Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on the cross sections through the spine at E12.5, E13.5, E14.5 or E15.5. Arrows indicate DRG. SC: spinal cord. (Scale bar: 100 μm). 1
Supplementary Figure 2. Normal morphogenesis of DRG neurons in PN-ZB20KO mice. (a) Nissl staining showed no difference of total neurons between control and PN-ZB20KO mice. Six L4 DRG from 3 mice were analyzed for each genotype (Scale bar: 100 μm). (b) DRG sections of PN-ZB20KO and control mice were labeled with anti-peripherin and anti-neurofilament (N200) antibodies. There was no difference in the proportions of peripherin and neurofilament (N200)-expressing neurons between PN-ZB20KO and control mice. 12-16 DRG sections per animal (4 animals of each genotype) were stained and analyzed (Scale bar: 50 μm). All data were analyzed by Student s t-test. Values are the mean ± s.e.m. 2
Supplementary Figure 3. Nissl staining showed no difference of total neurons in DRG between control and NS-ZB20KO mice (Scale bar: 50 μm). Six L4 DRG from 3 mice were analyzed for each genotype. Data were analyzed by Student s t-test. Values are the mean ± s.e.m. 3
Supplementary Figure 4. ZBTB20 ablation does not alter the generation of IB4 or CGRP neurons in DRG of NS-ZB20KO mice. (a-b) DRG sections from control or NS-ZB20KO mice were labeled with biotin-conjugated lectin IB4 (a) or anti-cgrp antibody (b) prior to visualization with the indirectly coupled Alexa Fluor 594 (red). (Scale bar: 100 μm). (c) IB4-binding nonpeptidergic neurons and CGRP-expressing peptidergic neurons were present at normal levels in DRG of NS-ZB20KO mice. 12-16 DRG sections per animal (4 animals of each genotype) were stained and analyzed. Data were analyzed by Student s t-test. Values are the mean ± s.e.m. 4
Supplementary Figure 5. ZBTB20 ablation does not alter the generation of TrkA or Ret neurons in DRG of NS-ZB20KO mice. In situ hybridization was performed with RNA probes for TrkA, Ret, or SCG10 on L4 DRG from control and PN-ZB20KO mice. The pan-neuronal marker SCG10 was used to determine the total number of neurons so that percentages can be calculated. (Scale bar:50 μm). 5
Supplementary Figure 6. Expression of nociceptive ion channels and sensory receptors in PN-ZB20KO mice. In situ hybridization performed with indicated probes, and the numbers of neurons that express these markers were not significantly changed in PN-ZB20KO DRG. (Scale bar:50 μm). 6
Supplementary Figure 7. ZBTB20 does not bind to the promoters of TRPV1, TRPA1 and TRPM8 genes. DRG were harvested from normal rats at the age of 3 months, and subjected to ChIP analysis with anti-zbtb20 monoclonal antibody 9A10. Isotype control IgG and anti-acetyl-histone H3 (ah3) were used as negative and positive control, respectively. (a) Conventional PCR analysis was performed to determine the association of ZBTB20 with the promoter regions of TRPV1 (C1), TRPA1 (C1) and TRPM8 (C1). Genomic DNA from DRG was used as input control. (b) Quantitative PCR-based ChIP analysis did not show any significant enrichment of ZBTB20 on the promoters of rat TRPV1, TRPA1 and TRPM8 genes with primers set listed in Supplementary Table 1. Conventional PCR and quantitative PCR-based ChIP analysis were performed for 3 times. Data were analyzed by Student s t-test. Values are the mean ± s.e.m. 7
Supplementary Figure 8. Balance and motor coordination of the control and PN-ZB20KO mice on the raised beams. (a,b) The latency to cross and the number of footslips were no difference between control (n=14) and PN-ZB20KO (n=11) mice on the trail of graded square beams. (c,d) The latency to cross and the number of footslips were no difference between control (n=14) and PN-ZB20KO (n=11) mice on the trail of graded round beams. All data were analyzed by Student s t-test. Values are the mean ± s.e.m. 8
Supplementary Figure 9. Both PN-ZB20KO and NS-ZB20KO mice show impaired behavioral responses to noxious thermal stimuli. Response latencies in the hot plate test. PN-ZB20KO mice had normal withdrawal latencies at temperatures 50 C, but had significantly longer withdrawal latencies than wild-type littermates at temperatures 52.5 C and 55 C. NS-ZB20KO mice had significantly longer withdrawal latencies than PN-ZB20KO mice at temperatures 52.5 C and 55 C. Data were analyzed by ANOVA followed by post hoc comparisons. *P < 0.05 vs control, **P < 0.01 vs control, # P < 0.01 vs PN-ZB20KO. Values are the mean ± s.e.m. 9
Supplementary Figure 10. Pain behavior of control and PN-ZB20KO mice after intraplantar injection of 20 μl of 5% formalin. (a) Time course of the formalin-induced response (licking/biting). (b) Time spent licking/biting the injected hindpaw in phase I (1 10 min) and phase II (10 60 min) after injection of formalin. Data were analyzed by Student s t-test.values are the mean ± s.e.m 10
Supplementary Figure 11. Unedited full blots of Figure 2b. 11
Supplementary Figure 12. Unedited full blots of Figure 5c. 12
Genes Primer sets Orientation Sequence (5 to 3 ) Position* PCR product TRPV1 C1 Forward gacactgggctttgcatctctgg -398 299 bp Reverse ctctgggcatactctggcactcaa -100 C2 Forward gcactgggggaggcgagaaat -622 373 bp Reverse gccagggcagaggagcacttag -250 C3 Forward cccctgcccatggttgttactg -1318 332 bp Reverse acccctcaccccacctctccata -987 C4 Forward gccgagttgccgagttttctgtaa -2545 241 bp Reverse gggaccgggaggcttttcatcta -2305 TRPA1 C1 Forward aagagcaccccaccctgacc -222 433 bp Reverse acccggactcccctttttga +211 C2 Forward gaaaggccgaggtggtaaggat -1535 291 bp Reverse gaagcccaaagacaacaaaggaat -1245 TRPM8 C1 Forward Reverse ttttaaaatgtgccaccaactgta gccccgcctcccgcactaag -337-75 263 bp * Position indicated in base pairs relative to the transcription starting site (+1). Supplementary Table 1. Sequence of the primers used for ChIP analysis of rat TRP channel genes. 13