Materials Glassware/Plasticware/Instruments and tools Inverted fuorescence microscope (Leica DM IL) autoclaved 1.5 ml tubes Axygen scientifc cat.# 22-281 96 deep well plates Fisher cat.#12-566-121 Axygen mini tube 96-well rack system- Axygen cat#mts-11-12-c-r Reagents DMEM 1X (Dulbecco modifed Eagle medium) GIBCO cat.# 11965 Opti-MEM (Reduced serum medium)- GIBCO cat.# 31985 Tryple 1X GIBCO cat.# 12604 Tet system approved FBS Clontech cat. #631106 PBS 1X (Phosphate buffered saline ph7.4) GIBCO cat.# 10010 Doxycycline Clontech cat.# 631311 Lysis Buffer: 100mM Tris-HCl ph 7.4 (made from Tris-Base US Biological cat.# 18600) 150mM NaCl (Sodium chloride SIGMA cat.# S5886) 25mM NaF 50 M ZnCl 2 15% glycerol (Fisher cat.# G33-500) 1% Triton X-100 (Sigma-Aldrich P1379) Supplement at the time of use with protease inhibitors tablets (Roche cat.# 11 836 145 001) 3.0 Doxycyclin induction and cell lysate After cells have been plated for transfection (section 2) doxycycline is added as follow: Freshly prepare a two working solution (WS) of 100ug/ml and 5ug/ml doxycycline from a 1mg/ml stock solution Add in the respective wells 100 l of doxycycline WS to obtain a fnal concentration of 1000 and 50ng/ml doxycycline respectively (10ml fnal volume). Add 20 l OptiMEM to the 0ng/ml doxycycline wells. Incubate for 48-72 hrs to induce the expression of the gene of interest. Before lysis the YFP expression in live cells is checked using a fuorescence inverted-microscope (Leica DM IL). Pictures to observe the pattern of expression and localization of the protein if interest are collected Aspirate the media from all wells and add 1 ml of Tryple solution to each plate.

Incubate with rocking at RT for 10 minutes Add 1.5 ml of PBS supplemented with 20% FBS Collect and distribute the cells into the four replicate sets wherein each set comprises of three mini tubes. Each mini-tube in a set (labeled A-C) corresponds to cell-pellets obtained from the different doxycycline inductions (see section 3). The approx. number of cells in a given tube per set is: Tube A. 0ng/ml doxycycline cells (~62,500 cells) Tube B. 50ng/ml doxycycline cells (~125,000 cells) Tube C. 1000ng/ml doxycycline cells (~187,500 cells) Spin cells at 3000 rcf for 2 minutes (cell pellet are stored at -80 C until use). Lyse the cells with lysis buffer supplemented with proteases inhibitor freshly added. Add 180 l of lysis buffer in tube 1, 360 l in tube 2 and 540 l in tube 3. Pellets are resuspended by vortexing for 2mins followed by incubation at RT for 10mins to ensure lysis. Spin the lysates at 4000 rcf for 15 min. Transfer the supernatant into 96 deep well plates in this order: 1 2 3 4 5 6 7 8 9 10 11 12 Lysate from tube= > A B C A B C A B C EMPTY A Lysate Plate-1 Lysate Plate-9 Lysate Plate-17 B Lysate Plate-2 Lysate Plate-10 Lysate Plate-18 C Lysate Plate-3 Lysate Plate-11 Lysate Plate-19 D Lysate Plate-4 Lysate Plate-12 Lysate Plate-20 E Lysate Plate-5 Lysate Plate-13 Lysate Plate-21 F Lysate Plate-6 Lysate Plate-14 Lysate Plate-22 G Lysate Plate-7 Lysate Plate-15 Lysate Plate-23 H Lysate Plate-8 Lysate Plate-16 Lysate Plate-24 N.B. Only 150 l/300 l /450 l of the cleared lysates from 0/50/1000 ng/ml reactions is recovered and the rest is discarded. Clear lysates are directly processed for IP.

AV-05 Total lysate preparation 1.0 Introduction / Description This method describes the preparation of total lysate to be used for IP and as INPUT in Western blotting analyses described in the protocol for immunoprecipitation and protocol for western blot analysis. 2.0 Materials Reagents NuPAGE LDS sample buffer (Life technologies corp. cat.# NP007) -mercaptoethanol (SIGMA-Aldrich cat.# M6250) 96 deep well plates Fisher cat.#12-566-121 3.0 Total Lysate preparation Mix 100ul of lysate from each sample to 33 l of 4X LDS sample buffer (Invitrogen) supplemented with 5% -mercaptoethanol (this will be the Input sample to be used as for Western blot together with the immunoprecipitation samples) Denature the lysates in 1XLDS sample buffer at 90 C for 10 minutes